Starting /dee2/code/volunteer_pipeline.sh ERR5052719 current disk space = 1526766776320 free memory = 1435819768 ERR5052719 SRAfilesize d33f13c06d0b3fdadfa8eddc8f604992 ERR5052719.sra ERR5052719.sra file validated ERR5052719 is paired end ERR5052719 is conventional basespace ERR5052719 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052719_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.40425 35.0 35.0 35.0 35.0 35.0 2 34.5945 35.0 35.0 35.0 35.0 35.0 3 34.6265 35.0 35.0 35.0 35.0 35.0 4 34.6335 35.0 35.0 35.0 35.0 35.0 5 34.61075 35.0 35.0 35.0 35.0 35.0 6 39.38075 40.0 40.0 40.0 39.0 40.0 7 39.36525 40.0 40.0 40.0 39.0 40.0 8 39.24875 40.0 40.0 40.0 39.0 40.0 9 39.3045 40.0 40.0 40.0 39.0 40.0 10 39.34125 40.0 40.0 40.0 39.0 40.0 11 39.34475 40.0 40.0 40.0 39.0 40.0 12 39.363 40.0 40.0 40.0 39.0 40.0 13 39.348 40.0 40.0 40.0 39.0 40.0 14 39.31 40.0 40.0 40.0 39.0 40.0 15 39.31875 40.0 40.0 40.0 39.0 40.0 16 39.309 40.0 40.0 40.0 39.0 40.0 17 39.27975 40.0 40.0 40.0 39.0 40.0 18 39.27425 40.0 40.0 40.0 39.0 40.0 19 39.3265 40.0 40.0 40.0 39.0 40.0 20 39.34525 40.0 40.0 40.0 39.0 40.0 21 39.343 40.0 40.0 40.0 39.0 40.0 22 39.30175 40.0 40.0 40.0 39.0 40.0 23 39.33575 40.0 40.0 40.0 39.0 40.0 24 39.28375 40.0 40.0 40.0 39.0 40.0 25 39.2345 40.0 40.0 40.0 39.0 40.0 26 39.24625 40.0 40.0 40.0 39.0 40.0 27 39.25275 40.0 40.0 40.0 39.0 40.0 28 39.22775 40.0 40.0 40.0 39.0 40.0 29 39.19425 40.0 40.0 40.0 39.0 40.0 30 39.2675 40.0 40.0 40.0 39.0 40.0 31 39.26075 40.0 40.0 40.0 39.0 40.0 32 39.28625 40.0 40.0 40.0 39.0 40.0 33 39.28025 40.0 40.0 40.0 39.0 40.0 34 39.24375 40.0 40.0 40.0 39.0 40.0 35 39.20075 40.0 40.0 40.0 39.0 40.0 36 39.23475 40.0 40.0 40.0 39.0 40.0 37 39.2695 40.0 40.0 40.0 39.0 40.0 38 39.20675 40.0 40.0 40.0 39.0 40.0 39 39.24075 40.0 40.0 40.0 39.0 40.0 40 39.24275 40.0 40.0 40.0 39.0 40.0 41 39.16125 40.0 40.0 40.0 39.0 40.0 42 39.191 40.0 40.0 40.0 39.0 40.0 43 39.20725 40.0 40.0 40.0 39.0 40.0 44 39.17675 40.0 40.0 40.0 39.0 40.0 45 39.19225 40.0 40.0 40.0 39.0 40.0 46 39.19275 40.0 40.0 40.0 39.0 40.0 47 39.213 40.0 40.0 40.0 39.0 40.0 48 39.21525 40.0 40.0 40.0 39.0 40.0 49 39.208 40.0 40.0 40.0 39.0 40.0 50 39.19 40.0 40.0 40.0 39.0 40.0 51 39.2865 40.0 40.0 40.0 39.0 40.0 52 39.2265 40.0 40.0 40.0 39.0 40.0 53 39.184 40.0 40.0 40.0 39.0 40.0 54 39.178 40.0 40.0 40.0 39.0 40.0 55 39.21775 40.0 40.0 40.0 39.0 40.0 56 39.21575 40.0 40.0 40.0 39.0 40.0 57 39.108 40.0 40.0 40.0 39.0 40.0 58 39.16 40.0 40.0 40.0 39.0 40.0 59 39.222 40.0 40.0 40.0 39.0 40.0 60 39.2035 40.0 40.0 40.0 39.0 40.0 61 39.2095 40.0 40.0 40.0 39.0 40.0 62 39.21525 40.0 40.0 40.0 39.0 40.0 63 39.20075 40.0 40.0 40.0 39.0 40.0 64 39.15325 40.0 40.0 40.0 39.0 40.0 65 39.195 40.0 40.0 40.0 39.0 40.0 66 39.1465 40.0 40.0 40.0 39.0 40.0 67 39.2205 40.0 40.0 40.0 39.0 40.0 68 39.18925 40.0 40.0 40.0 39.0 40.0 69 39.2265 40.0 40.0 40.0 39.0 40.0 70 39.19075 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 6.0 27 12.0 28 17.0 29 15.0 30 29.0 31 24.0 32 31.0 33 39.0 34 49.0 35 66.0 36 64.0 37 103.0 38 242.0 39 3303.