Starting /dee2/code/volunteer_pipeline.sh ERR6133365 current disk space = 1548125839360 free memory = 1600106412 ERR6133365 SRAfilesize 7f7d90513e63123121cae1e68d7c3287 ERR6133365.sra ERR6133365.sra file validated ERR6133365 is single end ERR6133365 is conventional basespace ERR6133365 read1 length is 70-93 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6133365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-93 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.90725 37.0 37.0 37.0 37.0 37.0 2 36.7695 37.0 37.0 37.0 37.0 37.0 3 36.63825 37.0 37.0 37.0 37.0 37.0 4 36.08075 37.0 37.0 37.0 33.0 37.0 5 36.13225 37.0 37.0 37.0 33.0 37.0 6 36.2885 37.0 37.0 37.0 33.0 37.0 7 38.18475 40.0 37.0 40.0 37.0 40.0 8 38.214 40.0 37.0 40.0 37.0 40.0 9 38.185 40.0 37.0 40.0 37.0 40.0 10-11 38.11475 40.0 37.0 40.0 37.0 40.0 12-13 38.134625 40.0 37.0 40.0 37.0 40.0 14-15 38.101625 40.0 37.0 40.0 37.0 40.0 16-17 37.957125 40.0 37.0 40.0 35.0 40.0 18-19 37.910125 40.0 37.0 40.0 33.0 40.0 20-21 37.74975 40.0 37.0 40.0 33.0 40.0 22-23 37.68675 38.5 37.0 40.0 33.0 40.0 24-25 37.544125 37.0 37.0 40.0 33.0 40.0 26-27 37.428125 37.0 37.0 40.0 33.0 40.0 28-29 37.371 37.0 37.0 40.0 33.0 40.0 30-31 37.23125 37.0 37.0 40.0 33.0 40.0 32-33 37.0055 37.0 37.0 40.0 33.0 40.0 34-35 36.80275 37.0 37.0 40.0 33.0 40.0 36-37 36.855875 37.0 37.0 40.0 33.0 40.0 38-39 36.88575 37.0 37.0 40.0 33.0 40.0 40-41 37.176249999999996 37.0 37.0 40.0 33.0 40.0 42-43 37.148375 37.0 37.0 40.0 33.0 40.0 44-45 37.057875 37.0 37.0 40.0 33.0 40.0 46-47 36.75 37.0 37.0 40.0 33.0 40.0 48-49 36.638125 37.0 37.0 40.0 33.0 40.0 50-51 36.5465 37.0 37.0 37.0 33.0 40.0 52-53 36.385374999999996 37.0 37.0 37.0 33.0 40.0 54-55 36.229375000000005 37.0 37.0 37.0 33.0 40.0 56-57 35.94925 37.0 37.0 37.0 33.0 40.0 58-59 35.815 37.0 37.0 37.0 33.0 38.5 60-61 35.697375 37.0 37.0 37.0 33.0 37.0 62-63 35.40775 37.0 33.0 37.0 33.0 37.0 64-65 35.256 37.0 33.0 37.0 33.0 37.0 66-67 35.223124999999996 37.0 33.0 37.0 33.0 37.0 68-69 34.330375000000004 35.0 33.0 37.0 30.0 37.0 70-71 34.43661522066199 37.0 33.0 37.0 33.0 37.0 72-73 34.96564692876751 37.0 33.0 37.0 33.0 37.0 74-75 34.96569930055452 37.0 33.0 37.0 33.0 37.0 76-77 34.92680274556031 37.0 33.0 37.0 33.0 37.0 78-79 35.03242339444356 37.0 33.0 37.0 33.0 37.0 80-81 34.82813096367826 37.0 33.0 37.0 33.0 37.0 82-83 34.62239616223361 37.0 33.0 37.0 33.0 37.0 84-85 34.65761730620654 37.0 33.0 37.0 33.0 37.0 86-87 34.44941935483871 37.0 33.0 37.0 33.0 37.0 88-89 34.41096774193549 37.0 33.0 37.0 33.0 37.0 90-91 34.173806451612904 37.0 33.0 37.0 33.0 37.0 92-93 33.88748387096774 37.0 33.0 37.0 27.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 4.0 21 3.0 22 6.0 23 7.0 24 7.0 25 11.0 26 16.0 27 26.0 28 36.0 29 45.0 30 52.0 31 70.0 32 96.0 33 112.0 34 199.0 35 422.0 36 960.0 37 1064.0 38 842.0 39 22.