Starting /dee2/code/volunteer_pipeline.sh ERR6133386 current disk space = 1547613908992 free memory = 1601967260 ERR6133386 SRAfilesize 4cc39a8a5920ff9901082b0f32188a8c ERR6133386.sra ERR6133386.sra file validated ERR6133386 is single end ERR6133386 is conventional basespace ERR6133386 read1 length is 70-93 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6133386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-93 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.918 37.0 37.0 37.0 37.0 37.0 2 36.8245 37.0 37.0 37.0 37.0 37.0 3 36.58575 37.0 37.0 37.0 37.0 37.0 4 36.04075 37.0 37.0 37.0 33.0 37.0 5 36.0435 37.0 37.0 37.0 33.0 37.0 6 36.197 37.0 37.0 37.0 33.0 37.0 7 38.18525 40.0 37.0 40.0 37.0 40.0 8 38.15575 40.0 37.0 40.0 37.0 40.0 9 38.216 40.0 37.0 40.0 37.0 40.0 10-11 38.14975 40.0 37.0 40.0 37.0 40.0 12-13 38.22325 40.0 37.0 40.0 37.0 40.0 14-15 38.124624999999995 40.0 37.0 40.0 37.0 40.0 16-17 38.012375 40.0 37.0 40.0 35.0 40.0 18-19 37.93075 40.0 37.0 40.0 33.0 40.0 20-21 37.894625000000005 40.0 37.0 40.0 33.0 40.0 22-23 37.84425 40.0 37.0 40.0 33.0 40.0 24-25 37.652625 40.0 37.0 40.0 33.0 40.0 26-27 37.469875 38.5 37.0 40.0 33.0 40.0 28-29 37.381875 37.0 37.0 40.0 33.0 40.0 30-31 37.383 37.0 37.0 40.0 33.0 40.0 32-33 37.043125 37.0 37.0 40.0 33.0 40.0 34-35 36.902249999999995 37.0 37.0 40.0 33.0 40.0 36-37 36.807249999999996 37.0 37.0 40.0 33.0 40.0 38-39 36.957875 37.0 37.0 40.0 33.0 40.0 40-41 37.174375 37.0 37.0 40.0 33.0 40.0 42-43 37.0505 37.0 37.0 40.0 33.0 40.0 44-45 37.019375 37.0 37.0 40.0 33.0 40.0 46-47 36.761250000000004 37.0 37.0 40.0 33.0 40.0 48-49 36.6125 37.0 37.0 40.0 33.0 40.0 50-51 36.492 37.0 37.0 38.5 33.0 40.0 52-53 36.381875 37.0 37.0 37.0 33.0 40.0 54-55 36.283 37.0 37.0 37.0 33.0 40.0 56-57 36.03975 37.0 37.0 37.0 33.0 40.0 58-59 35.891625000000005 37.0 37.0 37.0 33.0 40.0 60-61 35.729 37.0 37.0 37.0 33.0 38.5 62-63 35.5115 37.0 35.0 37.0 33.0 37.0 64-65 35.208375 37.0 33.0 37.0 33.0 37.0 66-67 35.255624999999995 37.0 33.0 37.0 33.0 37.0 68-69 34.28725 35.0 33.0 37.0 30.0 37.0 70-71 34.484091399197595 37.0 33.0 37.0 33.0 37.0 72-73 34.943365962791304 37.0 33.0 37.0 33.0 37.0 74-75 34.98017863858412 37.0 33.0 37.0 33.0 37.0 76-77 34.808148923265705 37.0 33.0 37.0 33.0 37.0 78-79 34.936350895797155 37.0 33.0 37.0 33.0 37.0 80-81 34.787565780135594 37.0 33.0 37.0 33.0 37.0 82-83 34.42606252430016 37.0 33.0 37.0 33.0 37.0 84-85 34.48646086573525 37.0 33.0 37.0 33.0 37.0 86-87 34.41544117647059 37.0 33.0 37.0 33.0 37.0 88-89 34.41951155462185 37.0 33.0 37.0 33.0 37.0 90-91 34.03374474789916 37.0 33.0 37.0 27.0 37.0 92-93 33.90690651260505 37.0 33.0 37.0 30.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 9.0 21 5.0 22 7.0 23 10.0 24 15.0 25 17.0 26 18.0 27 33.0 28 22.0 29 48.0 30 48.0 31 67.0 32 91.0 33 110.0 34 186.0 35 377.0 36 908.0 37 1035.0 38 948.0 39 46.