Starting /dee2/code/volunteer_pipeline.sh ERR5052717 current disk space = 1525888851968 free memory = 1598988872 ERR5052717 SRAfilesize a9429f937471098baeaf4a84e003bc66 ERR5052717.sra ERR5052717.sra file validated ERR5052717 is paired end ERR5052717 is conventional basespace ERR5052717 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052717_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.4225 35.0 35.0 35.0 35.0 35.0 2 34.57625 35.0 35.0 35.0 34.0 35.0 3 34.5495 35.0 35.0 35.0 34.0 35.0 4 34.486 35.0 35.0 35.0 34.0 35.0 5 34.47075 35.0 35.0 35.0 34.0 35.0 6 39.217 40.0 40.0 40.0 39.0 40.0 7 39.26475 40.0 40.0 40.0 39.0 40.0 8 39.13025 40.0 40.0 40.0 39.0 40.0 9 39.19825 40.0 40.0 40.0 39.0 40.0 10 39.21225 40.0 40.0 40.0 39.0 40.0 11 39.15475 40.0 40.0 40.0 38.0 40.0 12 39.1145 40.0 40.0 40.0 38.0 40.0 13 39.142 40.0 40.0 40.0 38.0 40.0 14 39.156 40.0 40.0 40.0 38.0 40.0 15 39.1675 40.0 40.0 40.0 38.0 40.0 16 39.15075 40.0 40.0 40.0 38.0 40.0 17 39.122 40.0 40.0 40.0 38.0 40.0 18 39.179 40.0 40.0 40.0 39.0 40.0 19 39.15025 40.0 40.0 40.0 39.0 40.0 20 39.138 40.0 40.0 40.0 39.0 40.0 21 39.04 40.0 40.0 40.0 38.0 40.0 22 39.15 40.0 40.0 40.0 38.0 40.0 23 39.06675 40.0 40.0 40.0 38.0 40.0 24 39.1195 40.0 40.0 40.0 38.0 40.0 25 39.09025 40.0 40.0 40.0 38.0 40.0 26 39.01975 40.0 40.0 40.0 38.0 40.0 27 39.056 40.0 40.0 40.0 38.0 40.0 28 39.071 40.0 40.0 40.0 38.0 40.0 29 39.033 40.0 40.0 40.0 38.0 40.0 30 39.094 40.0 40.0 40.0 38.0 40.0 31 39.014 40.0 40.0 40.0 38.0 40.0 32 39.03475 40.0 40.0 40.0 38.0 40.0 33 39.0795 40.0 40.0 40.0 39.0 40.0 34 39.07275 40.0 40.0 40.0 38.0 40.0 35 39.0385 40.0 40.0 40.0 38.0 40.0 36 39.08575 40.0 40.0 40.0 38.0 40.0 37 39.06025 40.0 40.0 40.0 38.0 40.0 38 39.01825 40.0 40.0 40.0 38.0 40.0 39 39.0105 40.0 40.0 40.0 38.0 40.0 40 39.03375 40.0 40.0 40.0 38.0 40.0 41 39.073 40.0 40.0 40.0 38.0 40.0 42 39.08425 40.0 40.0 40.0 38.0 40.0 43 39.05075 40.0 40.0 40.0 38.0 40.0 44 38.95425 40.0 40.0 40.0 38.0 40.0 45 38.98625 40.0 40.0 40.0 38.0 40.0 46 39.02575 40.0 40.0 40.0 38.0 40.0 47 38.92975 40.0 40.0 40.0 38.0 40.0 48 39.0225 40.0 40.0 40.0 38.0 40.0 49 38.99675 40.0 40.0 40.0 38.0 40.0 50 39.02475 40.0 40.0 40.0 38.0 40.0 51 39.01325 40.0 40.0 40.0 38.0 40.0 52 39.02925 40.0 40.0 40.0 38.0 40.0 53 38.95775 40.0 40.0 40.0 38.0 40.0 54 39.01975 40.0 40.0 40.0 38.0 40.0 55 38.931 40.0 40.0 40.0 38.0 40.0 56 39.00225 40.0 40.0 40.0 38.0 40.0 57 38.9125 40.0 40.0 40.0 37.0 40.0 58 38.938 40.0 40.0 40.0 38.0 40.0 59 39.0535 40.0 40.0 40.0 38.0 40.0 60 39.034 40.0 40.0 40.0 38.0 40.0 61 39.01875 40.0 40.0 40.0 38.0 40.0 62 39.0565 40.0 40.0 40.0 38.0 40.0 63 39.04675 40.0 40.0 40.0 38.0 40.0 64 38.99975 40.0 40.0 40.0 38.0 40.0 65 39.024 40.0 40.0 40.0 38.0 40.0 66 39.02075 40.0 40.0 40.0 38.0 40.0 67 38.91225 40.0 40.0 40.0 38.0 40.0 68 38.98925 40.0 40.0 40.0 38.0 40.0 69 39.003 40.0 40.0 40.0 38.0 40.0 70 38.96525 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 2.0 24 4.0 25 7.0 26 10.0 27 10.0 28 17.0 29 25.0 30 25.0 31 33.0 32 51.0 33 44.0 34 51.0 35 60.0 36 89.0 37 129.0 38 269.0 39 3172.