Starting /dee2/code/volunteer_pipeline.sh ERR5052714 current disk space = 1525779701760 free memory = 1561075508 ERR5052714 SRAfilesize ca051cd8e72df4e1bcc175ae296bb15e ERR5052714.sra ERR5052714.sra file validated ERR5052714 is paired end ERR5052714 is conventional basespace ERR5052714 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052714_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.33575 35.0 35.0 35.0 35.0 35.0 2 34.60325 35.0 35.0 35.0 35.0 35.0 3 34.642 35.0 35.0 35.0 35.0 35.0 4 34.63375 35.0 35.0 35.0 35.0 35.0 5 34.61075 35.0 35.0 35.0 35.0 35.0 6 39.32 40.0 40.0 40.0 39.0 40.0 7 39.3775 40.0 40.0 40.0 39.0 40.0 8 39.30775 40.0 40.0 40.0 39.0 40.0 9 39.317 40.0 40.0 40.0 39.0 40.0 10 39.352 40.0 40.0 40.0 39.0 40.0 11 39.29175 40.0 40.0 40.0 39.0 40.0 12 39.29475 40.0 40.0 40.0 39.0 40.0 13 39.3345 40.0 40.0 40.0 39.0 40.0 14 39.27075 40.0 40.0 40.0 39.0 40.0 15 39.3815 40.0 40.0 40.0 39.0 40.0 16 39.36325 40.0 40.0 40.0 39.0 40.0 17 39.351 40.0 40.0 40.0 39.0 40.0 18 39.351 40.0 40.0 40.0 39.0 40.0 19 39.33175 40.0 40.0 40.0 39.0 40.0 20 39.30725 40.0 40.0 40.0 39.0 40.0 21 39.3455 40.0 40.0 40.0 39.0 40.0 22 39.27575 40.0 40.0 40.0 39.0 40.0 23 39.27975 40.0 40.0 40.0 39.0 40.0 24 39.19475 40.0 40.0 40.0 39.0 40.0 25 39.29575 40.0 40.0 40.0 39.0 40.0 26 39.18375 40.0 40.0 40.0 39.0 40.0 27 39.22225 40.0 40.0 40.0 39.0 40.0 28 39.237 40.0 40.0 40.0 39.0 40.0 29 39.2215 40.0 40.0 40.0 39.0 40.0 30 39.27075 40.0 40.0 40.0 39.0 40.0 31 39.24575 40.0 40.0 40.0 39.0 40.0 32 39.251 40.0 40.0 40.0 39.0 40.0 33 39.2765 40.0 40.0 40.0 39.0 40.0 34 39.22425 40.0 40.0 40.0 39.0 40.0 35 39.25 40.0 40.0 40.0 39.0 40.0 36 39.25025 40.0 40.0 40.0 39.0 40.0 37 39.34225 40.0 40.0 40.0 39.0 40.0 38 39.27025 40.0 40.0 40.0 39.0 40.0 39 39.2605 40.0 40.0 40.0 39.0 40.0 40 39.26825 40.0 40.0 40.0 39.0 40.0 41 39.174 40.0 40.0 40.0 39.0 40.0 42 39.20625 40.0 40.0 40.0 39.0 40.0 43 39.25575 40.0 40.0 40.0 39.0 40.0 44 39.2365 40.0 40.0 40.0 39.0 40.0 45 39.24525 40.0 40.0 40.0 39.0 40.0 46 39.26375 40.0 40.0 40.0 39.0 40.0 47 39.2625 40.0 40.0 40.0 39.0 40.0 48 39.21275 40.0 40.0 40.0 39.0 40.0 49 39.2325 40.0 40.0 40.0 39.0 40.0 50 39.22025 40.0 40.0 40.0 39.0 40.0 51 39.235 40.0 40.0 40.0 39.0 40.0 52 39.219 40.0 40.0 40.0 39.0 40.0 53 39.1955 40.0 40.0 40.0 39.0 40.0 54 39.19425 40.0 40.0 40.0 39.0 40.0 55 39.18825 40.0 40.0 40.0 39.0 40.0 56 39.1985 40.0 40.0 40.0 39.0 40.0 57 39.19975 40.0 40.0 40.0 39.0 40.0 58 39.19375 40.0 40.0 40.0 39.0 40.0 59 39.1675 40.0 40.0 40.0 39.0 40.0 60 39.1475 40.0 40.0 40.0 39.0 40.0 61 39.1785 40.0 40.0 40.0 39.0 40.0 62 39.215 40.0 40.0 40.0 39.0 40.0 63 39.18 40.0 40.0 40.0 39.0 40.0 64 39.17925 40.0 40.0 40.0 39.0 40.0 65 39.239 40.0 40.0 40.0 39.0 40.0 66 39.2215 40.0 40.0 40.0 39.0 40.0 67 39.234 40.0 40.0 40.0 39.0 40.0 68 39.1705 40.0 40.0 40.0 39.0 40.0 69 39.18725 40.0 40.0 40.0 39.0 40.0 70 39.22375 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 