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 81.925 4.35 4.45 9.275 2 60.975 22.375 10.225 6.425 3 34.775 37.0 15.875 12.35 4 34.050000000000004 26.5 19.975 19.475 5 22.45 32.175 25.324999999999996 20.05 6 19.425 38.775 26.875 14.924999999999999 7 34.949999999999996 28.925 19.35 16.775000000000002 8 30.475 29.625 24.025 15.875 9 25.55 27.425 28.125 18.9 10-11 24.9875 28.787499999999998 27.0 19.225 12-13 27.712500000000002 24.7875 29.012500000000003 18.4875 14-15 23.1625 26.1125 31.0125 19.7125 16-17 25.4625 31.7375 25.637500000000003 17.1625 18-19 23.1875 26.337500000000002 27.737499999999997 22.7375 20-21 24.5125 25.887500000000003 28.3375 21.2625 22-23 26.650000000000002 23.225 28.475 21.65 24-25 25.825 23.3625 29.0875 21.725 26-27 25.55 25.3125 29.049999999999997 20.0875 28-29 25.6 25.387500000000003 28.125 20.8875 30-31 25.6125 25.025 28.0875 21.275 32-33 23.7875 27.425 28.65 20.1375 34-35 25.837500000000002 23.7 29.049999999999997 21.4125 36-37 24.887500000000003 24.325 29.2875 21.5 38-39 25.112499999999997 24.7875 30.2875 19.8125 40-41 26.775 24.0125 28.4125 20.8 42-43 23.962500000000002 27.55 28.3375 20.150000000000002 44-45 23.4875 25.900000000000002 29.462500000000002 21.15 46-47 24.9375 24.1625 28.5875 22.3125 48-49 25.124999999999996 25.0 30.225 19.650000000000002 50-51 24.825 25.25 29.325000000000003 20.599999999999998 52-53 24.6875 26.187500000000004 28.1625 20.962500000000002 54-55 24.4375 26.674999999999997 28.212500000000002 20.674999999999997 56-57 24.55 26.2875 28.725 20.4375 58-59 22.7125 25.4375 30.112499999999997 21.7375 60-61 24.4125 25.45 29.462500000000002 20.674999999999997 62-63 22.425 27.525 30.312499999999996 19.7375 64-65 23.4875 26.05 30.175 20.2875 66-67 24.762500000000003 26.9125 29.175 19.15 68-69 24.3 25.5125 28.812500000000004 21.375 70-71 24.962443665498245 25.375563345017525 29.256384576865297 20.40560841261893 72-73 24.760584677419356 25.037802419354836 29.548891129032256 20.652721774193548 74-75 23.597359735973598 25.882203604975885 30.198019801980198 20.322416857070323 76-77 22.84620293554563 25.34779834077856 31.193363114231015 20.612635609444798 78-79 24.772173020151456 24.412783981517137 30.53523296110897 20.279810037222436 80-81 24.78047520661157 26.136363636363637 29.571280991735538 19.511880165289256 82-83 24.21408157963107 25.253312548713954 30.189659651857625 20.34294621979735 84-85 24.662560608046128 24.29563622067881 30.939588520508455 20.10221465076661 86-87 22.518382352941178 27.00892857142857 30.84296218487395 19.629726890756302 88-89 22.938550420168067 26.326155462184875 32.024684873949575 18.71060924369748 90-91 24.422268907563023 26.011029411764707 30.19957983193277 19.367121848739497 92-93 22.22951680672269 28.912815126050422 30.13392857142857 18.72373949579832 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 2.5 18 4.0 19 2.0 20 0.5 21 0.0 22 0.0 23 2.5 24 4.0 25 3.5 26 9.0 27 16.0 28 22.5 29 26.0 30 25.0 31 23.0 32 39.5 33 61.0 34 73.5 35 100.5 36 119.5 37 138.5 38 169.0 39 191.0 40 206.5 41 201.5 42 194.5 43 197.5 44 203.5 45 213.0 46 219.5 47 204.5 48 175.5 49 168.0 50 182.0 51 176.0 52 146.5 53 133.0 54 107.0 55 72.5 56 63.0 57 64.0 58 57.0 59 51.0 60 46.5 61 42.5 62 36.0 63 28.0 64 28.0 65 23.0 66 17.5 67 14.0 68 7.5 69 6.5 70 5.0 71 1.0 72 1.0 73 1.0 74 1.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 12.0 71 13.0 72 14.0 73 16.0 74 12.0 75 10.0 76 11.0 77 9.0 78 15.0 79 12.0 80 8.0 81 10.0 82 18.0 83 17.0 84 15.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 3808.