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.136820925553323 14.159959758551308 17.102615694164992 37.600603621730386 2 22.386193096548272 14.507253626813407 28.88944472236118 34.21710855427714 3 22.025 22.1 22.725 33.15 4 25.575 25.55 23.025000000000002 25.85 5 23.9 30.175 25.5 20.424999999999997 6 19.85 26.125 31.474999999999998 22.55 7 22.125 22.2 33.75 21.925 8 20.4 21.099999999999998 32.2 26.3 9 20.0 26.3 29.825000000000003 23.875 10 24.75 28.599999999999998 23.025000000000002 23.625 11 25.5 22.775000000000002 23.65 28.075 12 22.275 22.8 27.875 27.05 13 23.525 24.675 25.95 25.85 14 22.2 25.3 26.25 26.25 15 23.375 24.099999999999998 25.174999999999997 27.35 16 25.3 24.6 24.0 26.1 17 22.650000000000002 24.224999999999998 26.55 26.575 18 23.225 26.224999999999998 24.675 25.874999999999996 19 24.075 24.8 24.6 26.525 20 24.175 24.474999999999998 25.374999999999996 25.974999999999998 21 23.525 24.4 26.8 25.275 22 24.099999999999998 25.3 24.05 26.55 23 24.125 24.675 25.674999999999997 25.525 24 23.175 24.525 24.7 27.6 25 23.9 25.424999999999997 24.075 26.6 26 23.849999999999998 25.4 24.725 26.025 27 23.175 24.6 25.874999999999996 26.35 28 24.5 23.525 25.25 26.724999999999998 29 23.65 23.674999999999997 26.150000000000002 26.525 30 23.549999999999997 23.724999999999998 25.474999999999998 27.250000000000004 31 24.95 24.4 24.575 26.075 32 24.45 23.799999999999997 25.775 25.974999999999998 33 22.8 24.05 25.4 27.750000000000004 34 23.575 23.775 25.474999999999998 27.175 35 22.2 25.825 25.6 26.375 36 23.775 23.849999999999998 25.474999999999998 26.900000000000002 37 24.3 24.575 24.099999999999998 27.025 38 23.05 25.5 25.525 25.924999999999997 39 22.35 24.825 24.125 28.7 40 23.75 24.825 24.95 26.474999999999998 41 23.075000000000003 24.95 25.074999999999996 26.900000000000002 42 22.825 24.725 26.125 26.325 43 24.85 24.575 24.775 25.8 44 23.400000000000002 24.349999999999998 25.924999999999997 26.325 45 23.75 23.75 26.125 26.375 46 24.15 24.825 25.15 25.874999999999996 47 22.975 25.35 26.200000000000003 25.474999999999998 48 24.375 23.9 24.825 26.900000000000002 49 25.05 23.674999999999997 24.7 26.575 50 23.35 24.55 26.900000000000002 25.2 51 23.799999999999997 23.375 24.575 28.249999999999996 52 24.125 25.275 24.474999999999998 26.125 53 24.099999999999998 24.975 25.825 25.1 54 24.825 24.6 23.35 27.224999999999998 55 23.875 24.0 26.1 26.025 56 22.35 25.275 26.1 26.275 57 22.825 24.725 26.200000000000003 26.25 58 24.625 24.2 25.275 25.900000000000002 59 25.85 23.9 24.55 25.7 60 23.625 24.625 23.7 28.050000000000004 61 24.575 24.95 24.7 25.775 62 24.325 24.575 24.2 26.900000000000002 63 23.150000000000002 23.35 25.724999999999998 27.775 64 23.799999999999997 24.525 23.724999999999998 27.950000000000003 65 24.10602650662666 24.006001500375092 26.206551637909474 25.681420355088775 66 22.92084168336673 23.74749498997996 25.425851703406817 27.90581162324649 67 26.030150753768844 