1.0 25 1.0 26 12.0 27 9.0 28 21.0 29 16.0 30 18.0 31 24.0 32 21.0 33 32.0 34 48.0 35 61.0 36 72.0 37 105.0 38 269.0 39 3288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.074589127686476 10.644753476611884 13.982300884955754 44.29835651074589 2 23.075000000000003 11.924999999999999 32.35 32.65 3 20.724999999999998 16.675 24.0 38.6 4 24.325 22.75 23.375 29.549999999999997 5 24.875 28.849999999999998 26.400000000000002 19.875 6 20.625 27.750000000000004 29.425 22.2 7 19.0 25.1 36.7 19.2 8 19.825 21.55 32.45 26.174999999999997 9 18.5 26.400000000000002 32.35 22.75 10 21.6 31.2 24.7 22.5 11 23.5 25.2 24.375 26.924999999999997 12 22.95 23.825 27.075 26.150000000000002 13 23.125 25.1 28.275 23.5 14 22.125 24.7 27.6 25.575 15 22.325 25.35 26.05 26.275 16 21.825 25.174999999999997 26.0 27.0 17 22.8 25.724999999999998 25.174999999999997 26.3 18 22.650000000000002 25.724999999999998 26.325 25.3 19 23.775 25.474999999999998 24.75 26.0 20 23.025000000000002 25.15 25.25 26.575 21 21.8 26.924999999999997 26.25 25.025 22 22.825 26.35 26.025 24.8 23 22.15 25.4 26.575 25.874999999999996 24 22.275 24.9 27.474999999999998 25.35 25 22.575 23.974999999999998 26.3 27.150000000000002 26 22.400000000000002 26.400000000000002 25.85 25.35 27 23.45 25.324999999999996 25.224999999999998 26.0 28 22.95 25.5 25.650000000000002 25.900000000000002 29 22.325 26.900000000000002 24.45 26.325 30 22.475 25.650000000000002 26.1 25.775 31 22.925 25.3 26.025 25.75 32 22.225 24.675 26.025 27.075 33 22.725 25.1 25.55 26.625 34 23.65 25.174999999999997 26.400000000000002 24.775 35 23.5 25.474999999999998 25.85 25.174999999999997 36 22.375 25.074999999999996 26.55 26.0 37 23.1 24.925 26.450000000000003 25.525 38 22.6 26.05 26.224999999999998 25.124999999999996 39 22.85 25.624999999999996 25.900000000000002 25.624999999999996 40 23.1 25.724999999999998 25.4 25.775 41 23.95 24.525 26.05 25.474999999999998 42 22.35 24.325 26.5 26.825 43 21.875 24.975 27.200000000000003 25.95 44 22.775000000000002 24.175 26.375 26.674999999999997 45 22.575 25.4 26.174999999999997 25.85 46 22.95 24.65 26.424999999999997 25.974999999999998 47 23.425 24.474999999999998 26.25 25.85 48 23.225 25.775 25.75 25.25 49 23.474999999999998 24.675 25.724999999999998 26.125 50 23.575 25.4 25.924999999999997 25.1 51 22.375 24.474999999999998 25.5 27.650000000000002 52 22.45 26.125 25.7 25.724999999999998 53 22.55 25.0 26.375 26.075 54 23.75 25.45 25.6 25.2 55 23.474999999999998 25.2 24.625 26.700000000000003 56 23.200000000000003 26.325 24.15 26.325 57 22.575 26.8 24.7 25.924999999999997 58 22.900000000000002 25.0 25.900000000000002 26.200000000000003 59 23.474999999999998 26.724999999999998 25.825 23.974999999999998 60 21.955488872218055 25.081270317579396 27.031757939484873 25.93148287071768 61 23.50587646911728 24.131032758189548 25.506376594148538 26.85671417854464 62 22.255563890972745 25.581395348837212 26.03150787696924 26.131532883220803 63 