Starting /dee2/code/volunteer_pipeline.sh ERR5052716 current disk space = 1525896495104 free memory = 1597766028 ERR5052716 SRAfilesize 952822d804165c72c8a6e8b13f18f584 ERR5052716.sra ERR5052716.sra file validated ERR5052716 is paired end ERR5052716 is conventional basespace ERR5052716 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052716_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.27675 35.0 35.0 35.0 35.0 35.0 2 34.57325 35.0 35.0 35.0 35.0 35.0 3 34.53725 35.0 35.0 35.0 34.0 35.0 4 34.482 35.0 35.0 35.0 34.0 35.0 5 34.53175 35.0 35.0 35.0 34.0 35.0 6 39.24125 40.0 40.0 40.0 39.0 40.0 7 39.22175 40.0 40.0 40.0 39.0 40.0 8 39.1865 40.0 40.0 40.0 39.0 40.0 9 39.217 40.0 40.0 40.0 39.0 40.0 10 39.27825 40.0 40.0 40.0 39.0 40.0 11 39.257 40.0 40.0 40.0 39.0 40.0 12 39.15775 40.0 40.0 40.0 39.0 40.0 13 39.18025 40.0 40.0 40.0 39.0 40.0 14 39.22675 40.0 40.0 40.0 39.0 40.0 15 39.128 40.0 40.0 40.0 39.0 40.0 16 39.17525 40.0 40.0 40.0 39.0 40.0 17 39.1575 40.0 40.0 40.0 39.0 40.0 18 39.188 40.0 40.0 40.0 39.0 40.0 19 39.20575 40.0 40.0 40.0 39.0 40.0 20 39.123 40.0 40.0 40.0 39.0 40.0 21 39.163 40.0 40.0 40.0 39.0 40.0 22 39.1285 40.0 40.0 40.0 38.0 40.0 23 39.18675 40.0 40.0 40.0 39.0 40.0 24 39.07975 40.0 40.0 40.0 39.0 40.0 25 39.17625 40.0 40.0 40.0 38.0 40.0 26 39.057 40.0 40.0 40.0 38.0 40.0 27 39.12725 40.0 40.0 40.0 38.0 40.0 28 39.16675 40.0 40.0 40.0 39.0 40.0 29 39.1685 40.0 40.0 40.0 39.0 40.0 30 39.0925 40.0 40.0 40.0 39.0 40.0 31 39.14675 40.0 40.0 40.0 39.0 40.0 32 39.091 40.0 40.0 40.0 38.0 40.0 33 39.197 40.0 40.0 40.0 39.0 40.0 34 39.1075 40.0 40.0 40.0 38.0 40.0 35 39.07925 40.0 40.0 40.0 38.0 40.0 36 39.06775 40.0 40.0 40.0 38.0 40.0 37 39.1305 40.0 40.0 40.0 38.0 40.0 38 39.08675 40.0 40.0 40.0 38.0 40.0 39 39.1625 40.0 40.0 40.0 38.0 40.0 40 39.1455 40.0 40.0 40.0 39.0 40.0 41 39.08375 40.0 40.0 40.0 38.0 40.0 42 39.0545 40.0 40.0 40.0 38.0 40.0 43 39.09325 40.0 40.0 40.0 38.0 40.0 44 39.1365 40.0 40.0 40.0 38.0 40.0 45 39.0465 40.0 40.0 40.0 38.0 40.0 46 39.05125 40.0 40.0 40.0 38.0 40.0 47 39.12875 40.0 40.0 40.0 38.0 40.0 48 39.0725 40.0 40.0 40.0 38.0 40.0 49 39.0865 40.0 40.0 40.0 38.0 40.0 50 39.098 40.0 40.0 40.0 38.0 40.0 51 39.11425 40.0 40.0 40.0 38.0 40.0 52 39.106 40.0 40.0 40.0 39.0 40.0 53 39.08075 40.0 40.0 40.0 38.0 40.0 54 39.00775 40.0 40.0 40.0 38.0 40.0 55 39.10275 40.0 40.0 40.0 38.0 40.0 56 39.08225 40.0 40.0 40.0 38.0 40.0 57 39.10575 40.0 40.0 40.0 38.0 40.0 58 39.05675 40.0 40.0 40.0 38.0 40.0 59 39.06025 40.0 40.0 40.0 38.0 40.0 60 38.99225 40.0 40.0 40.0 38.0 40.0 61 39.06125 40.0 40.0 40.0 38.0 40.0 62 39.024 40.0 40.0 40.0 38.0 40.0 63 39.06075 40.0 40.0 40.0 38.0 40.0 64 39.059 40.0 40.0 40.0 38.0 40.0 65 39.06175 40.0 40.0 40.0 38.0 40.0 66 39.0285 40.0 40.0 40.0 38.0 40.0 67 39.004 40.0 40.0 40.0 38.0 40.0 68 38.9775 40.0 40.0 40.0 38.0 40.0 69 38.90325 40.0 40.0 40.0 38.0 40.0 70 38.96675 