Starting /dee2/code/volunteer_pipeline.sh ERR6133432 current disk space = 1545756016640 free memory = 1462080880 ERR6133432 SRAfilesize 3a3f3cd420b37ae0b031a916769ee250 ERR6133432.sra ERR6133432.sra file validated ERR6133432 is single end ERR6133432 is conventional basespace ERR6133432 read1 length is 70-93 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6133432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-93 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1705 37.0 33.0 37.0 33.0 37.0 2 36.22725 37.0 37.0 37.0 33.0 37.0 3 35.68675 37.0 37.0 37.0 33.0 37.0 4 35.4975 37.0 37.0 37.0 33.0 37.0 5 35.408 37.0 37.0 37.0 33.0 37.0 6 35.752 37.0 37.0 37.0 33.0 37.0 7 37.336 37.0 37.0 40.0 33.0 40.0 8 37.41575 37.0 37.0 40.0 33.0 40.0 9 37.41825 37.0 37.0 40.0 33.0 40.0 10-11 37.373999999999995 37.0 37.0 40.0 33.0 40.0 12-13 37.297625 37.0 37.0 40.0 33.0 40.0 14-15 37.180625 37.0 37.0 40.0 33.0 40.0 16-17 37.08225 37.0 37.0 40.0 33.0 40.0 18-19 37.131874999999994 37.0 37.0 40.0 33.0 40.0 20-21 37.38225 37.0 37.0 40.0 33.0 40.0 22-23 36.9995 37.0 37.0 40.0 33.0 40.0 24-25 37.167500000000004 37.0 37.0 40.0 33.0 40.0 26-27 37.094625 37.0 37.0 40.0 33.0 40.0 28-29 37.210625 37.0 37.0 40.0 33.0 40.0 30-31 37.248374999999996 37.0 37.0 40.0 33.0 40.0 32-33 37.146375 37.0 37.0 40.0 33.0 40.0 34-35 37.00075 37.0 37.0 40.0 33.0 40.0 36-37 36.958749999999995 37.0 37.0 40.0 33.0 40.0 38-39 36.743125 37.0 37.0 40.0 33.0 40.0 40-41 36.6665 37.0 37.0 40.0 33.0 40.0 42-43 36.535 37.0 37.0 40.0 33.0 40.0 44-45 36.3725 37.0 37.0 40.0 33.0 40.0 46-47 36.2155 37.0 37.0 40.0 33.0 40.0 48-49 35.880125 37.0 35.0 37.0 33.0 40.0 50-51 35.79625 37.0 33.0 37.0 33.0 40.0 52-53 35.701875 37.0 33.0 37.0 33.0 40.0 54-55 35.379625000000004 37.0 33.0 37.0 33.0 40.0 56-57 35.405625 37.0 33.0 37.0 33.0 40.0 58-59 34.8065 37.0 33.0 37.0 30.0 38.5 60-61 34.735625 37.0 33.0 37.0 33.0 37.0 62-63 34.890875 37.0 33.0 37.0 33.0 37.0 64-65 34.387 37.0 33.0 37.0 30.0 37.0 66-67 34.355125 37.0 33.0 37.0 27.0 37.0 68-69 33.003875 35.0 33.0 35.0 27.0 37.0 70-71 33.22429968069121 33.0 33.0 37.0 27.0 37.0 72-73 33.82228392264 37.0 33.0 37.0 27.0 37.0 74-75 34.1484942274641 37.0 33.0 37.0 27.0 37.0 76-77 34.09256879378746 37.0 33.0 37.0 30.0 37.0 78-79 34.04560624697732 37.0 33.0 37.0 30.0 37.0 80-81 34.01913942798774 37.0 33.0 37.0 27.0 37.0 82-83 33.86650408644056 37.0 33.0 37.0 27.0 37.0 84-85 33.80737943534554 37.0 33.0 37.0 27.0 37.0 86-87 33.62664092664093 35.0 33.0 37.0 27.0 37.0 88-89 33.67194337194337 37.0 33.0 37.0 27.0 37.0 90-91 33.62380952380953 35.0 33.0 37.0 27.0 37.0 92-93 33.33539253539253 35.0 33.0 37.0 27.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 9.0 21 15.0 22 14.0 23 14.0 24 26.0 25 19.0 26 36.0 27 35.0 28 41.0 29 70.0 30 66.0 31 110.0 32 133.0 33 171.0 34 252.0 35 502.0 36 852.0 37 1080.0 38 550.0 39 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 84.15 6.8500000000000005 3.45 5.55 2 67.1757636454682 16.675012518778168 10.665998998497747 5.483224837255884 3 35.075 35.9 17.45 11.575000000000001 4 33.15 26.1 21.9 18.85 5 24.05 29.849999999999998 25.95 20.150000000000002 6 19.625 32.074999999999996 