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.456308234701588 13.623772349534121 12.994208008058425 44.92571140770586 2 20.355088772193046 15.628907226806701 35.408852213053265 28.60715178794699 3 20.849999999999998 19.35 23.775 36.025 4 24.349999999999998 27.025 21.625 27.0 5 23.7 30.375000000000004 24.725 21.2 6 20.075000000000003 28.9 29.675 21.349999999999998 7 19.175 22.400000000000002 37.325 21.099999999999998 8 19.8 20.75 32.35 27.1 9 19.825 22.95 31.45 25.775 10 22.3 31.1 23.5 23.1 11 24.45 24.575 23.05 27.925 12 23.45 21.2 26.55 28.799999999999997 13 23.3 25.775 26.55 24.375 14 22.8 25.674999999999997 25.2 26.325 15 22.35 25.3 24.8 27.55 16 23.3 24.975 25.025 26.700000000000003 17 21.925 25.2 26.224999999999998 26.650000000000002 18 23.150000000000002 25.575 25.75 25.525 19 23.849999999999998 25.025 24.875 26.25 20 22.650000000000002 25.424999999999997 26.125 25.8 21 22.375 24.825 26.1 26.700000000000003 22 23.275000000000002 26.0 23.849999999999998 26.875 23 23.5 24.7 26.450000000000003 25.35 24 22.475 25.474999999999998 25.974999999999998 26.075 25 22.475 24.75 24.95 27.825 26 21.75 27.675 25.775 24.8 27 22.625 24.8 26.3 26.275 28 23.375 25.624999999999996 24.25 26.75 29 22.15 26.5 25.825 25.525 30 22.55 25.374999999999996 26.6 25.474999999999998 31 22.8 26.474999999999998 24.675 26.05 32 23.599999999999998 25.424999999999997 25.900000000000002 25.074999999999996 33 22.025 24.45 25.3 28.225 34 22.2 27.35 24.425 26.025 35 21.75 26.075 25.900000000000002 26.275 36 22.05 24.45 25.074999999999996 28.425 37 23.05 26.125 24.575 26.25 38 23.025000000000002 26.275 24.9 25.8 39 23.35 25.6 24.25 26.8 40 22.0 26.474999999999998 25.174999999999997 26.35 41 22.400000000000002 25.25 26.325 26.025 42 24.175 24.975 25.5 25.35 43 23.674999999999997 26.1 24.55 25.674999999999997 44 22.25 25.6 25.474999999999998 26.674999999999997 45 23.25 24.8 26.075 25.874999999999996 46 24.55 25.4 24.675 25.374999999999996 47 22.400000000000002 27.200000000000003 24.575 25.825 48 22.55 24.65 25.224999999999998 27.575 49 24.25 25.75 24.625 25.374999999999996 50 23.150000000000002 25.674999999999997 26.35 24.825 51 23.724999999999998 25.05 26.05 25.174999999999997 52 24.65 24.575 24.099999999999998 26.674999999999997 53 22.75 25.6 25.75 25.900000000000002 54 23.724999999999998 24.575 25.474999999999998 26.224999999999998 55 23.575 25.55 25.374999999999996 25.5 56 25.45 24.175 24.8 25.575 57 23.275000000000002 25.275 24.3 27.150000000000002 58 23.95 25.374999999999996 25.4 25.275 59 22.25 25.25 26.950000000000003 25.55 60 23.575 24.675 26.200000000000003 25.55 61 24.825 25.525 24.474999999999998 25.174999999999997 62 24.125 25.374999999999996 25.874999999999996 24.625 63 23.474999999999998 24.474999999999998 26.55 25.5 64 24.031007751937985 25.406351587896975 24.656164041010253 25.906476619154787 65 23.08654327163582 25.68784392196098 26.038019009504755 25.18759379689845 66 23.74874874874875 24.074074074074073 