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.54031117397454 83.55 2 3.790664780763791 6.7 3 0.7072135785007072 1.875 4 0.3677510608203678 1.3 5 0.08486562942008487 0.375 6 0.08486562942008487 0.44999999999999996 7 0.028288543140028287 0.17500000000000002 8 0.028288543140028287 0.2 9 0.056577086280056574 0.44999999999999996 >10 0.31117397454031115 4.925 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGT 38 0.95 No Hit GGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTG 29 0.7250000000000001 No Hit GGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGG 27 0.675 No Hit TACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTT 21 0.525 No Hit GGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTT 15 0.375 No Hit GTATTTAGCCTTGCAAGGTGGTCCTTGCTGATTCACACGGGATTCCACGT 14 0.35000000000000003 No Hit GGGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAA 12 0.3 No Hit GAAGGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGC 11 0.27499999999999997 No Hit GGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAA 10 0.25 No Hit GGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGG 10 0.25 No Hit GGGAGAGCAATACAAGCGTTGTGCTGCTAGGCGAAGCGGTTGAGTGCCGC 10 0.25 No Hit GGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGC 9 0.22499999999999998 No Hit GGTAATGAAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGC 9 0.22499999999999998 No Hit GGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAA 8 0.2 No Hit GGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTG 7 0.17500000000000002 No Hit GGAGAGTGTGAGCATATATATTTATACGACGAATAAAAGGCTGCCACGTG 6 0.15 No Hit GGGGGTCGCAGTGACCAGGCCCGGGCGACTGTTTACCAAAAACACAGGTC 6 0.15 No Hit GTAACGAAGGGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGAGCA 6 0.15 No Hit GCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAA 5 0.125 No Hit GGAGTATCCTTGATATATAAATATATAGATAAATAGATTTAAATGGAAAA 5 0.125 No Hit GGTTTTGAAAAGGGAATCGATCGTGATTTAGAACCTGTTCTTTACATGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202863 READS because READLEN < 1 Read 202863 spots for ERR6133386.sra Written 202863 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra Rejected 202847 READS because READLEN < 1 Read 202847 spots for ERR6133386.sra Written 202847 spots for ERR6133386.sra SRR ids: ['ERR6133386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_krmtv6zx ERR6133386.sra spots: 4056956 blocks: [[1, 202847], [202848, 405694], [405695, 608541], [608542, 811388], [811389, 1014235], [1014236, 1217082], [1217083, 1419929], [1419930, 1622776], [1622777, 1825623], [1825624, 2028470], [2028471, 2231317], [2231318, 2434164], [2434165, 2637011], [2637012, 2839858], [2839859, 3042705], [3042706, 3245552], [3245553, 3448399], [3448400, 3651246], [3651247, 3854093], [3854094, 4056956]] ERR6133386 file size 894714 ERR6133386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6133386 ERR6133386_1.fastq Input file: ERR6133386_1.fastq trimmed: ERR6133386-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 02:21:39 2024 >> started Sat Dec 7 02:21:41 2024 >> done (2.308s) 4056956 reads processed; of these: 397 ( 0.01%) short reads filtered out after trimming by size control 13 ( 0.00%) empty reads filtered out after trimming by size control 4056546 (99.99%) reads available; of these: 160112 ( 3.95%) trimmed reads available after processing 3896434 (96.