Starting /dee2/code/volunteer_pipeline.sh ERR5052715 current disk space = 1525818425344 free memory = 1560662048 ERR5052715 SRAfilesize 7ed1b3fcd5b7b10cae26dec02d422e86 ERR5052715.sra ERR5052715.sra file validated ERR5052715 is paired end ERR5052715 is conventional basespace ERR5052715 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052715_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.41325 35.0 35.0 35.0 35.0 35.0 2 34.6075 35.0 35.0 35.0 35.0 35.0 3 34.65625 35.0 35.0 35.0 35.0 35.0 4 34.64575 35.0 35.0 35.0 35.0 35.0 5 34.645 35.0 35.0 35.0 35.0 35.0 6 39.4095 40.0 40.0 40.0 39.0 40.0 7 39.38625 40.0 40.0 40.0 39.0 40.0 8 39.338 40.0 40.0 40.0 39.0 40.0 9 39.383 40.0 40.0 40.0 39.0 40.0 10 39.39575 40.0 40.0 40.0 39.0 40.0 11 39.35875 40.0 40.0 40.0 39.0 40.0 12 39.36525 40.0 40.0 40.0 39.0 40.0 13 39.31925 40.0 40.0 40.0 39.0 40.0 14 39.418 40.0 40.0 40.0 39.0 40.0 15 39.35725 40.0 40.0 40.0 39.0 40.0 16 39.3495 40.0 40.0 40.0 39.0 40.0 17 39.326 40.0 40.0 40.0 39.0 40.0 18 39.31825 40.0 40.0 40.0 39.0 40.0 19 39.32225 40.0 40.0 40.0 39.0 40.0 20 39.3485 40.0 40.0 40.0 39.0 40.0 21 39.35525 40.0 40.0 40.0 39.0 40.0 22 39.26075 40.0 40.0 40.0 39.0 40.0 23 39.3055 40.0 40.0 40.0 39.0 40.0 24 39.29 40.0 40.0 40.0 39.0 40.0 25 39.3025 40.0 40.0 40.0 39.0 40.0 26 39.24325 40.0 40.0 40.0 39.0 40.0 27 39.23725 40.0 40.0 40.0 39.0 40.0 28 39.26925 40.0 40.0 40.0 39.0 40.0 29 39.228 40.0 40.0 40.0 39.0 40.0 30 39.2685 40.0 40.0 40.0 39.0 40.0 31 39.25075 40.0 40.0 40.0 39.0 40.0 32 39.23375 40.0 40.0 40.0 39.0 40.0 33 39.32175 40.0 40.0 40.0 39.0 40.0 34 39.27425 40.0 40.0 40.0 39.0 40.0 35 39.23075 40.0 40.0 40.0 39.0 40.0 36 39.27825 40.0 40.0 40.0 39.0 40.0 37 39.28475 40.0 40.0 40.0 39.0 40.0 38 39.29475 40.0 40.0 40.0 39.0 40.0 39 39.2465 40.0 40.0 40.0 39.0 40.0 40 39.23025 40.0 40.0 40.0 39.0 40.0 41 39.1525 40.0 40.0 40.0 39.0 40.0 42 39.217 40.0 40.0 40.0 39.0 40.0 43 39.3055 40.0 40.0 40.0 39.0 40.0 44 39.27725 40.0 40.0 40.0 39.0 40.0 45 39.308 40.0 40.0 40.0 39.0 40.0 46 39.218 40.0 40.0 40.0 39.0 40.0 47 39.11575 40.0 40.0 40.0 38.0 40.0 48 39.20875 40.0 40.0 40.0 39.0 40.0 49 39.249 40.0 40.0 40.0 39.0 40.0 50 39.29125 40.0 40.0 40.0 39.0 40.0 51 39.28075 40.0 40.0 40.0 39.0 40.0 52 39.26475 40.0 40.0 40.0 39.0 40.0 53 39.29975 40.0 40.0 40.0 39.0 40.0 54 39.257 40.0 40.0 40.0 39.0 40.0 55 39.24625 40.0 40.0 40.0 39.0 40.0 56 39.19775 40.0 40.0 40.0 39.0 40.0 57 39.16375 40.0 40.0 40.0 38.0 40.0 58 39.17675 40.0 40.0 40.0 39.0 40.0 59 39.2265 40.0 40.0 40.0 39.0 40.0 60 39.27775 40.0 40.0 40.0 39.0 40.0 61 39.271 40.0 40.0 40.0 39.0 40.0 62 39.20225 40.0 40.0 40.0 39.0 40.0 63 39.22325 40.0 40.0 40.0 39.0 40.0 64 39.209 40.0 40.0 40.0 39.0 40.0 65 39.22075 40.0 40.0 40.0 39.0 40.0 66 39.246 40.0 40.0 40.0 39.0 40.0 67 39.22 40.0 40.0 40.0 39.0 40.0 68 39.21075 40.0 40.0 40.0 39.0 40.0 69 39.21875 40.0 40.0 40.0 39.0 40.0 70 39.25075 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 5.0 27 9.0 28 14.0 29 13.0 30 21.0 31 35.0 32 28.0 33 37.0 34 38.0 35 53.0 36 78.0 37 133.0 38 232.0 39 3302.