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 8.0 26 4.0 27 8.0 28 25.0 29 20.0 30 33.0 31 34.0 32 47.0 33 43.0 34 49.0 35 59.0 36 81.0 37 126.0 38 255.0 39 3207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.297269969666328 12.487360970677452 18.70576339737108 39.50960566228513 2 21.85 14.899999999999999 29.125 34.125 3 22.5 21.425 22.425 33.650000000000006 4 25.650000000000002 24.625 24.2 25.525 5 23.65 29.825000000000003 27.075 19.45 6 19.85 25.974999999999998 32.15 22.025 7 22.25 20.849999999999998 34.1 22.8 8 19.900000000000002 21.9 31.724999999999998 26.474999999999998 9 19.25 26.424999999999997 29.95 24.375 10 24.975 27.250000000000004 22.075 25.7 11 25.15 23.35 24.875 26.625 12 22.125 22.725 27.700000000000003 27.450000000000003 13 22.925 24.525 27.925 24.625 14 24.3 24.275 26.375 25.05 15 23.625 24.375 25.6 26.400000000000002 16 23.95 23.75 24.55 27.750000000000004 17 23.200000000000003 25.15 24.55 27.1 18 23.75 24.5 24.175 27.575 19 24.25 26.075 25.2 24.474999999999998 20 23.3 26.224999999999998 25.35 25.124999999999996 21 22.95 24.5 25.525 27.025 22 24.175 23.9 26.0 25.924999999999997 23 23.575 24.7 25.650000000000002 26.075 24 23.525 23.974999999999998 25.724999999999998 26.775 25 23.674999999999997 24.325 24.575 27.425 26 23.474999999999998 23.625 27.150000000000002 25.75 27 23.325000000000003 25.4 25.25 26.025 28 24.2 23.549999999999997 24.9 27.35 29 22.3 25.85 26.05 25.8 30 22.1 25.6 25.55 26.75 31 23.625 24.925 25.35 26.1 32 23.925 25.424999999999997 25.6 25.05 33 24.4 24.15 24.3 27.150000000000002 34 24.325 24.95 24.7 26.025 35 24.3 23.799999999999997 25.4 26.5 36 23.35 25.0 25.974999999999998 25.674999999999997 37 24.075 24.45 24.575 26.900000000000002 38 23.35 24.575 26.35 25.724999999999998 39 22.575 24.95 25.1 27.375 40 23.375 25.374999999999996 25.8 25.45 41 23.724999999999998 25.0 25.25 26.025 42 21.425 25.7 25.5 27.375 43 23.825 25.174999999999997 24.975 26.025 44 24.575 24.125 25.4 25.900000000000002 45 23.7 24.775 24.675 26.85 46 24.224999999999998 24.25 25.05 26.474999999999998 47 23.5 24.175 26.125 26.200000000000003 48 24.3 24.4 24.775 26.525 49 24.525 24.875 24.099999999999998 26.5 50 24.125 24.85 24.975 26.05 51 24.775 25.974999999999998 24.0 25.25 52 24.3 23.9 25.124999999999996 26.674999999999997 53 24.099999999999998 23.625 26.174999999999997 26.1 54 23.45 24.95 24.7 26.900000000000002 55 25.3 22.95 24.7 27.05 56 24.575 23.75 25.3 26.375 57 23.0 23.75 25.7 27.55 58 24.075 24.525 24.95 26.450000000000003 59 23.474999999999998 24.425 25.95 26.150000000000002 60 24.3 24.2 24.6 26.900000000000002 61 24.9 23.925 23.25 27.925 62 24.05 24.75 25.974999999999998 25.224999999999998 63 24.275 23.7 24.75 27.275 64 24.406101525381345 23.53088272068017 24.85621405351338 27.206801700425103 65 23.06153076538269 24.512256128064035 25.887943971985994 26.538269134567283 66 23.759398496240603 23.157894736842106 25.263157894736842 27.819548872180448 67 25.12600806451613 