23.13078269567392 25.206301575393848 24.656164041010253 27.00675168792198 64 23.280820205051263 25.531382845711427 25.35633908477119 25.831457864466117 65 23.58089522380595 26.506626656664167 24.131032758189548 25.78144536134033 66 21.718436873747496 24.549098196392784 26.753507014028056 26.978957915831664 67 23.00729192858939 24.893135529293435 25.79834045763138 26.301232084485793 68 23.368313283849503 24.699257742513435 25.646275915024315 26.286153058612747 69 22.398251843758533 20.868615132477466 29.363561868341982 27.36957115542202 70 24.80762183950165 0.0 36.86331989739832 38.32905826310004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 1.0 26 5.5 27 10.0 28 10.5 29 10.5 30 10.0 31 17.0 32 32.5 33 41.0 34 48.5 35 74.0 36 102.0 37 112.0 38 136.5 39 174.0 40 187.0 41 198.0 42 245.0 43 281.0 44 290.0 45 288.0 46 289.5 47 302.0 48 279.0 49 240.0 50 224.0 51 218.0 52 194.5 53 177.0 54 158.5 55 137.0 56 128.0 57 122.0 58 105.5 59 89.0 60 89.0 61 86.5 62 81.5 63 79.0 64 72.0 65 58.0 66 49.0 67 47.0 68 46.0 69 41.0 70 37.0 71 34.5 72 21.0 73 10.0 74 10.5 75 9.5 76 7.5 77 7.0 78 4.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.2 67 0.575 68 2.325 69 8.475000000000001 70 31.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052714 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052714_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.31825 35.0 35.0 35.0 33.0 35.0 2 34.1525 35.0 35.0 35.0 33.0 35.0 3 34.07525 35.0 35.0 35.0 33.0 35.0 4 33.92175 35.0 35.0 35.0 32.0 35.0 5 33.937 35.0 35.0 35.0 32.0 35.0 6 38.494 40.0 40.0 40.0 36.0 40.0 7 38.4015 40.0 40.0 40.0 36.0 40.0 8 38.4295 40.0 40.0 40.0 36.0 40.0 9 38.5455 40.0 40.0 40.0 37.0 40.0 10 38.53675 40.0 40.0 40.0 36.0 40.0 11 38.585 40.0 40.0 40.0 37.0 40.0 12 38.58225 40.0 40.0 40.0 37.0 40.0 13 38.52025 40.0 40.0 40.0 36.0 40.0 14 38.48825 40.0 40.0 40.0 36.0 40.0 15 38.60125 40.0 40.0 40.0 37.0 40.0 16 38.52775 40.0 40.0 40.0 36.0 40.0 17 38.53075 40.0 40.0 40.0 36.0 40.0 18 38.51625 40.0 40.0 40.0 37.0 40.0 19 38.49725 40.0 40.0 40.0 37.0 40.0 20 38.463 40.0 40.0 40.0 36.0 40.0 21 38.464 40.0 40.0 40.0 36.0 40.0 22 38.528 40.0 40.0 40.0 36.0 40.0 23 38.56175 40.0 40.0 40.0 37.0 40.0 24 38.5235 40.0 40.0 40.0 36.0 40.0 25 38.5125 40.0 40.0 40.0 36.0 40.0 26 38.5455 40.0 40.0 40.0 36.0 40.0 27 38.4275 40.0 40.0 40.0 36.0 40.0 28 38.46 40.0 40.0 40.0 36.0 40.0 29 38.566 40.0 40.0 40.0 36.0 40.0 30 38.44 40.0 40.0 40.0 37.0 40.0 31 38.45075 40.0 40.0 40.0 36.0 40.0 32 38.5275 40.0 40.0 40.0 37.0 40.0 33 38.533 40.0 40.0 40.0 37.0 40.0 34 38.467 40.0 40.0 40.0 37.0 40.0 35 38.516 40.0 40.0 40.0 37.0 40.0 36 38.41675 40.0 40.0 40.0 36.0 40.0 37 38.51 40.0 40.0 40.0 36.0 40.0 38 38.49325 40.0 40.0 40.0 36.0 40.0 39 38.45675 40.0 40.0 40.0 36.0 40.0 40 38.464 40.0 40.0 40.0 36.0 40.0 41 38.48475 40.0 40.0 40.0 36.0 40.0 42 38.5975 40.0 40.0 40.0 37.0 40.0 43 38.404 40.0 40.0 40.0 36.0 40.0 44 38.41125 40.0 40.0 40.0 36.0 40.0 45 