25.175175175175173 27.002002002002 67 23.762873649836724 25.018839487565934 24.541572469228836 26.6767143933685 68 23.99281498588658 24.069797279958944 26.0456761611496 25.891711573004876 69 24.29441062534588 20.337576092971776 26.867736579966795 28.50027670171555 70 25.018642803877704 0.0 37.47203579418345 37.50932140193885 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 5.5 27 7.0 28 10.5 29 13.5 30 13.0 31 19.5 32 30.0 33 34.0 34 46.5 35 63.0 36 88.0 37 109.0 38 135.0 39 177.0 40 193.0 41 198.0 42 238.0 43 273.0 44 274.0 45 280.0 46 279.0 47 273.0 48 259.0 49 239.0 50 233.0 51 219.5 52 188.0 53 170.0 54 161.0 55 145.5 56 130.0 57 121.0 58 124.0 59 111.5 60 96.0 61 88.0 62 83.0 63 86.0 64 76.5 65 68.5 66 62.5 67 55.0 68 51.0 69 41.5 70 36.0 71 32.0 72 22.0 73 16.0 74 14.0 75 8.5 76 4.5 77 4.0 78 3.5 79 2.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.7250000000000001 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.05 66 0.1 67 0.475 68 2.5749999999999997 69 9.65 70 32.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR5052719 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR5052719_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.18725 35.0 35.0 35.0 33.0 35.0 2 34.11275 35.0 35.0 35.0 33.0 35.0 3 33.9435 35.0 35.0 35.0 32.0 35.0 4 33.915 35.0 35.0 35.0 32.0 35.0 5 33.925 35.0 35.0 35.0 32.0 35.0 6 38.41625 40.0 40.0 40.0 37.0 40.0 7 38.452 40.0 40.0 40.0 36.0 40.0 8 38.262 40.0 40.0 40.0 36.0 40.0 9 38.3935 40.0 40.0 40.0 36.0 40.0 10 38.4465 40.0 40.0 40.0 36.0 40.0 11 38.41225 40.0 40.0 40.0 36.0 40.0 12 38.40225 40.0 40.0 40.0 36.0 40.0 13 38.411 40.0 40.0 40.0 36.0 40.0 14 38.45175 40.0 40.0 40.0 36.0 40.0 15 38.5025 40.0 40.0 40.0 37.0 40.0 16 38.44175 40.0 40.0 40.0 37.0 40.0 17 38.40625 40.0 40.0 40.0 36.0 40.0 18 38.434 40.0 40.0 40.0 36.0 40.0 19 38.3865 40.0 40.0 40.0 36.0 40.0 20 38.4235 40.0 40.0 40.0 36.0 40.0 21 38.45125 40.0 40.0 40.0 36.0 40.0 22 38.533 40.0 40.0 40.0 37.0 40.0 23 38.4515 40.0 40.0 40.0 36.0 40.0 24 38.503 40.0 40.0 40.0 37.0 40.0 25 38.4585 40.0 40.0 40.0 37.0 40.0 26 38.4925 40.0 40.0 40.0 37.0 40.0 27 38.51375 40.0 40.0 40.0 37.0 40.0 28 38.4175 40.0 40.0 40.0 36.0 40.0 29 38.39625 40.0 40.0 40.0 36.0 40.0 30 38.403 40.0 40.0 40.0 36.0 40.0 31 38.45225 40.0 40.0 40.0 37.0 40.0 32 38.435 40.0 40.0 40.0 36.0 40.0 33 38.385 40.0 40.0 40.0 36.0 40.0 34 38.382 40.0 40.0 40.0 37.0 40.0 35 38.468 40.0 40.0 40.0 36.0 40.0 36 38.386 40.0 40.0 40.0 36.0 40.0 37 38.35425 40.0 40.0 40.0 36.0 40.0 38 38.48925 40.0 40.0 40.0 37.0 40.0 39 38.4675 40.0 40.0 40.0 36.0 40.0 40 38.39 40.0 40.0 40.0 36.0 40.0 41 38.399 40.0 40.0 40.0 36.0 40.0 42 38.3095 40.0 40.0 40.0 36.0 40.0 43 38.36875 40.0 40.0 40.0 36.0 40.0 44 38.30925 40.0 40.0 40.0 36.0 40.0 45 38.31075 40.0 40.0 40.0 36.0 40.0 46 38.3525 40.0 40.0 40.0 36.0 40.0 47 38.324 40.0 39.0 40.0 36.0 40.0 48 38.33975 40.0 40.0 40.0 36.0 40.0 49 38.34675 40.0 40.0 40.0 36.0 40.0 50 38.38325 40.0 40.0 40.0 36.0 40.0 51 38.34225 40.0 40.0 40.0 36.0 40.0 