29.25 19.05 7 34.575 27.750000000000004 22.45 15.225 8 32.875 27.375 23.5 16.25 9 27.200000000000003 25.35 28.749999999999996 18.7 10-11 25.525 26.674999999999997 29.4 18.4 12-13 28.512500000000003 25.0625 28.762500000000003 17.6625 14-15 23.325000000000003 26.924999999999997 28.999999999999996 20.75 16-17 24.5625 30.2625 26.724999999999998 18.45 18-19 24.762500000000003 26.1625 28.762500000000003 20.3125 20-21 25.2875 25.337500000000002 27.9125 21.462500000000002 22-23 27.500000000000004 23.3875 28.499999999999996 20.6125 24-25 26.224999999999998 24.4 28.225 21.15 26-27 25.275 24.4125 30.425 19.8875 28-29 25.074999999999996 25.5125 29.075 20.3375 30-31 25.25 24.762500000000003 28.7 21.2875 32-33 24.25 26.3625 29.299999999999997 20.0875 34-35 24.75 24.675 29.312500000000004 21.2625 36-37 25.112499999999997 24.125 28.825 21.9375 38-39 24.9875 24.474999999999998 30.525000000000002 20.0125 40-41 26.674999999999997 23.6875 28.075 21.5625 42-43 25.337500000000002 25.8 27.950000000000003 20.9125 44-45 24.4125 24.675 30.587500000000002 20.325 46-47 24.9375 24.587500000000002 28.9125 21.5625 48-49 24.4375 24.725 31.2625 19.575 50-51 23.2875 25.2875 30.775000000000002 20.65 52-53 23.775 25.937500000000004 29.375 20.9125 54-55 23.775 24.975 30.9875 20.2625 56-57 25.35 24.3 30.3875 19.9625 58-59 25.162499999999998 24.15 30.375000000000004 20.3125 60-61 24.1125 24.7 30.7875 20.4 62-63 24.1375 26.200000000000003 30.7875 18.875 64-65 24.15 25.3125 30.75 19.787499999999998 66-67 22.9875 25.362499999999997 31.162499999999998 20.4875 68-69 24.087500000000002 25.3 30.4 20.2125 70-71 24.69660953334167 24.82171900412861 30.251470036281745 20.23020142624797 72-73 23.823270992845487 25.442450106690096 30.513367641521278 20.22091125894314 74-75 23.925375015756963 25.601916046892725 30.820622715240138 19.652086222110174 76-77 22.872676697433302 26.07156404096599 30.408395498798836 20.64736376280187 78-79 23.239257564200354 24.853801169590643 31.718789727943047 20.188151538265956 80-81 23.468606431852987 26.480347115875446 31.227667177131192 18.82337927514038 82-83 23.579836233367452 25.882804503582395 30.053735926305013 20.48362333674514 84-85 23.514278363776693 25.237972729611524 31.926935940313868 19.320812966297915 86-87 23.62934362934363 25.122265122265127 31.866151866151863 19.382239382239383 88-89 22.985842985842986 26.640926640926644 31.261261261261264 19.111969111969113 90-91 23.93822393822394 26.074646074646076 30.68211068211068 19.305019305019304 92-93 23.539253539253536 27.36164736164736 30.21879021879022 18.88030888030888 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 12.0 18 13.5 19 2.5 20 0.0 21 1.0 22 2.0 23 1.5 24 2.5 25 4.5 26 5.5 27 9.0 28 13.5 29 14.0 30 20.0 31 30.5 32 43.5 33 64.5 34 73.5 35 96.5 36 119.5 37 131.0 38 179.5 39 212.5 40 211.0 41 215.5 42 237.5 43 255.5 44 235.5 45 197.5 46 170.5 47 173.0 48 178.0 49 179.5 50 166.5 51 133.0 52 115.0 53 103.0 54 91.0 55 72.0 56 67.0 57 75.0 58 67.0 59 54.5 60 48.0 61 43.5 62 36.5 63 33.5 64 34.5 65 31.5 66 28.0 67 22.0 68 13.5 69 12.5 70 9.0 71 3.0 72 3.5 73 2.5 74 2.0 75 2.