Starting /dee2/code/volunteer_pipeline.sh ERR5052718 current disk space = 1525879914496 free memory = 1556567044 ERR5052718 SRAfilesize 52c200a8a1c82fad14162a0e17f864a3 ERR5052718.sra ERR5052718.sra file validated ERR5052718 is paired end ERR5052718 is conventional basespace ERR5052718 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052718_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.42475 35.0 35.0 35.0 35.0 35.0 2 34.63325 35.0 35.0 35.0 35.0 35.0 3 34.649 35.0 35.0 35.0 35.0 35.0 4 34.6245 35.0 35.0 35.0 35.0 35.0 5 34.61375 35.0 35.0 35.0 35.0 35.0 6 39.44725 40.0 40.0 40.0 39.0 40.0 7 39.352 40.0 40.0 40.0 39.0 40.0 8 39.3965 40.0 40.0 40.0 39.0 40.0 9 39.3915 40.0 40.0 40.0 39.0 40.0 10 39.386 40.0 40.0 40.0 39.0 40.0 11 39.345 40.0 40.0 40.0 39.0 40.0 12 39.351 40.0 40.0 40.0 39.0 40.0 13 39.31325 40.0 40.0 40.0 39.0 40.0 14 39.2985 40.0 40.0 40.0 39.0 40.0 15 39.33225 40.0 40.0 40.0 39.0 40.0 16 39.32475 40.0 40.0 40.0 39.0 40.0 17 39.33 40.0 40.0 40.0 39.0 40.0 18 39.33325 40.0 40.0 40.0 39.0 40.0 19 39.3785 40.0 40.0 40.0 39.0 40.0 20 39.34525 40.0 40.0 40.0 39.0 40.0 21 39.3445 40.0 40.0 40.0 39.0 40.0 22 39.39575 40.0 40.0 40.0 39.0 40.0 23 39.2775 40.0 40.0 40.0 39.0 40.0 24 39.2175 40.0 40.0 40.0 39.0 40.0 25 39.3325 40.0 40.0 40.0 39.0 40.0 26 39.23675 40.0 40.0 40.0 39.0 40.0 27 39.27575 40.0 40.0 40.0 39.0 40.0 28 39.24975 40.0 40.0 40.0 39.0 40.0 29 39.28725 40.0 40.0 40.0 39.0 40.0 30 39.3135 40.0 40.0 40.0 39.0 40.0 31 39.339 40.0 40.0 40.0 39.0 40.0 32 39.32225 40.0 40.0 40.0 39.0 40.0 33 39.2685 40.0 40.0 40.0 39.0 40.0 34 39.28975 40.0 40.0 40.0 39.0 40.0 35 39.302 40.0 40.0 40.0 39.0 40.0 36 39.25525 40.0 40.0 40.0 39.0 40.0 37 39.3205 40.0 40.0 40.0 39.0 40.0 38 39.24875 40.0 40.0 40.0 39.0 40.0 39 39.319 40.0 40.0 40.0 39.0 40.0 40 39.24125 40.0 40.0 40.0 39.0 40.0 41 39.22475 40.0 40.0 40.0 39.0 40.0 42 39.25425 40.0 40.0 40.0 39.0 40.0 43 39.28075 40.0 40.0 40.0 39.0 40.0 44 39.307 40.0 40.0 40.0 39.0 40.0 45 39.2725 40.0 40.0 40.0 39.0 40.0 46 39.25775 40.0 40.0 40.0 39.0 40.0 47 39.32875 40.0 40.0 40.0 39.0 40.0 48 39.29025 40.0 40.0 40.0 39.0 40.0 49 39.307 40.0 40.0 40.0 39.0 40.0 50 39.25175 40.0 40.0 40.0 39.0 40.0 51 39.27725 40.0 40.0 40.0 39.0 40.0 52 39.25425 40.0 40.0 40.0 39.0 40.0 53 39.24725 40.0 40.0 40.0 39.0 40.0 54 39.2785 40.0 40.0 40.0 39.0 40.0 55 39.253 40.0 40.0 40.0 39.0 40.0 56 39.25075 40.0 40.0 40.0 39.0 40.0 57 39.24075 40.0 40.0 40.0 39.0 40.0 58 39.205 40.0 40.0 40.0 39.0 40.0 59 39.2125 40.0 40.0 40.0 39.0 40.0 60 39.2275 40.0 40.0 40.0 39.0 40.0 61 39.16875 40.0 40.0 40.0 39.0 40.0 62 39.15775 40.0 40.0 40.0 39.0 40.0 63 39.2415 40.0 40.0 40.0 39.0 40.0 64 39.212 40.0 40.0 40.0 39.0 40.0 65 39.28525 40.0 40.0 40.0 39.0 40.0 66 39.24225 40.0 40.0 40.0 39.0 40.0 67 39.26975 40.0 40.0 40.0 39.0 40.0 68 39.26475 40.0 40.0 40.0 39.0 40.0 69 39.20525 40.0 40.0 40.0 39.0 40.0 70 39.2135 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 