23.241206030150753 25.100502512562816 25.628140703517587 68 24.92331288343558 23.031697341513294 25.33231083844581 26.712678936605315 69 25.013728720483254 18.42394288852279 26.27677100494234 30.28555738605162 70 25.76823398741207 0.0 36.57904479822288 37.652721214365044 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.0 24 1.0 25 2.0 26 3.0 27 3.0 28 4.0 29 12.0 30 19.0 31 19.5 32 25.0 33 30.0 34 45.5 35 59.5 36 71.5 37 85.0 38 105.5 39 143.0 40 160.0 41 193.5 42 225.5 43 224.0 44 242.5 45 257.5 46 249.0 47 244.0 48 257.5 49 256.5 50 242.0 51 232.0 52 214.0 53 206.0 54 171.5 55 141.0 56 146.5 57 148.0 58 131.0 59 106.0 60 98.0 61 97.0 62 103.5 63 111.0 64 99.5 65 81.0 66 76.0 67 78.0 68 67.0 69 51.0 70 46.0 71 39.0 72 25.0 73 18.0 74 16.5 75 11.0 76 6.5 77 6.0 78 4.0 79 2.0 80 2.0 81 1.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.6 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.025 66 0.2 67 0.5 68 2.1999999999999997 69 8.95 70 32.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052717 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052717_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.0535 35.0 35.0 35.0 32.0 35.0 2 33.95 35.0 35.0 35.0 32.0 35.0 3 33.67725 35.0 35.0 35.0 31.0 35.0 4 33.56 35.0 35.0 35.0 31.0 35.0 5 33.47275 35.0 35.0 35.0 31.0 35.0 6 37.90975 40.0 39.0 40.0 34.0 40.0 7 37.84675 40.0 39.0 40.0 34.0 40.0 8 37.666 40.0 39.0 40.0 31.0 40.0 9 37.821 40.0 39.0 40.0 34.0 40.0 10 37.8635 40.0 39.0 40.0 34.0 40.0 11 37.90425 40.0 40.0 40.0 34.0 40.0 12 37.90725 40.0 40.0 40.0 34.0 40.0 13 37.973 40.0 40.0 40.0 34.0 40.0 14 37.89325 40.0 40.0 40.0 34.0 40.0 15 37.887 40.0 39.0 40.0 34.0 40.0 16 37.88725 40.0 40.0 40.0 34.0 40.0 17 37.914 40.0 39.0 40.0 34.0 40.0 18 37.94 40.0 39.0 40.0 34.0 40.0 19 37.9485 40.0 39.0 40.0 34.0 40.0 20 37.87025 40.0 39.0 40.0 34.0 40.0 21 37.96975 40.0 39.0 40.0 34.0 40.0 22 37.941 40.0 39.0 40.0 34.0 40.0 23 37.94275 40.0 39.0 40.0 34.0 40.0 24 37.93625 40.0 39.0 40.0 34.0 40.0 25 37.931 40.0 39.0 40.0 34.0 40.0 26 37.97725 40.0 39.0 40.0 34.0 40.0 27 37.9405 40.0 39.0 40.0 34.0 40.0 28 37.764 40.0 39.0 40.0 34.0 40.0 29 37.8935 40.0 39.0 40.0 34.0 40.0 30 37.87825 40.0 39.0 40.0 34.0 40.0 31 37.90725 40.0 39.0 40.0 34.0 40.0 32 37.9675 40.0 39.0 40.0 34.0 40.0 33 37.86075 40.0 39.0 40.0 34.0 40.0 34 37.82025 40.0 39.0 40.0 34.0 40.0 35 37.88025 40.0 39.0 40.0 34.0 40.0 36 37.8395 40.0 39.0 40.0 34.0 40.0 37 37.82725 40.0 39.0 40.0 34.0 40.0 38 37.8655 40.0 39.0 40.0 34.0 40.0 39 37.88325 40.0 39.0 40.0 34.0 40.0 40 37.9465 40.0 39.0 40.0 34.0 40.0 41 37.86575 40.0 39.0 40.0 34.0 40.0 42 37.824 40.0 39.0 40.0 34.0 40.0 43 37.7245 40.0 39.0 40.0 34.0 40.0 44 37.7085 40.0 39.0 40.0 34.0 40.0 45 37.775 40.0 39.0 40.0 34.0 40.0 46 37.8375 40.0 39.0 40.0 34.0 40.0 47 37.776 40.0 39.0 40.0 34.0 40.0 48 37.667 40.0 39.0 40.0 34.0 40.0 49 37.84675 40.0 39.0 40.0 34.0 40.0 50 37.804 40.0 39.0 40.0 34.0 40.0 51 37.869 40.0 39.0 40.0 34.0 40.0 52 37.775 40.0 39.0 40.0 34.0 40.0 53 37.7435 40.0 