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 35 0.00% 19 68 0.00% 20 23 0.00% 21 22 0.00% 22 13 0.00% 23 9 0.00% 24 15 0.00% 25 16 0.00% 26 11 0.00% 27 9 0.00% 28 15 0.00% 29 116 0.00% 30 18 0.00% 31 18 0.00% 32 30 0.00% 33 6 0.00% 34 11 0.00% 35 13 0.00% 36 10 0.00% 37 15 0.00% 38 17 0.00% 39 64 0.00% 40 139 0.00% 41 34 0.00% 42 24 0.00% 43 27 0.00% 44 36 0.00% 45 48 0.00% 46 73 0.00% 47 118 0.00% 48 191 0.00% 49 1359 0.03% 50 380 0.01% 51 431 0.01% 52 387 0.01% 53 502 0.01% 54 512 0.01% 55 670 0.02% 56 765 0.02% 57 1021 0.03% 58 811 0.02% 59 923 0.02% 60 1199 0.03% 61 881 0.02% 62 1026 0.03% 63 1267 0.03% 64 1203 0.03% 65 1263 0.03% 66 1320 0.03% 67 1631 0.04% 68 1787 0.04% 69 1012 0.02% 70 13587 0.33% 71 14279 0.35% 72 16290 0.40% 73 14562 0.36% 74 14988 0.37% 75 16186 0.40% 76 14851 0.37% 77 15329 0.38% 78 16593 0.41% 79 17027 0.42% 80 16510 0.41% 81 17258 0.43% 82 19523 0.48% 83 22861 0.56% 84 19457 0.48% 85 6542 0.16% 86 7432 0.18% 87 8355 0.21% 88 10824 0.27% 89 10591 0.26% 90 14347 0.35% 91 16406 0.40% 92 17932 0.44% 93 3693222 91.04% 4056546 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=5.77 fanout-score-rank=24 prefix-density=0.87 prefix-fanout=4.0 sequence=ATGCATGCATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=408.16 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=9.9 sequence=GAAGAAGAAAAGTTTTCTCAACATGGGGAGGAAGTCCCTCCGAAATTTGATTTGTTATTGTATTGTAAGGGGCTTTTTTAGTATTTATCTAAAGGAAGGAACAAACGAGGATAAGATAAAATTTCTTTAAATTTATTTTGCCCAAGTGGGATATATGGCATACTATTCTTTCCATTTTCATCTTTTTTTCTATTCCACTCCATCTAGATATAAGAAAGAACCCAATGCAATGAAATTCCACTAATATACAATACAAAAAAGAAGAATAGATACAGGGTCTCAAACCTTGCTATAGAGTTTTTGCTT Started job on | Dec 07 02:22:01 Started mapping on | Dec 07 02:22:01 Finished on | Dec 07 02:22:09 Mapping speed, Million of reads per hour | 1825.45 Number of input reads | 4056546 Average input read length | 91 UNIQUE READS: Uniquely mapped reads number | 3232831 Uniquely mapped reads % | 79.69% Average mapped length | 91.27 Number of splices: Total | 170578 Number of splices: Annotated (sjdb) | 142730 Number of splices: GT/AG | 162103 Number of splices: GC/AG | 4111 Number of splices: AT/AC | 35 Number of splices: Non-canonical | 4329 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.05% Deletion average length | 1.86 Insertion rate per base | 0.02% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 682215 % of reads mapped to multiple loci | 16.82% Number of reads mapped to too many loci | 32195 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 141500 141500 141500 N_multimapping 682215 682215 682215 N_noFeature 154401 182200 3089123 N_ambiguous 126006 10141 339 UnstrandedReadsAssigned:2952424 PositiveStrandReadsAssigned:3040490 NegativeStrandReadsAssigned:143369 Dataset is classified positive stranded MeadianReadLen=93 20thPercentileLength=93 echo kmer=89 ERR6133386 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR6133386-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,056,546 reads, 3,445,449 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52973 ERR6133386.ke.tsv 35125 ERR6133386.se.tsv 88098 total ==> ERR6133386.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 101 29.2748 PNS24243 293 194 0 0 KQK14069 1603 1504 64 16.9223 KQK14071 474 375 0 0 ==> ERR6133386.se.tsv <== BRADI_1g14170v3 64 BRADI_1g53295v3 57 BRADI_1g59795v3 52 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 66 BRADI_1g74790v3 46 BRADI_1g09890v3 0 BRADI_1g77505v3 58 BRADI_1g48960v3 0 ERR6133386 completed mapping pipeline successfully