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.34274193548387 10.58467741935484 13.432459677419356 45.640120967741936 2 22.255563890972745 13.15328832208052 30.707676919229808 33.88347086771693 3 20.05 16.650000000000002 25.374999999999996 37.925 4 24.9 22.2 23.674999999999997 29.225 5 24.775 28.050000000000004 26.174999999999997 21.0 6 21.05 26.6 30.525000000000002 21.825 7 20.625 23.65 36.8 18.925 8 19.950000000000003 23.05 32.275 24.725 9 18.325 25.275 33.75 22.650000000000002 10 21.4 30.175 25.924999999999997 22.5 11 24.975 23.825 23.7 27.500000000000004 12 21.65 23.7 28.15 26.5 13 23.3 25.25 27.400000000000002 24.05 14 23.1 24.85 26.3 25.75 15 21.375 25.55 27.224999999999998 25.85 16 22.925 26.5 25.224999999999998 25.35 17 23.95 24.85 26.55 24.65 18 23.1 25.5 25.025 26.375 19 23.575 24.875 25.900000000000002 25.650000000000002 20 23.674999999999997 25.724999999999998 24.375 26.224999999999998 21 22.275 25.374999999999996 26.3 26.05 22 23.05 26.55 25.1 25.3 23 23.0 25.85 26.224999999999998 24.925 24 21.55 25.124999999999996 25.674999999999997 27.650000000000002 25 22.625 25.3 26.05 26.025 26 21.825 25.3 26.85 26.025 27 22.5 24.175 27.250000000000004 26.075 28 23.925 25.25 24.575 26.25 29 22.125 25.324999999999996 25.650000000000002 26.900000000000002 30 22.1 25.825 26.375 25.7 31 23.075000000000003 25.074999999999996 26.724999999999998 25.124999999999996 32 23.0 26.450000000000003 25.75 24.8 33 21.675 25.650000000000002 26.6 26.075 34 22.3 26.375 24.625 26.700000000000003 35 22.85 25.575 26.450000000000003 25.124999999999996 36 22.775000000000002 25.25 25.124999999999996 26.85 37 22.35 25.1 26.275 26.275 38 22.650000000000002 25.724999999999998 26.0 25.624999999999996 39 23.325000000000003 25.825 24.0 26.85 40 22.675 25.575 25.374999999999996 26.375 41 22.975 25.8 25.974999999999998 25.25 42 22.55 24.175 26.150000000000002 27.125 43 22.875 24.7 26.275 26.150000000000002 44 23.45 24.349999999999998 26.950000000000003 25.25 45 21.75 25.75 26.325 26.174999999999997 46 23.5 25.124999999999996 25.124999999999996 26.25 47 22.175 25.8 25.924999999999997 26.1 48 23.225 26.3 26.224999999999998 24.25 49 23.525 25.324999999999996 26.224999999999998 24.925 50 23.175 25.525 26.200000000000003 25.1 51 23.400000000000002 26.125 25.4 25.074999999999996 52 23.849999999999998 24.575 26.400000000000002 25.174999999999997 53 24.875 24.75 25.2 25.174999999999997 54 23.025000000000002 24.15 26.875 25.95 55 22.6 25.525 25.75 26.125 56 23.125 24.875 26.825 25.174999999999997 57 22.575 25.0 26.5 25.924999999999997 58 23.525 25.124999999999996 25.374999999999996 25.974999999999998 59 23.549999999999997 25.275 25.0 26.174999999999997 60 22.3 26.0 25.575 26.125 61 22.55563890972743 26.106526631657918 24.681170292573142 26.65666416604151 62 22.83070767691923 26.081520380095025 26.006501625406354 25.081270317579396 63 22.380595148787197 25.006251562890725 26.531632908227053 