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0642756138321121 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 7.0 71 5.0 72 9.0 73 11.0 74 3.0 75 5.0 76 11.0 77 12.0 78 8.0 79 9.0 80 4.0 81 6.0 82 4.0 83 12.0 84 9.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 3885.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.79261672095548 88.225 2 2.9315960912052117 5.4 3 0.5428881650380022 1.5 4 0.32573289902280134 1.2 5 0.10857763300760044 0.5 6 0.02714440825190011 0.15 7 0.10857763300760044 0.7000000000000001 8 0.0 0.0 9 0.05428881650380022 0.44999999999999996 >10 0.10857763300760044 1.875 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATTCAATTTCAACCAATCTGTAGTTGATAGTCAAGGTCGCGTTATTAA 31 0.775 No Hit GGAGTATCCTTGATATATAAATATATAGATAAATAGATTTAAATGGAAAA 23 0.575 No Hit GGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGT 11 0.27499999999999997 No Hit GGTGGGGCAATGGGCATTCCGTTGAGTTTGTATGGTGGGTGCTGTTTTGC 10 0.25 No Hit GGTCGCGTTATTAATACTTGGGCTGATATCATCAACCGTGCTAATCTTGG 9 0.22499999999999998 No Hit GGGAGTATTATGAAAGGAGATTAATCATAGATTATCAAAAACCCTAGAAA 9 0.22499999999999998 No Hit CTGAGCCGTGCTCTCTTCTGTGTACATCTTCATGTCATTTTAGCGATTCT 7 0.17500000000000002 No Hit GGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGG 7 0.17500000000000002 No Hit GGAGGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAA 7 0.17500000000000002 No Hit TTCACAAGTCTGGTTCAGGGTGTCCTCCGGTGGAGTTGTCGCGTGTCTGA 7 0.17500000000000002 No Hit GGGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGAGCAGCTTGCAA 6 0.15 No Hit CAAGGTCGCGTTATTAATACTTGGGCTGATATCATCAACCGTGCTAATCT 5 0.125 No Hit GGCGTTCAACCTAAATGGATTCAATTTCAACCAATCTGTAGTTGATAGTC 5 0.125 No Hit GGGACAAGGGGTACGACGTGACGGCGAGGTTCCTGGACTACTGCGACTCG 5 0.125 No Hit GGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.037500000000000006 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122027 READS because READLEN < 1 Read 122027 spots for ERR6133432.sra Written 122027 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra Rejected 122018 READS because READLEN < 1 Read 122018 spots for ERR6133432.sra Written 122018 spots for ERR6133432.sra SRR ids: ['ERR6133432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w28iz733 ERR6133432.sra spots: 2440369 blocks: [[1, 122018], [122019, 244036], [244037, 366054], [366055, 488072], [488073, 610090], [610091, 732108], [732109, 854126], [854127, 976144], [976145, 1098162], [1098163, 1220180], [1220181, 1342198], [1342199, 1464216], [1464217, 1586234], [1586235, 1708252], [1708253, 1830270], [1830271, 1952288], [1952289, 2074306], [2074307, 2196324], [2196325, 2318342], [2318343, 2440369]] ERR6133432 file size 539065 ERR6133432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6133432 ERR6133432_1.fastq Input file: ERR6133432_1.fastq trimmed: ERR6133432-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 05:25:45 2024 >> started Sat Dec 7 05:25:47 2024 >> done (1.647s) 2440369 reads processed; of these: 899 ( 0.04%) short reads filtered out after trimming by size control 24 ( 0.00%) empty reads filtered out after trimming by size control 2439446 (99.96%) reads available; of these: 32758 ( 1.34%) trimmed reads available after processing 2406688 (98.