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 84.65 3.8249999999999997 3.55 7.9750000000000005 2 63.949999999999996 21.025 9.2 5.825 3 35.625 38.3 14.374999999999998 11.700000000000001 4 35.199999999999996 25.900000000000002 18.575 20.325 5 23.325000000000003 33.1 24.474999999999998 19.1 6 19.400000000000002 39.15 25.825 15.625 7 35.475 28.425 20.200000000000003 15.9 8 31.674999999999997 28.999999999999996 23.375 15.950000000000001 9 25.2 28.575 27.425 18.8 10-11 26.1 27.712500000000002 26.3125 19.875 12-13 28.5625 25.525 27.8875 18.025 14-15 23.7 26.424999999999997 29.9375 19.9375 16-17 26.474999999999998 30.7375 25.7375 17.05 18-19 24.5125 26.337500000000002 26.437500000000004 22.7125 20-21 26.2125 25.8625 27.1375 20.7875 22-23 28.15 23.25 27.3875 21.212500000000002 24-25 27.200000000000003 24.925 26.875 21.0 26-27 25.9875 26.3125 28.512500000000003 19.1875 28-29 25.912499999999998 25.55 27.0125 21.525 30-31 27.737499999999997 25.35 26.424999999999997 20.4875 32-33 24.349999999999998 27.737499999999997 27.775 20.1375 34-35 26.3125 23.8125 28.1 21.775 36-37 25.5375 24.25 27.900000000000002 22.3125 38-39 26.0375 24.7875 29.75 19.425 40-41 25.9625 25.912499999999998 27.450000000000003 20.674999999999997 42-43 25.4 28.375 26.137500000000003 20.0875 44-45 24.6875 25.525 28.775000000000002 21.0125 46-47 25.724999999999998 23.1875 27.212500000000002 23.875 48-49 24.5625 24.8125 29.7 20.925 50-51 25.025 26.1125 28.975 19.8875 52-53 25.1875 27.275 27.125 20.4125 54-55 23.5625 28.1375 27.35 20.95 56-57 26.6125 24.637500000000003 27.750000000000004 21.0 58-59 23.225 24.65 29.762499999999996 22.3625 60-61 25.7 24.587500000000002 28.199999999999996 21.512500000000003 62-63 22.225 27.625 30.95 19.2 64-65 23.974999999999998 26.5625 28.725 20.7375 66-67 25.525 26.887499999999996 28.15 19.4375 68-69 24.425 26.1 28.6625 20.8125 70-71 25.763645468202302 24.01101652478718 28.65548322483726 21.56985478217326 72-73 26.58450704225352 25.037726358148895 27.527665995975852 20.85010060362173 74-75 23.536092882382633 26.918223119636547 28.899545683997978 20.64613831398284 76-77 22.646052464833353 26.739323279685717 29.99619820048156 20.618426054999368 78-79 25.45824847250509 24.618126272912424 30.14256619144603 19.781059063136457 80-81 24.89149859586418 26.71687515956089 29.550676538166964 18.840949706407965 82-83 24.544755065401386 24.339574249807644 29.917927673762502 21.197743011028468 84-85 24.181490074761534 23.36942510956432 30.574890435679297 21.874194379994844 86-87 23.67741935483871 25.74193548387097 30.72258064516129 19.85806451612903 88-89 23.483870967741936 28.12903225806452 30.206451612903223 18.180645161290325 90-91 25.81935483870968 25.85806451612903 29.458064516129035 18.864516129032257 92-93 24.18064516129032 27.39354838709677 29.419354838709676 19.006451612903223 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 5.5 18 6.0 19 1.0 20 0.5 21 1.0 22 1.5 23 2.0 24 3.0 25 4.5 26 9.5 27 12.0 28 13.0 29 15.5 30 24.5 31 32.5 32 32.5 33 45.0 34 67.5 35 83.5 36 95.5 37 121.5 38 161.0 39 178.5 40 172.5 41 175.5 42 199.0 43 214.0 44 195.5 45 182.5 46 211.0 47 212.5 48 188.5 49 168.5 50 167.5 51 176.5 52 160.5 53 167.0 54 144.5 55 95.0 56 77.5 57 75.5 58 70.0 59 52.0 60 46.5 61 48.0 62 38.5 63 31.5 64 32.0 65 29.0 66 21.5 67 21.5 68 16.5 69 8.0 70 4.5 71 3.0 72 2.0 73 1.0 74 1.5 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 12.0 71 10.0 72 4.0 73 9.0 74 6.0 75 9.0 76 9.0 77 9.0 78 8.0 79 4.0 80 6.0 81 10.0 82 10.0 83 11.0 84 8.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 3875.