11.0 27 5.0 28 8.0 29 15.0 30 24.0 31 23.0 32 33.0 33 40.0 34 39.0 35 68.0 36 62.0 37 102.0 38 239.0 39 3327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.330395366406446 13.170486023671618 13.497859481238983 45.00125912868295 2 21.025 16.0 33.550000000000004 29.425 3 19.45 21.625 23.525 35.4 4 24.15 27.825 21.8 26.224999999999998 5 24.0 31.0 25.45 19.55 6 19.425 29.349999999999998 28.275 22.95 7 19.175 23.9 36.375 20.549999999999997 8 20.575 20.525 31.55 27.35 9 19.325 24.725 31.374999999999996 24.575 10 22.825 31.85 22.575 22.75 11 25.275 23.925 23.0 27.800000000000004 12 22.375 21.8 27.05 28.775000000000002 13 21.625 24.625 27.500000000000004 26.25 14 21.224999999999998 25.5 26.825 26.450000000000003 15 22.75 24.55 27.6 25.1 16 22.975 25.324999999999996 25.95 25.75 17 23.25 25.424999999999997 25.6 25.724999999999998 18 21.85 25.974999999999998 25.624999999999996 26.55 19 22.325 25.3 26.724999999999998 25.650000000000002 20 22.45 25.275 26.05 26.224999999999998 21 22.650000000000002 24.65 25.85 26.85 22 22.15 26.625 25.224999999999998 26.0 23 22.775000000000002 25.924999999999997 25.424999999999997 25.874999999999996 24 22.2 24.474999999999998 26.400000000000002 26.924999999999997 25 22.75 25.3 26.275 25.674999999999997 26 23.225 25.724999999999998 25.4 25.650000000000002 27 22.075 27.1 24.875 25.95 28 23.35 25.575 25.2 25.874999999999996 29 22.775000000000002 26.924999999999997 24.675 25.624999999999996 30 22.650000000000002 25.825 26.424999999999997 25.1 31 23.0 26.125 24.474999999999998 26.400000000000002 32 22.7 26.575 25.224999999999998 25.5 33 22.725 25.575 25.95 25.75 34 23.9 25.374999999999996 24.4 26.325 35 23.1 25.324999999999996 25.0 26.575 36 23.724999999999998 25.35 25.7 25.224999999999998 37 23.325000000000003 26.375 24.8 25.5 38 24.425 25.124999999999996 24.275 26.174999999999997 39 23.45 25.074999999999996 25.025 26.450000000000003 40 22.55 26.200000000000003 24.825 26.424999999999997 41 22.825 26.775 24.349999999999998 26.05 42 23.125 26.55 24.65 25.674999999999997 43 23.325000000000003 24.474999999999998 25.575 26.625 44 22.7 25.45 24.95 26.900000000000002 45 22.05 25.3 26.825 25.825 46 24.675 26.55 23.875 24.9 47 23.150000000000002 26.674999999999997 24.975 25.2 48 23.65 25.35 24.65 26.35 49 22.225 26.450000000000003 24.95 26.375 50 23.724999999999998 26.150000000000002 24.675 25.45 51 23.125 25.4 25.174999999999997 26.3 52 22.375 26.1 25.3 26.224999999999998 53 23.275000000000002 25.074999999999996 24.775 26.875 54 21.9 26.1 26.025 25.974999999999998 55 23.025000000000002 26.325 25.95 24.7 56 24.349999999999998 24.224999999999998 25.1 26.325 57 23.125 24.8 25.900000000000002 26.174999999999997 58 23.175 26.05 24.8 25.974999999999998 59 24.925 26.025 24.224999999999998 24.825 60 23.225 25.2 25.3 26.275 61 22.475 25.924999999999997 25.05 26.55 62 23.775 24.8 25.55 25.874999999999996 63 21.9 25.874999999999996 24.975 27.250000000000004 64 22.625 