52 38.2995 40.0 40.0 40.0 36.0 40.0 53 38.29525 40.0 40.0 40.0 36.0 40.0 54 38.3405 40.0 39.0 40.0 36.0 40.0 55 38.2845 40.0 40.0 40.0 36.0 40.0 56 38.307 40.0 40.0 40.0 36.0 40.0 57 38.412 40.0 40.0 40.0 36.0 40.0 58 38.28075 40.0 40.0 40.0 36.0 40.0 59 38.3005 40.0 40.0 40.0 36.0 40.0 60 38.23075 40.0 40.0 40.0 36.0 40.0 61 38.278 40.0 40.0 40.0 36.0 40.0 62 38.28025 40.0 40.0 40.0 36.0 40.0 63 38.2285 40.0 39.0 40.0 36.0 40.0 64 38.27275 40.0 40.0 40.0 36.0 40.0 65 38.31825 40.0 39.0 40.0 36.0 40.0 66 38.20075 40.0 39.0 40.0 36.0 40.0 67 38.24525 40.0 40.0 40.0 36.0 40.0 68 38.2705 40.0 39.0 40.0 36.0 40.0 69 38.189 40.0 39.0 40.0 35.0 40.0 70 38.3825 40.0 39.0 40.0 36.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 6.0 18 15.0 19 23.0 20 25.0 21 27.0 22 27.0 23 20.0 24 23.0 25 17.0 26 19.0 27 20.0 28 19.0 29 20.0 30 24.0 31 21.0 32 26.0 33 32.0 34 43.0 35 54.0 36 59.0 37 115.0 38 236.0 39 3129.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.725 17.05 17.875 35.35 2 26.224999999999998 25.025 26.75 22.0 3 21.2 26.1 26.400000000000002 26.3 4 25.224999999999998 29.275000000000002 21.925 23.575 5 26.724999999999998 32.2 21.675 19.400000000000002 6 21.966474856142106 31.17338003502627 24.168126094570926 22.692019014260694 7 23.799999999999997 18.2 34.225 23.775 8 22.05 21.65 27.725 28.575 9 23.150000000000002 23.65 26.525 26.674999999999997 10 24.975 29.725 22.825 22.475 11 28.199999999999996 22.6 21.95 27.250000000000004 12 24.349999999999998 22.25 25.775 27.625 13 24.7 24.075 26.5 24.725 14 24.625 25.424999999999997 24.125 25.825 15 24.175 25.724999999999998 25.45 24.65 16 27.200000000000003 25.025 22.95 24.825 17 25.674999999999997 25.275 24.425 24.625 18 26.5 25.324999999999996 24.224999999999998 23.95 19 25.874999999999996 25.900000000000002 23.525 24.7 20 25.124999999999996 25.55 24.675 24.65 21 24.224999999999998 25.924999999999997 25.1 24.75 22 26.150000000000002 24.8 23.65 25.4 23 24.95 25.1 24.8 25.15 24 25.45 24.925 25.45 24.175 25 25.624999999999996 24.8 23.925 25.650000000000002 26 26.35 25.650000000000002 24.25 23.75 27 24.5 25.575 25.374999999999996 24.55 28 26.0 25.424999999999997 24.675 23.9 29 25.474999999999998 25.974999999999998 25.35 23.200000000000003 30 25.3 25.1 24.95 24.65 31 25.374999999999996 25.924999999999997 24.474999999999998 24.224999999999998 32 25.5 27.200000000000003 23.974999999999998 23.325000000000003 33 25.25 25.324999999999996 24.775 24.65 34 25.275 26.0 24.3 24.425 35 25.825 24.45 25.0 24.725 36 25.074999999999996 25.224999999999998 24.775 24.925 37 25.575 24.474999999999998 25.374999999999996 24.575 38 26.075 25.7 23.974999999999998 24.25 39 25.174999999999997 24.95 24.775 25.1 40 25.674999999999997 25.374999999999996 24.325 24.625 41 25.775 25.15 24.375 24.7 42 24.224999999999998 26.05 24.925 24.8 43 26.75 24.099999999999998 24.975 24.175 44 25.025 26.0 24.6 24.375 45 24.3 25.624999999999996 25.275 24.8 46 26.174999999999997 24.9 24.2 24.725 47 27.474999999999998 24.95 24.125 23.45 48 25.8 26.5 23.9 