23.739919354838708 24.949596774193548 26.184475806451612 68 23.98873527905786 23.783922171018943 26.446492575524832 25.78084997439836 69 24.267551133222774 18.85019347705915 28.054173576561638 28.82808181315644 70 27.598964113947467 0.0 34.48020717721051 37.92082870884202 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 4.0 26 4.0 27 4.0 28 6.5 29 13.0 30 17.0 31 14.5 32 23.0 33 34.0 34 37.0 35 50.0 36 76.5 37 93.0 38 115.0 39 156.5 40 176.0 41 189.5 42 213.0 43 223.0 44 244.5 45 267.0 46 267.0 47 266.0 48 264.0 49 246.5 50 231.0 51 226.5 52 205.0 53 188.0 54 174.5 55 162.0 56 150.5 57 138.0 58 128.5 59 122.5 60 126.0 61 112.5 62 95.5 63 92.0 64 81.0 65 63.5 66 62.0 67 67.0 68 62.5 69 50.0 70 42.0 71 36.5 72 28.0 73 25.0 74 19.0 75 12.0 76 7.0 77 3.0 78 3.0 79 2.0 80 1.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.05 66 0.25 67 0.8 68 2.35 69 9.55 70 32.425 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052716 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052716_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.029 35.0 35.0 35.0 32.0 35.0 2 33.94025 35.0 35.0 35.0 32.0 35.0 3 33.593 35.0 35.0 35.0 31.0 35.0 4 33.47475 35.0 35.0 35.0 31.0 35.0 5 33.46375 35.0 35.0 35.0 31.0 35.0 6 37.88375 40.0 39.0 40.0 34.0 40.0 7 37.67475 40.0 39.0 40.0 31.0 40.0 8 37.82175 40.0 39.0 40.0 34.0 40.0 9 37.8485 40.0 39.0 40.0 34.0 40.0 10 37.9105 40.0 39.0 40.0 34.0 40.0 11 37.88125 40.0 39.0 40.0 34.0 40.0 12 37.9865 40.0 40.0 40.0 34.0 40.0 13 37.93425 40.0 39.0 40.0 34.0 40.0 14 37.9295 40.0 39.0 40.0 34.0 40.0 15 37.888 40.0 40.0 40.0 34.0 40.0 16 37.895 40.0 40.0 40.0 34.0 40.0 17 37.974 40.0 40.0 40.0 34.0 40.0 18 37.79925 40.0 40.0 40.0 34.0 40.0 19 37.94925 40.0 40.0 40.0 34.0 40.0 20 37.893 40.0 39.0 40.0 34.0 40.0 21 37.82575 40.0 39.0 40.0 34.0 40.0 22 37.8505 40.0 39.0 40.0 34.0 40.0 23 37.95225 40.0 40.0 40.0 34.0 40.0 24 37.9075 40.0 40.0 40.0 34.0 40.0 25 37.792 40.0 39.0 40.0 34.0 40.0 26 37.9105 40.0 40.0 40.0 34.0 40.0 27 37.889 40.0 40.0 40.0 34.0 40.0 28 37.85025 40.0 40.0 40.0 34.0 40.0 29 37.9165 40.0 40.0 40.0 34.0 40.0 30 37.925 40.0 40.0 40.0 34.0 40.0 31 37.92275 40.0 39.0 40.0 34.0 40.0 32 37.8845 40.0 39.0 40.0 34.0 40.0 33 37.9055 40.0 39.0 40.0 34.0 40.0 34 37.80975 40.0 39.0 40.0 34.0 40.0 35 37.9365 40.0 39.0 40.0 34.0 40.0 36 37.84525 40.0 39.0 40.0 34.0 40.0 37 37.82925 40.0 39.0 40.0 34.0 40.0 38 37.848 40.0 39.0 40.0 34.0 40.0 39 37.77925 40.0 39.0 40.0 34.0 40.0 40 37.91275 40.0 39.0 40.0 34.0 40.0 41 37.73825 40.0 39.0 40.0 34.0 40.0 42 37.835 40.0 39.0 40.0 34.0 40.0 43 37.817 40.0 39.0 40.0 34.0 40.0 44 37.75225 40.0 39.0 40.0 34.0 40.0 45 37.82725 40.0 39.0 40.0 34.0 40.0 46 37.68075 40.0 39.0 40.0 34.0 40.0 47 37.74225 40.0 39.0 40.0 31.0 40.0 48 37.708 40.0 39.0 40.0 34.0 40.0 49 37.73975 40.0 39.0 40.0 34.0 40.0 50 37.74725 40.0 39.0 40.0 34.0 40.0 51 37.847 40.0 39.0 40.0 34.0 40.0 52 37.6195 40.0 39.0 40.0 31.0 