26.081520380095025 64 22.080520130032507 24.381095273818453 26.106526631657918 27.431857964491122 65 23.111555777888945 25.587793896948476 27.41370685342671 23.88694347173587 66 23.24824824824825 24.64964964964965 26.7017017017017 25.400400400400404 67 23.43043696634857 24.63586137619287 24.962330487192368 26.971371170266195 68 24.464831804281346 23.623853211009173 25.458715596330272 26.452599388379205 69 24.02826855123675 20.358793150312586 27.724925251427017 27.888013047023648 70 24.301470588235293 0.0 38.125 37.5735294117647 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 3.5 27 3.0 28 8.0 29 13.5 30 14.0 31 23.5 32 41.0 33 49.0 34 53.0 35 74.5 36 94.5 37 97.0 38 116.5 39 161.0 40 186.0 41 209.5 42 241.0 43 249.0 44 261.5 45 270.0 46 289.0 47 312.0 48 296.5 49 256.5 50 232.0 51 223.5 52 202.5 53 190.0 54 178.5 55 148.0 56 123.0 57 117.0 58 110.0 59 97.0 60 91.0 61 84.5 62 77.5 63 77.0 64 65.0 65 58.0 66 55.0 67 47.0 68 44.0 69 42.5 70 44.0 71 33.5 72 18.5 73 14.0 74 10.0 75 4.5 76 3.5 77 4.0 78 3.0 79 1.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.8 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.1 67 0.44999999999999996 68 1.9 69 8.025 70 32.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052715 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052715_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.247 35.0 35.0 35.0 33.0 35.0 2 34.16075 35.0 35.0 35.0 33.0 35.0 3 33.9005 35.0 35.0 35.0 32.0 35.0 4 33.849 35.0 35.0 35.0 32.0 35.0 5 33.90275 35.0 35.0 35.0 32.0 35.0 6 38.43525 40.0 40.0 40.0 36.0 40.0 7 38.41525 40.0 40.0 40.0 36.0 40.0 8 38.2645 40.0 40.0 40.0 35.0 40.0 9 38.4235 40.0 40.0 40.0 36.0 40.0 10 38.44375 40.0 40.0 40.0 36.0 40.0 11 38.47925 40.0 40.0 40.0 36.0 40.0 12 38.42275 40.0 40.0 40.0 36.0 40.0 13 38.48875 40.0 40.0 40.0 36.0 40.0 14 38.419 40.0 40.0 40.0 36.0 40.0 15 38.4875 40.0 40.0 40.0 36.0 40.0 16 38.49125 40.0 40.0 40.0 37.0 40.0 17 38.47825 40.0 40.0 40.0 36.0 40.0 18 38.4945 40.0 40.0 40.0 36.0 40.0 19 38.437 40.0 40.0 40.0 36.0 40.0 20 38.434 40.0 40.0 40.0 36.0 40.0 21 38.48925 40.0 40.0 40.0 36.0 40.0 22 38.47125 40.0 40.0 40.0 36.0 40.0 23 38.421 40.0 40.0 40.0 36.0 40.0 24 38.46 40.0 40.0 40.0 37.0 40.0 25 38.5 40.0 40.0 40.0 36.0 40.0 26 38.426 40.0 40.0 40.0 36.0 40.0 27 38.43975 40.0 40.0 40.0 36.0 40.0 28 38.417 40.0 40.0 40.0 36.0 40.0 29 38.519 40.0 40.0 40.0 37.0 40.0 30 38.47675 40.0 40.0 40.0 37.0 40.0 31 38.512 40.0 40.0 40.0 37.0 40.0 32 38.40125 40.0 40.0 40.0 36.0 40.0 33 38.42425 40.0 40.0 40.0 36.0 40.0 34 38.44425 40.0 40.0 40.0 36.0 40.0 35 38.47175 40.0 40.0 40.0 36.0 40.0 36 38.40275 40.0 40.0 40.0 36.0 40.0 37 38.39525 40.0 40.0 40.0 36.0 40.0 38 38.38975 40.0 40.0 40.0 36.0 40.0 39 38.40575 40.0 40.0 40.0 36.0 40.0 40 38.51 40.0 40.0 40.0 36.0 40.0 41 38.4675 40.0 40.0 40.0 37.0 40.0 42 38.4275 40.0 40.0 40.0 36.0 40.0 43 38.3545 40.0 40.0 40.0 36.0 40.0 44 38.35025 40.0 40.0 40.0 36.0 40.0 45 38.411 40.0 40.0 40.0 36.0 40.0 46 38.39525 