25.900000000000002 24.45 27.025 65 23.66183091545773 24.112056028014006 27.613806903451728 24.61230615307654 66 23.971915747241727 24.34804413239719 23.771313941825476 27.90872617853561 67 22.423784328546233 27.08490803728899 24.263038548752835 26.22826908541194 68 22.576497814348162 24.582154795577267 26.51067112368218 26.330676266392388 69 22.996706915477496 19.374313940724477 28.979143798024147 28.649835345773877 70 24.612546125461254 0.0 37.047970479704794 38.33948339483395 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 4.5 27 6.0 28 6.5 29 12.5 30 18.0 31 20.5 32 30.5 33 38.0 34 52.0 35 77.5 36 106.5 37 124.0 38 139.5 39 181.0 40 207.0 41 221.0 42 233.5 43 232.0 44 254.5 45 292.0 46 285.0 47 263.0 48 256.5 49 242.5 50 235.0 51 215.0 52 180.5 53 166.0 54 155.0 55 135.5 56 126.5 57 126.0 58 110.5 59 93.0 60 91.0 61 91.0 62 90.0 63 89.0 64 74.5 65 65.5 66 60.5 67 50.0 68 48.5 69 42.5 70 38.0 71 30.5 72 18.0 73 13.0 74 14.5 75 13.5 76 8.0 77 5.0 78 4.0 79 2.0 80 1.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.05 66 0.3 67 0.775 68 2.775 69 8.9 70 32.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052718 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052718_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.20075 35.0 35.0 35.0 33.0 35.0 2 34.169 35.0 35.0 35.0 33.0 35.0 3 33.96725 35.0 35.0 35.0 32.0 35.0 4 34.0095 35.0 35.0 35.0 32.0 35.0 5 33.90475 35.0 35.0 35.0 32.0 35.0 6 38.54125 40.0 40.0 40.0 37.0 40.0 7 38.42375 40.0 40.0 40.0 36.0 40.0 8 38.43225 40.0 40.0 40.0 37.0 40.0 9 38.54975 40.0 40.0 40.0 37.0 40.0 10 38.5605 40.0 40.0 40.0 37.0 40.0 11 38.60725 40.0 40.0 40.0 37.0 40.0 12 38.69775 40.0 40.0 40.0 38.0 40.0 13 38.5515 40.0 40.0 40.0 37.0 40.0 14 38.545 40.0 40.0 40.0 37.0 40.0 15 38.64075 40.0 40.0 40.0 37.0 40.0 16 38.61075 40.0 40.0 40.0 37.0 40.0 17 38.626 40.0 40.0 40.0 38.0 40.0 18 38.63875 40.0 40.0 40.0 37.0 40.0 19 38.633 40.0 40.0 40.0 37.0 40.0 20 38.55075 40.0 40.0 40.0 37.0 40.0 21 38.55975 40.0 40.0 40.0 37.0 40.0 22 38.56425 40.0 40.0 40.0 37.0 40.0 23 38.51925 40.0 40.0 40.0 37.0 40.0 24 38.6495 40.0 40.0 40.0 37.0 40.0 25 38.628 40.0 40.0 40.0 37.0 40.0 26 38.619 40.0 40.0 40.0 37.0 40.0 27 38.594 40.0 40.0 40.0 38.0 40.0 28 38.572 40.0 40.0 40.0 37.0 40.0 29 38.6335 40.0 40.0 40.0 37.0 40.0 30 38.531 40.0 40.0 40.0 37.0 40.0 31 38.52275 40.0 40.0 40.0 36.0 40.0 32 38.5035 40.0 40.0 40.0 37.0 40.0 33 38.553 40.0 40.0 40.0 37.0 40.0 34 38.51475 40.0 40.0 40.0 37.0 40.0 35 38.55875 40.0 40.0 40.0 36.0 40.0 36 38.469 40.0 40.0 40.0 37.0 40.0 37 38.4985 40.0 40.0 40.0 36.0 40.0 38 38.4895 40.0 40.0 40.0 36.0 40.0 39 38.48275 40.0 40.0 40.0 36.0 40.0 40 38.60375 40.0 40.0 40.0 37.0 40.0 41 38.544 40.0 40.0 40.0 37.0 40.0 42 38.49225 40.0 40.0 40.0 36.0 40.0 43 38.396 40.0 40.0 40.0 36.0 40.0 44 38.476 40.0 40.0 40.0 37.0 40.0 45 38.5235 40.0 40.0 40.0 37.0 40.0 46 38.5365 40.0 40.0 40.0 37.0 40.0 47 38.4935 40.0 40.0 40.0 36.0 40.0 