38.44375 40.0 40.0 40.0 36.0 40.0 46 38.477 40.0 40.0 40.0 36.0 40.0 47 38.458 40.0 40.0 40.0 36.0 40.0 48 38.39875 40.0 40.0 40.0 36.0 40.0 49 38.3225 40.0 40.0 40.0 36.0 40.0 50 38.38775 40.0 40.0 40.0 36.0 40.0 51 38.284 40.0 40.0 40.0 36.0 40.0 52 38.27925 40.0 39.0 40.0 36.0 40.0 53 38.354 40.0 39.0 40.0 36.0 40.0 54 38.3095 40.0 39.0 40.0 36.0 40.0 55 38.33325 40.0 40.0 40.0 36.0 40.0 56 38.423 40.0 40.0 40.0 36.0 40.0 57 38.34575 40.0 40.0 40.0 36.0 40.0 58 38.396 40.0 40.0 40.0 36.0 40.0 59 38.32875 40.0 40.0 40.0 36.0 40.0 60 38.406 40.0 40.0 40.0 36.0 40.0 61 38.35 40.0 40.0 40.0 36.0 40.0 62 38.32175 40.0 40.0 40.0 36.0 40.0 63 38.3 40.0 40.0 40.0 36.0 40.0 64 38.305 40.0 40.0 40.0 36.0 40.0 65 38.3865 40.0 40.0 40.0 36.0 40.0 66 38.281 40.0 39.0 40.0 36.0 40.0 67 38.2875 40.0 40.0 40.0 35.0 40.0 68 38.32625 40.0 39.0 40.0 36.0 40.0 69 38.326 40.0 39.0 40.0 36.0 40.0 70 38.33375 40.0 39.0 40.0 36.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 7.0 18 7.0 19 17.0 20 24.0 21 18.0 22 21.0 23 19.0 24 23.0 25 18.0 26 32.0 27 18.0 28 18.0 29 19.0 30 24.0 31 34.0 32 35.0 33 30.0 34 40.0 35 58.0 36 65.0 37 106.0 38 228.0 39 3138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.575 19.975 17.9 33.550000000000004 2 27.750000000000004 26.325 25.174999999999997 20.75 3 21.099999999999998 26.650000000000002 25.85 26.400000000000002 4 24.675 29.625 22.125 23.575 5 25.924999999999997 32.625 22.05 19.400000000000002 6 21.775 31.225 24.825 22.175 7 24.075 20.474999999999998 31.874999999999996 23.575 8 22.975 23.225 27.250000000000004 26.55 9 23.549999999999997 24.349999999999998 27.1 25.0 10 25.7 28.000000000000004 23.05 23.25 11 28.375 22.975 21.475 27.175 12 26.174999999999997 22.275 23.95 27.6 13 25.8 24.775 24.375 25.05 14 25.25 25.924999999999997 24.05 24.775 15 25.874999999999996 25.25 24.8 24.075 16 25.75 24.725 24.325 25.2 17 27.875 24.9 23.625 23.599999999999998 18 25.0 25.95 24.725 24.325 19 25.324999999999996 24.224999999999998 23.625 26.825 20 25.85 27.6 23.400000000000002 23.150000000000002 21 25.25 25.05 25.3 24.4 22 25.974999999999998 24.725 24.925 24.375 23 26.775 25.5 24.975 22.75 24 24.375 26.400000000000002 24.474999999999998 24.75 25 26.5 24.224999999999998 24.65 24.625 26 26.35 24.775 24.775 24.099999999999998 27 25.15 26.35 24.55 23.95 28 27.450000000000003 24.425 23.175 24.95 29 26.075 25.35 23.875 24.7 30 26.0 25.45 24.55 24.0 31 26.674999999999997 25.174999999999997 23.125 25.025 32 26.075 26.174999999999997 24.099999999999998 23.65 33 24.4 24.875 25.7 25.025 34 26.525 23.75 25.3 24.425 35 25.75 25.874999999999996 24.125 24.25 36 24.525 25.674999999999997 25.924999999999997 23.875 37 27.35 23.3 24.65 24.7 38 26.325 25.674999999999997 24.3 23.7 39 25.424999999999997 25.8 24.525 24.25 40 26.775 23.575 25.324999999999996 24.325 41 26.075 25.224999999999998 24.325 24.375 42 24.4 23.925 26.650000000000002 25.025 43 25.775 24.7 25.05 24.474999999999998 44 26.200000000000003 