Starting /dee2/code/volunteer_pipeline.sh ERR6145993 current disk space = 1542394187776 free memory = 1600061556 ERR6145993 SRAfilesize 5e5cd59864fe9a0727c0e591f74b3e6a ERR6145993.sra ERR6145993.sra file validated ERR6145993 is paired end ERR6145993 is conventional basespace ERR6145993 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.307 35.0 35.0 35.0 35.0 35.0 2 34.59475 35.0 35.0 35.0 35.0 35.0 3 34.62875 35.0 35.0 35.0 35.0 35.0 4 34.6305 35.0 35.0 35.0 35.0 35.0 5 34.63075 35.0 35.0 35.0 35.0 35.0 6 39.3975 40.0 40.0 40.0 39.0 40.0 7 39.36725 40.0 40.0 40.0 39.0 40.0 8 39.33825 40.0 40.0 40.0 39.0 40.0 9 39.361 40.0 40.0 40.0 39.0 40.0 10 39.324 40.0 40.0 40.0 39.0 40.0 11 39.313 40.0 40.0 40.0 39.0 40.0 12 39.297 40.0 40.0 40.0 39.0 40.0 13 39.34 40.0 40.0 40.0 39.0 40.0 14 39.253 40.0 40.0 40.0 39.0 40.0 15 39.3125 40.0 40.0 40.0 39.0 40.0 16 39.35625 40.0 40.0 40.0 39.0 40.0 17 39.28675 40.0 40.0 40.0 39.0 40.0 18 39.31325 40.0 40.0 40.0 39.0 40.0 19 39.28075 40.0 40.0 40.0 39.0 40.0 20 39.337 40.0 40.0 40.0 39.0 40.0 21 39.3185 40.0 40.0 40.0 39.0 40.0 22 39.259 40.0 40.0 40.0 39.0 40.0 23 39.27975 40.0 40.0 40.0 39.0 40.0 24 39.21 40.0 40.0 40.0 39.0 40.0 25 39.285 40.0 40.0 40.0 39.0 40.0 26 39.29825 40.0 40.0 40.0 39.0 40.0 27 39.2545 40.0 40.0 40.0 39.0 40.0 28 39.34725 40.0 40.0 40.0 39.0 40.0 29 39.2755 40.0 40.0 40.0 39.0 40.0 30 39.25575 40.0 40.0 40.0 39.0 40.0 31 39.28225 40.0 40.0 40.0 39.0 40.0 32 39.28275 40.0 40.0 40.0 39.0 40.0 33 39.27675 40.0 40.0 40.0 39.0 40.0 34 39.217 40.0 40.0 40.0 39.0 40.0 35 39.277 40.0 40.0 40.0 39.0 40.0 36 39.29375 40.0 40.0 40.0 39.0 40.0 37 39.2335 40.0 40.0 40.0 39.0 40.0 38 39.2505 40.0 40.0 40.0 39.0 40.0 39 39.27325 40.0 40.0 40.0 39.0 40.0 40 39.26275 40.0 40.0 40.0 39.0 40.0 41 39.22825 40.0 40.0 40.0 39.0 40.0 42 39.24975 40.0 40.0 40.0 39.0 40.0 43 39.32 40.0 40.0 40.0 39.0 40.0 44 39.2895 40.0 40.0 40.0 39.0 40.0 45 39.31675 40.0 40.0 40.0 39.0 40.0 46 39.2585 40.0 40.0 40.0 39.0 40.0 47 39.331 40.0 40.0 40.0 39.0 40.0 48 39.249 40.0 40.0 40.0 39.0 40.0 49 39.26275 40.0 40.0 40.0 39.0 40.0 50 39.3105 40.0 40.0 40.0 39.0 40.0 51 39.2675 40.0 40.0 40.0 39.0 40.0 52 39.22775 40.0 40.0 40.0 39.0 40.0 53 39.26225 40.0 40.0 40.0 39.0 40.0 54 39.19 40.0 40.0 40.0 39.0 40.0 55 39.27175 40.0 40.0 40.0 39.0 40.0 56 39.189 40.0 40.0 40.0 39.0 40.0 57 39.25425 40.0 40.0 40.0 39.0 40.0 58 39.1785 40.0 40.0 40.0 39.0 40.0 59 39.1745 40.0 40.0 40.0 39.0 40.0 60 39.2785 40.0 40.0 40.0 39.0 40.0 61 39.1625 40.0 40.0 40.0 39.0 40.0 62 39.2175 40.0 40.0 40.0 39.0 40.0 63 39.19925 40.0 40.0 40.0 39.0 40.0 64 39.264 40.0 40.0 40.0 39.0 40.0 65 39.23275 40.0 40.0 40.0 39.0 40.0 66 39.22725 40.0 40.0 40.0 39.0 40.0 67 39.17875 40.0 40.0 40.0 39.0 40.0 68 39.20875 40.0 40.0 40.0 39.0 40.0 69 39.194 40.0 40.0 40.0 39.0 40.0 70 39.23975 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 5.0 26 5.0 27 11.0 28 9.0 29 17.0 30 21.0 31 30.0 32 24.0 33 35.0 34 43.0 35 53.0 36 90.0 37 107.0 38 258.0 39 3290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.648129423660265 13.953488372093023 14.888776541961576 39.50960566228513 2 23.225 15.775 30.4 30.599999999999998 3 21.85 21.0 24.099999999999998 33.050000000000004 4 25.474999999999998 26.575 22.900000000000002 25.05 5 25.525 30.349999999999998 24.125 20.0 6 21.2 29.299999999999997 26.674999999999997 22.825 7 20.575 23.599999999999998 34.75 21.075 8 20.75 22.625 29.5 27.125 9 19.35 25.724999999999998 31.125000000000004 23.799999999999997 10 21.925 30.975 23.974999999999998 23.125 11 26.275 23.075000000000003 23.05 27.6 12 22.775000000000002 23.625 26.55 27.05 13 23.075000000000003 25.35 26.075 