39.0 40.0 34.0 40.0 54 37.748 40.0 39.0 40.0 34.0 40.0 55 37.7925 40.0 39.0 40.0 34.0 40.0 56 37.722 40.0 39.0 40.0 34.0 40.0 57 37.75675 40.0 39.0 40.0 34.0 40.0 58 37.81225 40.0 39.0 40.0 34.0 40.0 59 37.73675 40.0 39.0 40.0 34.0 40.0 60 37.79875 40.0 39.0 40.0 34.0 40.0 61 37.77525 40.0 39.0 40.0 34.0 40.0 62 37.77875 40.0 39.0 40.0 34.0 40.0 63 37.82 40.0 39.0 40.0 34.0 40.0 64 37.73975 40.0 39.0 40.0 34.0 40.0 65 37.7695 40.0 39.0 40.0 34.0 40.0 66 37.763 40.0 39.0 40.0 34.0 40.0 67 37.72375 40.0 39.0 40.0 34.0 40.0 68 37.654 40.0 39.0 40.0 31.0 40.0 69 37.70375 40.0 39.0 40.0 34.0 40.0 70 37.654 40.0 39.0 40.0 31.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 8.0 18 15.0 19 29.0 20 41.0 21 44.0 22 48.0 23 33.0 24 26.0 25 20.0 26 28.0 27 30.0 28 27.0 29 26.0 30 25.0 31 21.0 32 33.0 33 42.0 34 45.0 35 59.0 36 66.0 37 107.0 38 265.0 39 2960.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.499999999999996 20.5 19.875 31.125000000000004 2 28.999999999999996 26.650000000000002 23.525 20.825 3 22.775000000000002 27.700000000000003 23.9 25.624999999999996 4 24.725 30.049999999999997 21.224999999999998 24.0 5 26.375 31.900000000000002 20.775 20.95 6 22.98649324662331 27.738869434717362 24.212106053026513 25.062531265632813 7 23.825 20.25 29.25 26.674999999999997 8 23.625 21.15 26.224999999999998 28.999999999999996 9 23.150000000000002 25.5 25.074999999999996 26.275 10 25.775 26.55 21.275 26.400000000000002 11 27.3 22.25 21.85 28.599999999999998 12 25.5 21.9 24.025 28.575 13 24.5 23.25 24.8 27.450000000000003 14 25.7 25.1 23.849999999999998 25.35 15 26.700000000000003 24.5 23.849999999999998 24.95 16 26.875 22.575 23.525 27.025 17 26.85 25.650000000000002 22.575 24.925 18 26.450000000000003 24.525 23.45 25.575 19 26.950000000000003 23.825 23.5 25.724999999999998 20 26.0 25.974999999999998 23.525 24.5 21 25.45 24.275 23.05 27.224999999999998 22 27.200000000000003 24.474999999999998 23.05 25.275 23 26.400000000000002 26.0 22.675 24.925 24 25.2 23.599999999999998 24.8 26.400000000000002 25 26.174999999999997 24.55 23.674999999999997 25.6 26 24.875 25.275 23.325000000000003 26.525 27 26.474999999999998 23.075000000000003 23.95 26.5 28 25.900000000000002 25.124999999999996 22.95 26.025 29 26.974999999999998 24.8 22.725 25.5 30 26.3 24.025 23.775 25.900000000000002 31 28.000000000000004 23.125 23.175 25.7 32 26.05 24.65 24.0 25.3 33 25.424999999999997 24.95 23.549999999999997 26.075 34 26.775 24.5 23.575 25.15 35 25.924999999999997 26.474999999999998 22.85 24.75 36 25.4 24.825 24.275 25.5 37 26.125 23.925 23.724999999999998 26.224999999999998 38 27.375 25.575 23.599999999999998 23.45 39 24.65 24.525 24.474999999999998 26.35 40 26.924999999999997 23.925 22.625 26.525 41 26.950000000000003 25.224999999999998 22.650000000000002 25.174999999999997 42 26.875 24.125 23.724999999999998 25.275 43 26.724999999999998 25.174999999999997 22.650000000000002 25.45 44 25.95 26.125 23.549999999999997 24.375 45 24.8 25.374999999999996 24.625 25.2 46 27.450000000000003 