40.0 53 37.68 40.0 39.0 40.0 34.0 40.0 54 37.63375 40.0 39.0 40.0 34.0 40.0 55 37.729 40.0 39.0 40.0 34.0 40.0 56 37.80225 40.0 39.0 40.0 34.0 40.0 57 37.84475 40.0 39.0 40.0 34.0 40.0 58 37.76675 40.0 39.0 40.0 34.0 40.0 59 37.74025 40.0 39.0 40.0 34.0 40.0 60 37.7905 40.0 39.0 40.0 34.0 40.0 61 37.70625 40.0 39.0 40.0 34.0 40.0 62 37.693 40.0 39.0 40.0 31.0 40.0 63 37.61475 40.0 39.0 40.0 31.0 40.0 64 37.72775 40.0 39.0 40.0 34.0 40.0 65 37.7085 40.0 39.0 40.0 34.0 40.0 66 37.662 40.0 39.0 40.0 31.0 40.0 67 37.76825 40.0 39.0 40.0 34.0 40.0 68 37.69175 40.0 39.0 40.0 34.0 40.0 69 37.74875 40.0 39.0 40.0 34.0 40.0 70 37.66375 40.0 39.0 40.0 31.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 7.0 18 23.0 19 33.0 20 40.0 21 34.0 22 20.0 23 31.0 24 40.0 25 35.0 26 31.0 27 26.0 28 29.0 29 37.0 30 27.0 31 38.0 32 31.0 33 32.0 34 44.0 35 54.0 36 65.0 37 111.0 38 246.0 39 2963.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.599999999999998 21.275 20.775 29.349999999999998 2 28.249999999999996 26.375 23.474999999999998 21.9 3 22.275 26.525 25.7 25.5 4 26.825 28.925 20.075000000000003 24.175 5 25.624999999999996 34.325 19.5 20.549999999999997 6 21.55 26.775 25.775 25.900000000000002 7 26.150000000000002 20.1 28.875 24.875 8 22.725 22.6 26.150000000000002 28.525 9 22.7 26.25 24.95 26.1 10 27.55 26.825 21.325 24.3 11 27.825 22.325 21.825 28.025 12 25.6 22.05 24.45 27.900000000000002 13 26.25 24.425 23.575 25.75 14 25.2 26.150000000000002 23.674999999999997 24.975 15 25.4 25.25 23.549999999999997 25.8 16 27.200000000000003 24.375 22.7 25.724999999999998 17 26.625 24.65 24.2 24.525 18 26.075 24.8 24.4 24.725 19 27.675 24.075 23.0 25.25 20 25.4 26.05 23.599999999999998 24.95 21 25.45 25.2 22.925 26.424999999999997 22 26.5 25.0 23.375 25.124999999999996 23 25.624999999999996 25.650000000000002 24.125 24.6 24 25.275 25.224999999999998 23.200000000000003 26.3 25 25.474999999999998 24.0 25.55 24.975 26 27.400000000000002 24.875 22.900000000000002 24.825 27 24.474999999999998 23.974999999999998 25.15 26.400000000000002 28 26.974999999999998 24.0 23.65 25.374999999999996 29 25.575 25.45 24.65 24.325 30 25.7 24.05 23.95 26.3 31 26.875 24.625 22.875 25.624999999999996 32 25.75 25.45 24.025 24.775 33 25.624999999999996 25.025 23.75 25.6 34 26.75 23.125 24.025 26.1 35 27.224999999999998 24.474999999999998 24.575 23.724999999999998 36 25.45 24.8 24.525 25.224999999999998 37 26.025 24.975 23.400000000000002 25.6 38 26.224999999999998 24.75 23.400000000000002 25.624999999999996 39 25.025 24.4 24.349999999999998 26.224999999999998 40 26.700000000000003 25.85 23.549999999999997 23.9 41 25.324999999999996 25.8 24.0 24.875 42 25.124999999999996 24.625 24.775 25.474999999999998 43 27.55 24.075 23.1 25.275 44 27.450000000000003 24.95 22.975 24.625 45 24.75 26.35 23.674999999999997 25.224999999999998 46 27.474999999999998 23.425 23.599999999999998 25.5 47 27.150000000000002 24.975 23.3 24.575 48 