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 20 0.00% 20 12 0.00% 21 13 0.00% 22 13 0.00% 23 13 0.00% 24 8 0.00% 25 13 0.00% 26 7 0.00% 27 5 0.00% 28 8 0.00% 29 28 0.00% 30 6 0.00% 31 5 0.00% 32 8 0.00% 33 8 0.00% 34 2 0.00% 35 5 0.00% 36 5 0.00% 37 8 0.00% 38 14 0.00% 39 28 0.00% 40 15 0.00% 41 16 0.00% 42 8 0.00% 43 13 0.00% 44 18 0.00% 45 12 0.00% 46 14 0.00% 47 11 0.00% 48 19 0.00% 49 15 0.00% 50 12 0.00% 51 35 0.00% 52 11 0.00% 53 8 0.00% 54 16 0.00% 55 12 0.00% 56 12 0.00% 57 14 0.00% 58 14 0.00% 59 10 0.00% 60 15 0.00% 61 14 0.00% 62 1 0.00% 63 2 0.00% 64 1 0.00% 65 6 0.00% 66 5 0.00% 67 8 0.00% 68 12 0.00% 69 62 0.00% 70 4438 0.18% 71 4177 0.17% 72 4532 0.19% 73 4304 0.18% 74 4487 0.18% 75 4187 0.17% 76 4246 0.17% 77 4294 0.18% 78 4464 0.18% 79 4665 0.19% 80 4601 0.19% 81 5233 0.21% 82 4971 0.20% 83 5113 0.21% 84 4828 0.20% 85 68 0.00% 86 151 0.01% 87 177 0.01% 88 386 0.02% 89 782 0.03% 90 1810 0.07% 91 5307 0.22% 92 22516 0.92% 93 2339044 95.88% 2439446 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=12.95 fanout-score-rank=14 prefix-density=0.47 prefix-fanout=7.1 sequence=ATGCATGCATGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=140.33 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=25.1 sequence=TTTTTTTTTTAAGAATCCTCCATTTTTGTTCTTCCACCCATGCAATAGAGAGCAAATGGGAAAAGAGGGGTTACTTTTTTTCATTTTTCCCTTAAAAGATAGGCTTTGAAATCGGAGTCATGGAATAATGGTGAATTCAAATGTTTAGTTCTTTAGTATAAGAAGTATAAGAA Started job on | Dec 07 05:26:05 Started mapping on | Dec 07 05:26:06 Finished on | Dec 07 05:26:11 Mapping speed, Million of reads per hour | 1756.40 Number of input reads | 2439446 Average input read length | 92 UNIQUE READS: Uniquely mapped reads number | 2115975 Uniquely mapped reads % | 86.74% Average mapped length | 92.28 Number of splices: Total | 98388 Number of splices: Annotated (sjdb) | 83690 Number of splices: GT/AG | 96075 Number of splices: GC/AG | 1798 Number of splices: AT/AC | 28 Number of splices: Non-canonical | 487 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272931 % of reads mapped to multiple loci | 11.19% Number of reads mapped to too many loci | 9017 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 50540 50540 50540 N_multimapping 272931 272931 272931 N_noFeature 95296 114779 2031896 N_ambiguous 70540 5890 195 UnstrandedReadsAssigned:1950139 PositiveStrandReadsAssigned:1995306 NegativeStrandReadsAssigned:83884 Dataset is classified positive stranded MeadianReadLen=93 20thPercentileLength=93 echo kmer=89 ERR6133432 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR6133432-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,439,446 reads, 2,174,858 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52973 ERR6133432.ke.tsv 35125 ERR6133432.se.tsv 88098 total ==> ERR6133432.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 54 24.8991 PNS24243 293 194 0 0 KQK14069 1603 1504 340 143.013 KQK14071 474 375 0 0 ==> ERR6133432.se.tsv <== BRADI_1g14170v3 337 BRADI_1g53295v3 38 BRADI_1g59795v3 10 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 23 BRADI_1g74790v3 32 BRADI_1g09890v3 0 BRADI_1g77505v3 44 BRADI_1g48960v3 0 ERR6133432 completed mapping pipeline successfully