25.35 22.35 24.85 47 26.5 25.575 22.85 25.074999999999996 48 26.525 24.349999999999998 23.65 25.474999999999998 49 26.174999999999997 24.8 23.400000000000002 25.624999999999996 50 27.500000000000004 25.874999999999996 22.75 23.875 51 26.224999999999998 23.474999999999998 24.825 25.474999999999998 52 26.1 25.275 23.25 25.374999999999996 53 27.750000000000004 24.825 23.474999999999998 23.95 54 27.200000000000003 24.175 24.025 24.6 55 26.174999999999997 25.825 23.674999999999997 24.325 56 26.1 24.95 25.1 23.849999999999998 57 26.525 24.725 23.625 25.124999999999996 58 27.675 24.325 23.575 24.425 59 26.450000000000003 25.025 24.05 24.474999999999998 60 25.8 25.324999999999996 23.775 25.1 61 26.650000000000002 23.599999999999998 25.3 24.45 62 26.325 24.4 24.6 24.675 63 26.150000000000002 24.675 24.2 24.975 64 27.55 23.825 24.075 24.55 65 27.988994497248626 23.861930965482742 24.212106053026513 23.936968484242122 66 26.145755071374904 25.36939644377661 23.39093413473579 25.093914350112694 67 27.389659520807065 23.203026481715007 24.892812105926858 24.51450189155107 68 28.18393180056833 23.456471196073366 24.670627744768794 23.688969258589513 69 27.396878483835007 18.366778149386846 26.588628762541806 27.647714604236345 70 30.42830540037244 0.0 32.513966480446925 37.05772811918063 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 3.0 25 3.5 26 2.0 27 1.0 28 3.5 29 8.5 30 11.0 31 10.5 32 22.5 33 35.0 34 33.0 35 53.5 36 81.0 37 86.0 38 93.0 39 115.0 40 130.0 41 145.0 42 182.5 43 205.0 44 216.5 45 240.5 46 257.5 47 262.0 48 256.5 49 246.5 50 242.0 51 218.0 52 188.5 53 183.0 54 175.5 55 157.5 56 142.5 57 138.0 58 140.5 59 137.5 60 132.0 61 129.0 62 107.5 63 89.0 64 106.0 65 107.5 66 94.5 67 97.0 68 83.5 69 63.5 70 57.0 71 52.5 72 40.0 73 32.0 74 26.0 75 20.5 76 11.5 77 2.0 78 3.5 79 3.5 80 2.0 81 3.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.05 66 0.17500000000000002 67 0.8750000000000001 68 3.225 69 10.299999999999999 70 32.875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169885 spots for ERR5052717.sra Written 169885 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra Read 169873 spots for ERR5052717.sra Written 169873 spots for ERR5052717.sra SRR ids: ['ERR5052717.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nr4tl8xn ERR5052717.sra spots: 3397472 blocks: [[1, 169873], [169874, 339746], [339747, 509619], [509620, 679492], [679493, 849365], [849366, 1019238], [1019239, 1189111], [1189112, 1358984], [1358985, 1528857], [1528858, 1698730], [1698731, 1868603], [1868604, 2038476], [2038477, 2208349], [2208350, 2378222], [2378223, 2548095], [2548096, 2717968], [2717969, 2887841], [2887842, 3057714], [3057715, 3227587], [3227588, 3397472]] ERR5052717 file size 601678 ERR5052717 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052717 ERR5052717_1.fastq ERR5052717_2.fastq Input file: ERR5052717_1.fastq Paired file: ERR5052717_2.fastq trimmed: ERR5052717-trimmed-pair1.fastq, ERR5052717-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:47:23 