26.25 23.575 23.974999999999998 45 24.275 25.275 26.625 23.825 46 26.525 24.85 24.025 24.6 47 26.400000000000002 25.275 24.25 24.075 48 25.474999999999998 24.675 24.95 24.9 49 26.6 25.15 24.9 23.35 50 26.174999999999997 26.55 23.65 23.625 51 25.1 25.674999999999997 25.1 24.125 52 26.1 25.7 24.224999999999998 23.974999999999998 53 26.900000000000002 24.65 24.775 23.674999999999997 54 24.525 26.575 25.374999999999996 23.525 55 26.974999999999998 24.875 25.074999999999996 23.075000000000003 56 26.075 25.95 24.875 23.1 57 25.1 26.525 25.0 23.375 58 26.325 25.2 24.925 23.549999999999997 59 25.825 25.324999999999996 25.650000000000002 23.200000000000003 60 25.724999999999998 25.124999999999996 24.9 24.25 61 27.3 24.575 24.65 23.474999999999998 62 26.05 26.775 23.9 23.275000000000002 63 25.8 25.074999999999996 25.825 23.3 64 26.174999999999997 24.775 24.2 24.85 65 26.450000000000003 26.674999999999997 24.05 22.825 66 25.60700876095119 25.456821026282856 25.481852315394242 23.454317897371716 67 26.326376665828516 24.1136535076691 25.245159668091528 24.314810158410864 68 25.996400102854206 25.27642067369504 24.50501414245307 24.222165080997684 69 25.236242356864924 19.53863257365203 28.01556420233463 27.209560867148415 70 26.613816534541336 0.0 36.655341638354095 36.73084182710456 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.5 15 2.5 16 2.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 2.0 26 4.0 27 6.0 28 5.5 29 12.0 30 19.0 31 20.0 32 28.0 33 35.0 34 45.5 35 70.0 36 92.5 37 101.0 38 120.0 39 158.5 40 178.0 41 199.0 42 225.5 43 231.0 44 239.5 45 271.5 46 279.0 47 263.0 48 245.0 49 224.0 50 221.0 51 209.0 52 184.5 53 172.0 54 167.0 55 151.0 56 134.5 57 129.0 58 120.0 59 94.5 60 78.0 61 89.5 62 104.0 63 107.0 64 90.5 65 80.5 66 82.0 67 77.0 68 63.5 69 47.0 70 44.0 71 41.0 72 31.5 73 25.0 74 21.5 75 16.0 76 11.0 77 8.0 78 5.5 79 1.5 80 0.0 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.125 67 0.575 68 2.775 69 10.05 70 33.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra Read 202655 spots for ERR5052714.sra Written 202655 spots for ERR5052714.sra SRR ids: ['ERR5052714.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cx1s3mnh ERR5052714.sra spots: 4053100 blocks: [[1, 202655], [202656, 405310], [405311, 607965], [607966, 810620], [810621, 1013275], [1013276, 1215930], [1215931, 1418585], [1418586, 1621240], [1621241, 1823895], [1823896, 2026550], [2026551, 2229205], [2229206, 2431860], [2431861, 2634515], [2634516, 2837170], [2837171, 3039825], [3039826, 3242480], [3242481, 3445135], [3445136, 3647790], [3647791, 3850445], [3850446, 4053100]] ERR5052714 file size 718206 ERR5052714 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052714 ERR5052714_1.fastq ERR5052714_2.fastq Input file: ERR5052714_1.fastq Paired file: ERR5052714_2.fastq trimmed: ERR5052714-trimmed-pair1.fastq, ERR5052714-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:45:47 2024 >> started Tue Dec 