48 38.452 40.0 40.0 40.0 36.0 40.0 49 38.44075 40.0 40.0 40.0 36.0 40.0 50 38.45725 40.0 40.0 40.0 36.0 40.0 51 38.42 40.0 40.0 40.0 36.0 40.0 52 38.304 40.0 39.0 40.0 36.0 40.0 53 38.369 40.0 40.0 40.0 36.0 40.0 54 38.35025 40.0 40.0 40.0 36.0 40.0 55 38.4295 40.0 40.0 40.0 36.0 40.0 56 38.38775 40.0 40.0 40.0 36.0 40.0 57 38.4545 40.0 40.0 40.0 36.0 40.0 58 38.40975 40.0 40.0 40.0 36.0 40.0 59 38.44375 40.0 40.0 40.0 36.0 40.0 60 38.38425 40.0 40.0 40.0 36.0 40.0 61 38.48425 40.0 40.0 40.0 36.0 40.0 62 38.4305 40.0 40.0 40.0 36.0 40.0 63 38.291 40.0 40.0 40.0 36.0 40.0 64 38.388 40.0 40.0 40.0 36.0 40.0 65 38.386 40.0 40.0 40.0 36.0 40.0 66 38.316 40.0 40.0 40.0 36.0 40.0 67 38.36825 40.0 39.0 40.0 36.0 40.0 68 38.3475 40.0 40.0 40.0 36.0 40.0 69 38.4305 40.0 40.0 40.0 36.0 40.0 70 38.35275 40.0 40.0 40.0 36.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 2.0 18 10.0 19 12.0 20 28.0 21 18.0 22 18.0 23 19.0 24 31.0 25 21.0 26 19.0 27 17.0 28 22.0 29 22.0 30 22.0 31 26.0 32 23.0 33 33.0 34 42.0 35 55.0 36 69.0 37 102.0 38 228.0 39 3160.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.599999999999998 18.099999999999998 17.724999999999998 35.575 2 28.425 24.925 26.724999999999998 19.925 3 20.45 26.275 28.025 25.25 4 27.375 28.175 21.7 22.75 5 26.05 33.125 21.45 19.375 6 21.3 30.975 24.65 23.075000000000003 7 23.3 18.825 33.775 24.099999999999998 8 22.650000000000002 21.75 27.150000000000002 28.449999999999996 9 24.175 25.05 26.05 24.725 10 25.6 28.925 22.175 23.3 11 29.225 22.875 20.8 27.1 12 26.950000000000003 21.425 24.925 26.700000000000003 13 24.95 24.725 25.124999999999996 25.2 14 24.325 26.55 24.525 24.6 15 25.575 25.974999999999998 24.325 24.125 16 26.950000000000003 24.5 23.5 25.05 17 25.324999999999996 25.674999999999997 24.325 24.675 18 26.025 25.650000000000002 23.724999999999998 24.6 19 25.35 24.25 24.6 25.8 20 26.775 26.1 23.625 23.5 21 24.825 24.875 25.1 25.2 22 25.5 24.6 24.525 25.374999999999996 23 25.825 25.3 25.674999999999997 23.200000000000003 24 24.65 25.674999999999997 24.85 24.825 25 25.1 24.6 24.9 25.4 26 25.75 26.150000000000002 24.349999999999998 23.75 27 25.1 25.05 26.125 23.724999999999998 28 25.1 23.525 26.674999999999997 24.7 29 25.7 24.85 25.1 24.349999999999998 30 25.5 24.25 25.575 24.675 31 25.775 24.425 24.375 25.424999999999997 32 25.974999999999998 26.5 22.675 24.85 33 25.45 24.425 25.5 24.625 34 24.725 23.799999999999997 26.450000000000003 25.025 35 26.200000000000003 25.525 24.95 23.325000000000003 36 25.074999999999996 25.074999999999996 25.1 24.75 37 25.75 24.025 25.25 24.975 38 26.075 25.75 24.875 23.3 39 25.324999999999996 25.074999999999996 25.525 24.075 40 26.224999999999998 24.675 24.825 24.275 41 26.0 25.25 25.174999999999997 23.575 42 25.674999999999997 24.975 25.525 23.825 43 25.074999999999996 24.025 25.825 25.074999999999996 44 27.125 25.7 23.95 23.225 45 24.65 24.675 25.95 24.725 46 26.424999999999997 24.525 25.1 23.95 47 26.200000000000003 