2024 >> started Tue Dec 10 05:47:26 2024 >> done (3.619s) 3397472 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 22 ( 0.00%) empty read pairs filtered out after trimming by size control 3397450 (100.00%) read pairs available; of these: 10 ( 0.00%) trimmed read pairs available after processing 3397440 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 8 0.00% 70 3397440 100.00% 3397450 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=35 prefix-density=0.10 prefix-fanout=2.5 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=543.29 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=33.8 sequence=CTTCTTCTTCTGCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=122.93 fanout-score-rank=14 prefix-density=0.94 prefix-fanout=18.5 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=565.33 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=15.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA ERR5052717 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:48:06 Started mapping on | Dec 10 05:48:06 Finished on | Dec 10 05:48:18 Mapping speed, Million of reads per hour | 1019.24 Number of input reads | 3397450 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3192663 Uniquely mapped reads % | 93.97% Average mapped length | 138.72 Number of splices: Total | 1578577 Number of splices: Annotated (sjdb) | 1494001 Number of splices: GT/AG | 1557243 Number of splices: GC/AG | 18856 Number of splices: AT/AC | 1087 Number of splices: Non-canonical | 1391 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 49024 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 3546 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.19% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 155763 155763 155763 N_multimapping 49024 49024 49024 N_noFeature 78140 3123269 97204 N_ambiguous 57262 288 7127 UnstrandedReadsAssigned:3057261 PositiveStrandReadsAssigned:69106 NegativeStrandReadsAssigned:3088332 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052717 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052717-trimmed-pair1.fastq ERR5052717-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,397,450 reads, 3,212,658 reads pseudoaligned [quant] estimated average fragment length: 196.174 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 ERR5052717.ke.tsv 35125 ERR5052717.se.tsv 88098 total ==> ERR5052717.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.136 1.20664 0.750627 PNS24247 1044 848.826 16.0841 8.73619 PNS24249 1928 1732.83 31.4693 8.3729 PNS24246 1044 848.826 16.0841 8.73619 PNS24248 1044 848.826 16.0841 8.73619 PNS24244 1471 1275.83 33.0719 11.9512 PNS24243 293 117.738 1 3.91587 KQK14069 1603 1407.83 1104.8 361.807 KQK14071 474 283.076 41.4407 67.4946 ==> ERR5052717.se.tsv <== BRADI_1g14170v3 1258 BRADI_1g53295v3 13 BRADI_1g59795v3 47 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 180 BRADI_1g74790v3 25 BRADI_1g09890v3 0 BRADI_1g77505v3 21 BRADI_1g48960v3 0 ERR5052717 completed mapping pipeline successfully