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.52094931145619 80.65 2 3.3401699384705537 5.7 3 0.9668912979783182 2.475 4 0.41019630823322595 1.4000000000000001 5 0.11719894520949312 0.5 6 0.02929973630237328 0.15 7 0.08789920890711983 0.525 8 0.08789920890711983 0.6 9 0.02929973630237328 0.22499999999999998 >10 0.3808965719308526 6.3 >50 0.02929973630237328 1.4749999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGT 59 1.4749999999999999 No Hit GGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGG 46 1.15 No Hit GGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTG 29 0.7250000000000001 No Hit GGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTT 28 0.7000000000000001 No Hit TACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTT 25 0.625 No Hit GGGAGAGCAATACAAGCGTTGTGCTGCTAGGCGAAGCGGTTGAGTGCCGC 24 0.6 No Hit GGGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAA 18 0.44999999999999996 No Hit GGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAA 14 0.35000000000000003 No Hit GAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGC 13 0.325 No Hit GTATTTAGCCTTGCAAGGTGGTCCTTGCTGATTCACACGGGATTCCACGT 13 0.325 No Hit GGAGTATCCTTGATATATAAATATATAGATAAATAGATTTAAATGGAAAA 11 0.27499999999999997 No Hit GGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGG 11 0.27499999999999997 No Hit GGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGC 10 0.25 No Hit GGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTG 10 0.25 No Hit GAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAAT 9 0.22499999999999998 No Hit GGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAA 8 0.2 No Hit GGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTAC 8 0.2 No Hit GGGACGCATGCAACGACCATCTACATATAGCTACTCGATCTACCGCTACC 8 0.2 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCG 7 0.17500000000000002 No Hit GGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGC 7 0.17500000000000002 No Hit GGGAGTATTATGAAAGGAGATTAATCATAGATTATCAAAAACCCTAGAAA 7 0.17500000000000002 No Hit GGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAAA 6 0.15 No Hit AGTATGGCATCGGTTACATACTTCAGTGCCGTAGCGCCTGGTATGAGCCT 5 0.125 No Hit GTATGGAAGGCGATCAAATTCGAGTTCGCGCCGGTAGATACTATCGATTA 5 0.125 No Hit GGAGTTGAAAATAAGCATAGATCCGGAGATTCCCAAATAGGTCAACCTTT 5 0.125 No Hit GGGGAAGTACACCAGCGACGGCGAGGCCGCCGCCGCCAAGGAAGGCATGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra Rejected 76059 READS because READLEN < 1 Read 76059 spots for ERR6133365.sra Written 76059 spots for ERR6133365.sra SRR ids: ['ERR6133365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__2qdxqrd ERR6133365.sra spots: 1521180 blocks: [[1, 76059], [76060, 152118], [152119, 228177], [228178, 304236], [304237, 380295], [380296, 456354], [456355, 532413], [532414, 608472], [608473, 684531], [684532, 760590], [760591, 836649], [836650, 912708], [912709, 988767], [988768, 1064826], [1064827, 1140885], [1140886, 1216944], [1216945, 1293003], [1293004, 1369062], [1369063, 1445121], [1445122, 1521180]] ERR6133365 file size 334936 ERR6133365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6133365 ERR6133365_1.fastq Input file: ERR6133365_1.fastq trimmed: ERR6133365-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 01:30:21 2024 >> started Sat Dec 7 01:30:22 2024 >> done (0.878s) 1521180 reads processed; of these: 177 ( 0.01%) short reads filtered out after trimming by size control 2 ( 0.00%) empty reads filtered out after trimming by size control 1521001 (99.99%) reads available; of these: 65091 ( 4.28%) trimmed reads available after processing 1455910 (95.