25.650000000000002 24.95 24.474999999999998 24.925 49 26.474999999999998 24.65 23.325000000000003 25.55 50 26.025 26.3 23.175 24.5 51 25.074999999999996 24.45 24.75 25.724999999999998 52 27.224999999999998 24.8 23.525 24.45 53 26.3 25.224999999999998 24.0 24.474999999999998 54 27.075 24.45 24.099999999999998 24.375 55 26.55 24.125 23.9 25.424999999999997 56 25.55 25.424999999999997 24.425 24.6 57 26.3 24.25 24.6 24.85 58 27.025 24.575 22.625 25.775 59 25.874999999999996 26.625 23.375 24.125 60 25.575 24.474999999999998 24.8 25.15 61 28.199999999999996 23.599999999999998 22.95 25.25 62 25.5 25.6 23.724999999999998 25.174999999999997 63 26.400000000000002 24.925 23.724999999999998 24.95 64 26.974999999999998 24.575 23.575 24.875 65 25.812906453226613 25.437718859429715 25.03751875937969 23.71185592796398 66 26.095667417981467 24.36764337590784 23.791635361883294 25.7450538442274 67 26.993710691823896 24.67924528301887 23.371069182389938 24.955974842767294 68 26.55163533350502 23.615761009528715 23.25521503991759 26.577388617048676 69 25.937325125909343 18.858421936205932 28.231673195299383 26.97257974258534 70 28.582034149962883 0.0 34.484038604305866 36.933927245731255 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 2.0 22 3.0 23 3.0 24 3.0 25 2.0 26 3.5 27 6.0 28 6.0 29 11.0 30 16.0 31 14.5 32 19.0 33 25.0 34 32.5 35 47.5 36 82.0 37 109.0 38 102.0 39 103.5 40 112.0 41 160.0 42 210.5 43 213.0 44 222.0 45 246.0 46 254.5 47 248.0 48 249.5 49 240.0 50 229.0 51 220.5 52 198.0 53 184.0 54 182.0 55 169.5 56 152.5 57 146.0 58 129.5 59 126.0 60 139.0 61 130.0 62 110.0 63 99.0 64 94.0 65 87.0 66 84.5 67 84.0 68 74.0 69 64.0 70 64.0 71 51.5 72 32.0 73 25.0 74 24.5 75 20.0 76 11.5 77 7.0 78 5.0 79 4.0 80 5.0 81 3.5 82 1.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.05 66 0.17500000000000002 67 0.625 68 2.9250000000000003 69 10.65 70 32.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165891 spots for ERR5052716.sra Written 165891 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra Read 165879 spots for ERR5052716.sra Written 165879 spots for ERR5052716.sra SRR ids: ['ERR5052716.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hra_k2rw ERR5052716.sra spots: 3317592 blocks: [[1, 165879], [165880, 331758], [331759, 497637], [497638, 663516], [663517, 829395], [829396, 995274], [995275, 1161153], [1161154, 1327032], [1327033, 1492911], [1492912, 1658790], [1658791, 1824669], [1824670, 1990548], [1990549, 2156427], [2156428, 2322306], [2322307, 2488185], [2488186, 2654064], [2654065, 2819943], [2819944, 2985822], [2985823, 3151701], [3151702, 3317592]] ERR5052716 file size 587481 ERR5052716 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052716 ERR5052716_1.fastq ERR5052716_2.fastq Input file: ERR5052716_1.fastq Paired file: ERR5052716_2.fastq trimmed: ERR5052716-trimmed-pair1.fastq, ERR5052716-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:46:23 2024 >> started Tue Dec 10 05:46:26 2024 >> done (2.582s) 3317592 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 29 ( 0.00%) empty read pairs filtered out after trimming by size control 3317563 (100.00%) read pairs available; of these: 10 ( 0.00%) trimmed read pairs available after processing 3317553 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 7 0.00% 70 3317553 100.00% 3317563 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=34 prefix-density=0.10 prefix-fanout=2.5 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=568.69 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=34.4 sequence=CTTCTTCTTCTGCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=122.18 fanout-score-rank=12 prefix-density=0.96 prefix-fanout=18.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=521.70 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=16.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA ERR5052716 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:46:53 Started mapping on | Dec 10 05:46:53 Finished on | Dec 10 05:47:06 Mapping speed, Million of reads per hour | 918.71 Number of input reads | 3317563 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3122747 Uniquely mapped reads % | 94.13% Average mapped length | 138.73 Number of splices: Total | 1543593 Number of splices: Annotated (sjdb) | 1460893 Number of splices: GT/AG | 1522813 Number of splices: GC/AG | 18295 Number of splices: AT/AC | 1076 Number of splices: Non-canonical | 1409 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 47604 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 3536 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 147212 147212 147212 N_multimapping 47604 47604 47604 N_noFeature 76641 3055115 95501 N_ambiguous 55696 273 7132 UnstrandedReadsAssigned:2990410 PositiveStrandReadsAssigned:67359 NegativeStrandReadsAssigned:3020114 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052716 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052716-trimmed-pair1.fastq ERR5052716-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,317,563 reads, 3,136,848 reads pseudoaligned [quant] estimated average fragment length: 196.063 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 ERR5052716.ke.tsv 35125 ERR5052716.se.tsv 88098 total ==> ERR5052716.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.248 24.32 15.4542 PNS24247 1044 848.937 6.55693 3.63807 PNS24249 1928 1732.94 14.7059 3.99718 PNS24246 1044 848.937 6.55693 3.63807 PNS24248 1044 848.937 6.55693 3.63807 PNS24244 1471 1275.94 19.3033 7.12606 PNS24243 293 117.903 0 0 KQK14069 1603 1407.94 1099.8 367.939 KQK14071 474 283.361 24.3864 40.5372 ==> ERR5052716.se.tsv <== BRADI_1g14170v3 1192 BRADI_1g53295v3 17 BRADI_1g59795v3 37 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 216 BRADI_1g74790v3 33 BRADI_1g09890v3 0 BRADI_1g77505v3 30 BRADI_1g48960v3 0 ERR5052716 completed mapping pipeline successfully