23.799999999999997 49 25.45 24.8 24.425 25.324999999999996 50 27.750000000000004 25.0 24.325 22.925 51 25.575 24.75 24.3 25.374999999999996 52 26.75 24.175 24.8 24.275 53 27.925 25.575 22.95 23.549999999999997 54 25.0 25.525 25.424999999999997 24.05 55 26.55 24.525 23.7 25.224999999999998 56 26.424999999999997 25.4 24.425 23.75 57 25.224999999999998 25.924999999999997 26.125 22.725 58 26.650000000000002 23.65 24.65 25.05 59 27.175 24.575 24.775 23.474999999999998 60 25.724999999999998 26.474999999999998 25.324999999999996 22.475 61 26.0 25.0 25.324999999999996 23.674999999999997 62 27.875 23.974999999999998 24.05 24.099999999999998 63 24.725 26.0 25.15 24.125 64 26.38159539884971 25.056264066016503 25.006251562890725 23.55588897224306 65 27.45245245245245 24.424424424424423 24.34934934934935 23.773773773773772 66 24.9248496993988 24.37374749498998 25.651302605210418 25.0501002004008 67 26.72544080604534 24.937027707808564 24.861460957178842 23.476070528967256 68 26.210092687950564 23.970133882595263 25.566426364572603 24.253347064881563 69 26.22259696458685 19.33670601461495 28.780213603147835 25.660483417650365 70 28.41079460269865 0.0 37.21889055472264 34.37031484257871 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.0 24 0.5 25 2.0 26 4.0 27 4.0 28 6.0 29 10.0 30 12.0 31 14.0 32 27.0 33 38.0 34 42.5 35 59.0 36 92.5 37 114.0 38 122.5 39 166.0 40 201.0 41 219.5 42 243.0 43 248.0 44 240.5 45 239.0 46 257.0 47 269.0 48 249.0 49 216.5 50 204.0 51 206.0 52 186.5 53 165.0 54 165.5 55 159.5 56 148.5 57 144.0 58 130.0 59 116.0 60 116.0 61 108.0 62 91.5 63 83.0 64 84.0 65 82.0 66 72.0 67 65.0 68 59.5 69 54.0 70 54.0 71 46.5 72 31.5 73 24.0 74 18.0 75 11.5 76 6.5 77 2.0 78 2.0 79 1.0 80 0.0 81 0.5 82 1.5 83 2.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.025 65 0.1 66 0.2 67 0.75 68 2.9000000000000004 69 11.05 70 33.300000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190150 spots for ERR5052719.sra Written 190150 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra Read 190140 spots for ERR5052719.sra Written 190140 spots for ERR5052719.sra SRR ids: ['ERR5052719.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g2l9siiq ERR5052719.sra spots: 3802810 blocks: [[1, 190140], [190141, 380280], [380281, 570420], [570421, 760560], [760561, 950700], [950701, 1140840], [1140841, 1330980], [1330981, 1521120], [1521121, 1711260], [1711261, 1901400], [1901401, 2091540], [2091541, 2281680], [2281681, 2471820], [2471821, 2661960], [2661961, 2852100], [2852101, 3042240], [3042241, 3232380], [3232381, 3422520], [3422521, 3612660], [3612661, 3802810]] ERR5052719 file size 673720 ERR5052719 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR5052719 ERR5052719_1.fastq ERR5052719_2.fastq Input file: ERR5052719_1.fastq Paired file: ERR5052719_2.fastq trimmed: ERR5052719-trimmed-pair1.fastq, ERR5052719-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:21:29 2024 >> started Tue Dec 10 08:21:33 2024 >> done (3.800s) 3802810 