40.0 40.0 40.0 36.0 40.0 47 38.301 40.0 39.0 40.0 36.0 40.0 48 38.4095 40.0 40.0 40.0 36.0 40.0 49 38.41475 40.0 40.0 40.0 36.0 40.0 50 38.424 40.0 40.0 40.0 36.0 40.0 51 38.32275 40.0 40.0 40.0 36.0 40.0 52 38.3375 40.0 40.0 40.0 36.0 40.0 53 38.37525 40.0 40.0 40.0 36.0 40.0 54 38.30925 40.0 40.0 40.0 36.0 40.0 55 38.28925 40.0 40.0 40.0 36.0 40.0 56 38.31325 40.0 40.0 40.0 36.0 40.0 57 38.3115 40.0 40.0 40.0 36.0 40.0 58 38.3115 40.0 40.0 40.0 36.0 40.0 59 38.30875 40.0 39.0 40.0 36.0 40.0 60 38.41325 40.0 40.0 40.0 36.0 40.0 61 38.34975 40.0 40.0 40.0 36.0 40.0 62 38.31825 40.0 40.0 40.0 36.0 40.0 63 38.29775 40.0 40.0 40.0 36.0 40.0 64 38.254 40.0 39.0 40.0 36.0 40.0 65 38.26225 40.0 39.0 40.0 36.0 40.0 66 38.268 40.0 39.0 40.0 36.0 40.0 67 38.32175 40.0 39.0 40.0 36.0 40.0 68 38.3295 40.0 39.0 40.0 36.0 40.0 69 38.266 40.0 40.0 40.0 36.0 40.0 70 38.2455 40.0 39.0 40.0 36.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 4.0 18 9.0 19 18.0 20 34.0 21 31.0 22 27.0 23 17.0 24 25.0 25 23.0 26 12.0 27 22.0 28 15.0 29 21.0 30 27.0 31 22.0 32 28.0 33 32.0 34 37.0 35 38.0 36 69.0 37 108.0 38 242.0 39 3139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.575 20.599999999999998 17.375 34.449999999999996 2 28.925 25.6 25.874999999999996 19.6 3 20.325 27.725 27.05 24.9 4 24.725 29.425 22.475 23.375 5 25.974999999999998 32.675 22.175 19.175 6 22.380595148787197 30.182545636409102 24.131032758189548 23.305826456614152 7 24.075 19.775000000000002 32.1 24.05 8 22.15 22.900000000000002 27.1 27.85 9 22.225 25.3 27.85 24.625 10 26.400000000000002 28.675 22.575 22.35 11 27.250000000000004 23.825 21.3 27.625 12 24.0 23.9 24.7 27.400000000000002 13 27.05 24.05 25.2 23.7 14 26.200000000000003 24.474999999999998 24.425 24.9 15 24.975 25.374999999999996 25.1 24.55 16 26.724999999999998 24.825 25.275 23.175 17 26.625 24.8 23.625 24.95 18 24.375 25.974999999999998 25.074999999999996 24.575 19 26.224999999999998 25.75 24.4 23.625 20 26.35 25.5 23.825 24.325 21 24.95 26.85 23.674999999999997 24.525 22 25.775 26.174999999999997 24.625 23.425 23 25.424999999999997 24.725 25.45 24.4 24 24.825 26.1 24.825 24.25 25 27.425 25.35 24.25 22.975 26 25.874999999999996 25.25 24.15 24.725 27 24.725 25.424999999999997 25.55 24.3 28 25.25 25.45 25.074999999999996 24.224999999999998 29 24.224999999999998 26.125 25.124999999999996 24.525 30 25.0 25.05 26.85 23.1 31 25.3 25.05 25.374999999999996 24.275 32 27.200000000000003 24.85 25.124999999999996 22.825 33 25.825 25.75 24.175 24.25 34 25.324999999999996 25.474999999999998 24.85 24.349999999999998 35 24.95 26.625 25.025 23.400000000000002 36 24.65 25.8 25.775 23.775 37 24.975 24.875 24.925 25.224999999999998 38 25.275 25.474999999999998 23.775 25.474999999999998 39 25.474999999999998 24.875 24.925 24.725 40 24.4 25.474999999999998 24.55 25.575 41 25.45 25.974999999999998 24.75 23.825 42 25.374999999999996 25.35 25.275 24.0 43 25.825 25.224999999999998 24.425 24.525 44 26.5 24.675 24.65 24.175 45 24.675 25.55 25.3 