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 30 0.00% 20 13 0.00% 21 5 0.00% 22 15 0.00% 23 9 0.00% 24 11 0.00% 25 5 0.00% 26 12 0.00% 27 8 0.00% 28 6 0.00% 29 225 0.01% 30 6 0.00% 31 10 0.00% 32 12 0.00% 33 10 0.00% 34 3 0.00% 35 4 0.00% 36 3 0.00% 37 6 0.00% 38 15 0.00% 39 23 0.00% 40 62 0.00% 41 16 0.00% 42 11 0.00% 43 5 0.00% 44 13 0.00% 45 17 0.00% 46 31 0.00% 47 38 0.00% 48 64 0.00% 49 518 0.03% 50 147 0.01% 51 145 0.01% 52 126 0.01% 53 182 0.01% 54 215 0.01% 55 245 0.02% 56 243 0.02% 57 381 0.03% 58 314 0.02% 59 399 0.03% 60 466 0.03% 61 393 0.03% 62 396 0.03% 63 559 0.04% 64 513 0.03% 65 492 0.03% 66 575 0.04% 67 672 0.04% 68 887 0.06% 69 352 0.02% 70 3574 0.23% 71 3906 0.26% 72 4316 0.28% 73 3870 0.25% 74 4139 0.27% 75 4217 0.28% 76 3912 0.26% 77 4066 0.27% 78 4437 0.29% 79 4712 0.31% 80 4618 0.30% 81 4801 0.32% 82 5629 0.37% 83 6610 0.43% 84 5847 0.38% 85 2725 0.18% 86 2974 0.20% 87 3422 0.22% 88 4439 0.29% 89 4408 0.29% 90 5863 0.39% 91 6666 0.44% 92 7236 0.48% 93 1405695 92.42% 1521001 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=8.73 fanout-score-rank=12 prefix-density=0.56 prefix-fanout=5.1 sequence=ATGCATGCATGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=89.83 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.1 sequence=TTTTTTTTTTAAGAATCCTCCATTTTTGTTCTTCCACCCATGCAATAGAGAGCAAATGGGAAAAGAGGGGTTACTTTTTTTCATTTTTCCCTTAAAAGATAGGCTTTGAAATCGGAGTCATGGAATAATGGTGAATTCAAATGTTTAGTTCTTTAGTATAAGAAGTATAAGAA Started job on | Dec 07 01:30:34 Started mapping on | Dec 07 01:30:34 Finished on | Dec 07 01:30:39 Mapping speed, Million of reads per hour | 1095.12 Number of input reads | 1521001 Average input read length | 92 UNIQUE READS: Uniquely mapped reads number | 1189222 Uniquely mapped reads % | 78.19% Average mapped length | 91.54 Number of splices: Total | 67327 Number of splices: Annotated (sjdb) | 57043 Number of splices: GT/AG | 64423 Number of splices: GC/AG | 1533 Number of splices: AT/AC | 17 Number of splices: Non-canonical | 1354 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.05% Deletion average length | 1.95 Insertion rate per base | 0.03% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275274 % of reads mapped to multiple loci | 18.10% Number of reads mapped to too many loci | 10501 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 56505 56505 56505 N_multimapping 275274 275274 275274 N_noFeature 55163 66779 1135753 N_ambiguous 45203 3346 154 UnstrandedReadsAssigned:1088856 PositiveStrandReadsAssigned:1119097 NegativeStrandReadsAssigned:53315 Dataset is classified positive stranded MeadianReadLen=93 20thPercentileLength=93 echo kmer=89 ERR6133365 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR6133365-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,521,001 reads, 1,287,639 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 950 rounds 52973 ERR6133365.ke.tsv 35125 ERR6133365.se.tsv 88098 total ==> ERR6133365.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 46 35.6262 PNS24243 293 194 0 0 KQK14069 1603 1504 9 6.35859 KQK14071 474 375 0 0 ==> ERR6133365.se.tsv <== BRADI_1g14170v3 10 BRADI_1g53295v3 23 BRADI_1g59795v3 9 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 27 BRADI_1g74790v3 13 BRADI_1g09890v3 0 BRADI_1g77505v3 27 BRADI_1g48960v3 0 ERR6133365 completed mapping pipeline successfully