25.8 23.9 24.099999999999998 48 26.125 25.275 25.25 23.35 49 25.4 24.325 26.724999999999998 23.549999999999997 50 25.575 24.8 25.85 23.775 51 24.575 24.7 26.125 24.6 52 26.424999999999997 23.75 25.15 24.675 53 26.0 26.05 24.45 23.5 54 24.725 26.474999999999998 25.3 23.5 55 26.35 24.525 25.525 23.599999999999998 56 27.675 25.650000000000002 24.7 21.975 57 25.624999999999996 25.174999999999997 24.825 24.375 58 25.6 25.575 25.324999999999996 23.5 59 26.625 24.7 24.375 24.3 60 26.1 26.0 23.875 24.025 61 26.375 25.174999999999997 25.1 23.35 62 25.95 24.125 25.674999999999997 24.25 63 25.124999999999996 25.775 25.474999999999998 23.625 64 25.95648912228057 23.755938984746187 26.406601650412604 23.88097024256064 65 26.244683512634477 25.8443832874656 24.418313735301474 23.492619464598448 66 26.29072681704261 25.112781954887218 25.46365914786967 23.1328320802005 67 25.75834175935288 24.443882709807887 26.541961577350857 23.25581395348837 68 26.860674736028844 24.465619366469223 25.186711305691478 23.486994591810458 69 25.806451612903224 19.35483870967742 27.46071133167907 27.377998345740277 70 29.834862385321102 0.0 35.70642201834862 34.45871559633027 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 2.0 12 1.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 2.0 22 1.5 23 2.0 24 2.0 25 3.0 26 5.0 27 6.0 28 7.5 29 11.0 30 13.0 31 19.0 32 29.5 33 34.0 34 44.5 35 61.5 36 91.0 37 114.0 38 122.0 39 146.5 40 163.0 41 187.5 42 227.0 43 242.0 44 255.0 45 268.0 46 267.5 47 267.0 48 244.5 49 230.0 50 238.0 51 215.5 52 188.5 53 184.0 54 182.5 55 163.5 56 139.5 57 133.0 58 119.0 59 105.0 60 105.0 61 104.5 62 95.0 63 86.0 64 80.5 65 70.5 66 67.5 67 69.0 68 62.0 69 57.5 70 60.0 71 47.0 72 27.0 73 20.0 74 18.0 75 11.0 76 6.0 77 6.0 78 4.5 79 2.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.075 66 0.25 67 1.0999999999999999 68 2.9250000000000003 69 9.325 70 31.874999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 186015 spots for ERR5052718.sra Written 186015 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra Read 185999 spots for ERR5052718.sra Written 185999 spots for ERR5052718.sra SRR ids: ['ERR5052718.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__10arfsj ERR5052718.sra spots: 3719996 blocks: [[1, 185999], [186000, 371998], [371999, 557997], [557998, 743996], [743997, 929995], [929996, 1115994], [1115995, 1301993], [1301994, 1487992], [1487993, 1673991], [1673992, 1859990], [1859991, 2045989], [2045990, 2231988], [2231989, 2417987], [2417988, 2603986], [2603987, 2789985], [2789986, 2975984], [2975985, 3161983], [3161984, 3347982], [3347983, 3533981], [3533982, 3719996]] ERR5052718 file size 659002 ERR5052718 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052718 ERR5052718_1.fastq ERR5052718_2.fastq Input file: ERR5052718_1.fastq Paired file: ERR5052718_2.fastq trimmed: ERR5052718-trimmed-pair1.fastq, ERR5052718-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:48:13 