24.474999999999998 46 26.400000000000002 25.5 24.4 23.7 47 24.8 26.174999999999997 25.674999999999997 23.35 48 26.650000000000002 24.3 26.224999999999998 22.825 49 25.825 26.55 24.05 23.575 50 27.075 25.8 23.025000000000002 24.099999999999998 51 25.825 25.25 25.674999999999997 23.25 52 25.974999999999998 24.95 25.275 23.799999999999997 53 26.025 24.85 24.4 24.725 54 25.025 25.55 25.224999999999998 24.2 55 25.074999999999996 25.650000000000002 25.4 23.875 56 26.200000000000003 24.425 24.65 24.725 57 24.4 25.4 24.45 25.75 58 26.275 24.925 26.525 22.275 59 26.625 26.5 24.75 22.125 60 26.025 26.400000000000002 23.799999999999997 23.775 61 26.474999999999998 25.374999999999996 25.95 22.2 62 25.474999999999998 26.0 25.25 23.275000000000002 63 25.575 27.0 24.15 23.275000000000002 64 26.224999999999998 25.95 24.8 23.025000000000002 65 25.99449587190393 25.769326995246434 24.418313735301474 23.817863397548162 66 26.197041865129105 24.868388067184757 25.520180496365004 23.414389571321134 67 26.108870967741936 25.982862903225808 25.30241935483871 22.605846774193548 68 25.574193548387097 24.129032258064516 25.083870967741934 25.21290322580645 69 25.862068965517242 19.49388209121246 28.337041156840936 26.307007786429367 70 29.716446124763706 0.0 36.06805293005671 34.215500945179585 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 2.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.5 26 3.0 27 2.0 28 4.5 29 6.5 30 6.0 31 13.0 32 29.0 33 38.0 34 56.0 35 72.5 36 100.0 37 129.0 38 152.5 39 172.0 40 168.0 41 195.5 42 225.5 43 228.0 44 247.0 45 263.5 46 270.0 47 279.0 48 260.0 49 228.0 50 215.0 51 210.5 52 183.5 53 161.0 54 161.5 55 149.0 56 121.5 57 107.0 58 109.5 59 107.0 60 102.0 61 97.0 62 94.5 63 97.0 64 92.5 65 79.0 66 61.0 67 52.0 68 57.0 69 50.5 70 39.0 71 37.0 72 29.0 73 23.0 74 19.5 75 12.0 76 6.5 77 5.0 78 2.5 79 1.5 80 3.0 81 1.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.075 66 0.27499999999999997 67 0.8 68 3.125 69 10.100000000000001 70 33.875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207714 spots for ERR5052715.sra Written 207714 spots for ERR5052715.sra Read 207722 spots for ERR5052715.sra Written 207722 spots for ERR5052715.sra SRR ids: ['ERR5052715.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nej01mft ERR5052715.sra spots: 4154288 blocks: [[1, 207714], [207715, 415428], [415429, 623142], [623143, 830856], [830857, 1038570], [1038571, 1246284], [1246285, 1453998], [1453999, 1661712], [1661713, 1869426], [1869427, 2077140], [2077141, 2284854], [2284855, 2492568], [2492569, 2700282], [2700283, 2907996], [2907997, 3115710], [3115711, 3323424], [3323425, 3531138], [3531139, 3738852], [3738853, 3946566], [3946567, 4154288]] ERR5052715 file size 736190 ERR5052715 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052715 ERR5052715_1.fastq ERR5052715_2.fastq Input file: ERR5052715_1.fastq Paired file: ERR5052715_2.fastq trimmed: ERR5052715-trimmed-pair1.fastq, ERR5052715-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:46:11 