10 05:45:51 2024 >> done (3.764s) 4053100 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 183 ( 0.00%) empty read pairs filtered out after trimming by size control 4052917 (100.00%) read pairs available; of these: 7 ( 0.00%) trimmed read pairs available after processing 4052910 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 5 0.00% 70 4052910 100.00% 4052917 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=119.87 fanout-score-rank=7 prefix-density=0.39 prefix-fanout=20.6 sequence=CCTTCTTCTTGTGCTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=529.08 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=32.1 sequence=CTTCTTCTTCTG criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=114.03 fanout-score-rank=11 prefix-density=0.78 prefix-fanout=17.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=574.61 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=16.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA ERR5052714 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:46:24 Started mapping on | Dec 10 05:46:24 Finished on | Dec 10 05:46:38 Mapping speed, Million of reads per hour | 1042.18 Number of input reads | 4052917 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3866176 Uniquely mapped reads % | 95.39% Average mapped length | 138.72 Number of splices: Total | 1968649 Number of splices: Annotated (sjdb) | 1867723 Number of splices: GT/AG | 1941028 Number of splices: GC/AG | 24304 Number of splices: AT/AC | 1433 Number of splices: Non-canonical | 1884 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 55355 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 5119 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 131386 131386 131386 N_multimapping 55355 55355 55355 N_noFeature 121867 3779947 144783 N_ambiguous 72235 414 9109 UnstrandedReadsAssigned:3672074 PositiveStrandReadsAssigned:85815 NegativeStrandReadsAssigned:3712284 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052714 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052714-trimmed-pair1.fastq ERR5052714-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,052,917 reads, 3,812,170 reads pseudoaligned [quant] estimated average fragment length: 204.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 ERR5052714.ke.tsv 35125 ERR5052714.se.tsv 88098 total ==> ERR5052714.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.627 14.2796 7.79054 PNS24247 1044 840.351 8.84285 4.20596 PNS24249 1928 1724.35 20.191 4.68021 PNS24246 1044 840.351 8.84285 4.20596 PNS24248 1044 840.351 8.84285 4.20596 PNS24244 1471 1267.35 45.0009 14.1924 PNS24243 293 116.169 0 0 KQK14069 1603 1399.35 1828.08 522.158 KQK14071 474 275.264 52.0658 75.6025 ==> ERR5052714.se.tsv <== BRADI_1g14170v3 2227 BRADI_1g53295v3 25 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 242 BRADI_1g74790v3 26 BRADI_1g09890v3 0 BRADI_1g77505v3 55 BRADI_1g48960v3 0 ERR5052714 completed mapping pipeline successfully