2024 >> started Tue Dec 10 05:48:16 2024 >> done (3.302s) 3719996 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 16 ( 0.00%) empty read pairs filtered out after trimming by size control 3719980 (100.00%) read pairs available; of these: 13 ( 0.00%) trimmed read pairs available after processing 3719967 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 69 13 0.00% 70 3719967 100.00% 3719980 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=32 prefix-density=0.07 prefix-fanout=2.9 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=497.40 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=32.9 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=130.96 fanout-score-rank=8 prefix-density=0.65 prefix-fanout=18.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=456.61 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=15.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA ERR5052718 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:48:48 Started mapping on | Dec 10 05:48:48 Finished on | Dec 10 05:49:01 Mapping speed, Million of reads per hour | 1030.15 Number of input reads | 3719980 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3530296 Uniquely mapped reads % | 94.90% Average mapped length | 138.72 Number of splices: Total | 1734840 Number of splices: Annotated (sjdb) | 1650145 Number of splices: GT/AG | 1709878 Number of splices: GC/AG | 22069 Number of splices: AT/AC | 1191 Number of splices: Non-canonical | 1702 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 49245 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 3643 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 140439 140439 140439 N_multimapping 49245 49245 49245 N_noFeature 102206 3447603 124669 N_ambiguous 68165 297 8066 UnstrandedReadsAssigned:3359925 PositiveStrandReadsAssigned:82396 NegativeStrandReadsAssigned:3397561 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052718 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052718-trimmed-pair1.fastq ERR5052718-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,719,980 reads, 3,480,190 reads pseudoaligned [quant] estimated average fragment length: 194.257 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52973 ERR5052718.ke.tsv 35125 ERR5052718.se.tsv 88098 total ==> ERR5052718.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.922 9.56269e-07 5.62933e-07 PNS24247 1044 850.743 15.0093 7.71582 PNS24249 1928 1734.74 22.2052 5.59808 PNS24246 1044 850.743 15.0093 7.71582 PNS24248 1044 850.743 15.0093 7.71582 PNS24244 1471 1277.74 20.767 7.10804 PNS24243 293 117.86 0 0 KQK14069 1603 1409.74 2227.55 691.048 KQK14071 474 283.971 31.7216 48.8541 ==> ERR5052718.se.tsv <== BRADI_1g14170v3 2414 BRADI_1g53295v3 19 BRADI_1g59795v3 58 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 197 BRADI_1g74790v3 31 BRADI_1g09890v3 1 BRADI_1g77505v3 32 BRADI_1g48960v3 0 ERR5052718 completed mapping pipeline successfully