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 19 ( 0.00%) empty read pairs filtered out after trimming by size control 3802791 (100.00%) read pairs available; of these: 14 ( 0.00%) trimmed read pairs available after processing 3802777 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 12 0.00% 70 3802777 100.00% 3802791 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=32 prefix-density=0.08 prefix-fanout=2.5 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=589.89 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=22.2 sequence=CAGCAGCAGGATACATGGAAGGAAGACAATAGATAAAGATTCCAGAGCCAGACGGATGACACAGACGGACCCCTATGGCCCGAAGCCCAACCTAAACCCAGATCTCATCAGACTCACTCACACAGACACGATAGCGACACGCGAGACTCGGATCTTATTTTGTTTAACGACACGACGACGAC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=126.28 fanout-score-rank=9 prefix-density=0.63 prefix-fanout=18.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=545.78 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=16.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA ERR5052719 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:22:09 Started mapping on | Dec 10 08:22:10 Finished on | Dec 10 08:22:24 Mapping speed, Million of reads per hour | 977.86 Number of input reads | 3802791 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3606719 Uniquely mapped reads % | 94.84% Average mapped length | 138.72 Number of splices: Total | 1773405 Number of splices: Annotated (sjdb) | 1686811 Number of splices: GT/AG | 1747544 Number of splices: GC/AG | 22965 Number of splices: AT/AC | 1181 Number of splices: Non-canonical | 1715 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 50170 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 3812 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 145902 145902 145902 N_multimapping 50170 50170 50170 N_noFeature 104660 3522408 127527 N_ambiguous 69699 313 8390 UnstrandedReadsAssigned:3432360 PositiveStrandReadsAssigned:83998 NegativeStrandReadsAssigned:3470802 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR5052719 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR5052719-trimmed-pair1.fastq ERR5052719-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,802,791 reads, 3,558,427 reads pseudoaligned [quant] estimated average fragment length: 193.962 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52973 ERR5052719.ke.tsv 35125 ERR5052719.se.tsv 88098 total ==> ERR5052719.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 743.21 0 0 PNS24247 1044 851.038 16.2107 8.157 PNS24249 1928 1735.04 30.799 7.60159 PNS24246 1044 851.038 16.2107 8.157 PNS24248 1044 851.038 16.2107 8.157 PNS24244 1471 1278.04 23.5689 7.89718 PNS24243 293 118.035 0 0 KQK14069 1603 1410.04 2293.21 696.452 KQK14071 474 284.236 47.3657 71.3613 ==> ERR5052719.se.tsv <== BRADI_1g14170v3 2533 BRADI_1g53295v3 24 BRADI_1g59795v3 75 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 208 BRADI_1g74790v3 33 BRADI_1g09890v3 0 BRADI_1g77505v3 36 BRADI_1g48960v3 0 ERR5052719 completed mapping pipeline successfully