2024 >> started Tue Dec 10 05:46:15 2024 >> done (4.017s) 4154288 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 187 ( 0.00%) empty read pairs filtered out after trimming by size control 4154101 (100.00%) read pairs available; of these: 18 ( 0.00%) trimmed read pairs available after processing 4154083 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 16 0.00% 70 4154083 100.00% 4154101 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=120.66 fanout-score-rank=7 prefix-density=0.40 prefix-fanout=20.7 sequence=CCTTCTTCTTGTGCTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=490.49 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=31.7 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=110.83 fanout-score-rank=11 prefix-density=0.77 prefix-fanout=17.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=480.52 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=15.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA ERR5052715 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:46:50 Started mapping on | Dec 10 05:46:50 Finished on | Dec 10 05:47:06 Mapping speed, Million of reads per hour | 934.67 Number of input reads | 4154101 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3959402 Uniquely mapped reads % | 95.31% Average mapped length | 138.71 Number of splices: Total | 2017571 Number of splices: Annotated (sjdb) | 1915291 Number of splices: GT/AG | 1989752 Number of splices: GC/AG | 24433 Number of splices: AT/AC | 1453 Number of splices: Non-canonical | 1933 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 56710 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 5091 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 137989 137989 137989 N_multimapping 56710 56710 56710 N_noFeature 125934 3870957 149162 N_ambiguous 74642 422 9587 UnstrandedReadsAssigned:3758826 PositiveStrandReadsAssigned:88023 NegativeStrandReadsAssigned:3800653 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052715 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052715-trimmed-pair1.fastq ERR5052715-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,154,101 reads, 3,907,031 reads pseudoaligned [quant] estimated average fragment length: 204.786 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52973 ERR5052715.ke.tsv 35125 ERR5052715.se.tsv 88098 total ==> ERR5052715.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.568 0 0 PNS24247 1044 840.214 14.1469 6.57021 PNS24249 1928 1724.21 25.598 5.79325 PNS24246 1044 840.214 14.1469 6.57021 PNS24248 1044 840.214 14.1469 6.57021 PNS24244 1471 1267.21 30.9612 9.53399 PNS24243 293 116.539 0 0 KQK14069 1603 1399.21 1897.1 529.071 KQK14071 474 275.394 51.9355 73.5897 ==> ERR5052715.se.tsv <== BRADI_1g14170v3 2221 BRADI_1g53295v3 25 BRADI_1g59795v3 58 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 262 BRADI_1g74790v3 28 BRADI_1g09890v3 0 BRADI_1g77505v3 58 BRADI_1g48960v3 0 ERR5052715 completed mapping pipeline successfully