25.5 14 23.1 25.575 26.150000000000002 25.174999999999997 15 22.95 25.900000000000002 25.0 26.150000000000002 16 24.975 24.224999999999998 25.3 25.5 17 24.099999999999998 26.974999999999998 24.325 24.6 18 23.05 25.674999999999997 25.6 25.674999999999997 19 22.900000000000002 24.55 25.650000000000002 26.900000000000002 20 24.6 25.8 24.275 25.324999999999996 21 22.875 26.525 24.6 26.0 22 23.575 25.224999999999998 25.0 26.200000000000003 23 23.674999999999997 24.325 26.0 26.0 24 22.025 24.75 25.85 27.375 25 23.849999999999998 25.275 24.5 26.375 26 22.925 25.2 25.7 26.174999999999997 27 22.25 24.875 26.35 26.525 28 24.125 24.6 24.75 26.525 29 23.325000000000003 25.0 25.525 26.150000000000002 30 22.85 24.775 24.875 27.500000000000004 31 24.05 25.424999999999997 24.95 25.575 32 24.9 24.5 25.575 25.025 33 22.675 26.05 24.45 26.825 34 23.525 25.525 23.674999999999997 27.275 35 22.775000000000002 25.25 25.275 26.700000000000003 36 23.275000000000002 24.9 24.55 27.275 37 23.325000000000003 24.775 25.1 26.8 38 23.575 24.925 25.3 26.200000000000003 39 22.225 25.324999999999996 25.924999999999997 26.525 40 24.525 24.925 25.724999999999998 24.825 41 24.825 24.95 25.224999999999998 25.0 42 23.025000000000002 25.924999999999997 24.6 26.450000000000003 43 23.974999999999998 25.0 25.124999999999996 25.900000000000002 44 25.174999999999997 24.224999999999998 24.775 25.825 45 23.1 24.525 24.675 27.700000000000003 46 24.325 24.9 24.65 26.125 47 24.025 24.675 23.925 27.375 48 23.275000000000002 24.4 25.75 26.575 49 24.025 25.6 24.05 26.325 50 23.7 24.349999999999998 25.45 26.5 51 24.925 25.1 24.3 25.674999999999997 52 24.15 24.825 24.3 26.724999999999998 53 25.4 24.175 25.174999999999997 25.25 54 23.525 24.3 25.424999999999997 26.75 55 24.25 24.099999999999998 24.875 26.775 56 24.55 24.075 25.025 26.35 57 23.45 25.474999999999998 25.1 25.974999999999998 58 25.025 26.35 22.8 25.825 59 23.849999999999998 25.7 24.2 26.25 60 23.65 23.125 26.25 26.974999999999998 61 25.28132033008252 23.43085771442861 24.081020255063766 27.206801700425103 62 24.656164041010253 25.006251562890725 25.681420355088775 24.656164041010253 63 24.656164041010253 24.33108277069267 23.755938984746187 27.25681420355089 64 24.756189047261813 24.20605151287822 24.031007751937985 27.00675168792198 65 22.661330665332667 25.512756378189096 25.162581290645324 26.663331665832917 66 24.216595638004513 23.08849335673101 26.071697167209827 26.62321383805465 67 24.252324704699674 23.548630309122895 24.277456647398843 27.921588338778587 68 23.577652485904665 23.80830343413634 25.525371604305487 27.088672475653514 69 24.429160935350758 18.76203576341128 27.18019257221458 29.628610729023386 70 25.76370997423629 0.0 35.11225616488775 39.12403386087597 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 1.0 24 2.0 25 2.5 26 6.0 27 10.0 28 7.0 29 10.5 30 17.0 31 15.0 32 30.0 33 47.0 34 54.5 35 71.0 36 92.0 37 104.0 38 121.5 39 149.0 40 159.0 41 170.5 42 201.5 43 221.0 44 238.0 45 261.5 46 265.0 47 262.0 48 267.5 49 249.5 50 226.0 51 223.5 52 209.0 53 197.0 54 185.0 55 155.5 56 130.5 57 123.0 58 115.5 59 108.5 60 109.0 61 104.0 62 91.5 63 84.0 64 79.5 65 72.5 66 66.0 67 62.0 68 51.5 69 45.5 70 50.0 71 46.5 72 35.0 73 27.0 74 22.0 75 14.0 76 9.5 77 8.0 78 7.5 79 5.0 80 3.0 81 2.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.27499999999999997 67 0.525 68 2.45 69 9.125 70 32.074999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6145993 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145993_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.24525 35.0 35.0 35.0 33.0 35.0 2 33.96175 35.0 35.0 35.0 32.0 35.0 3 33.8025 35.0 35.0 35.0 32.0 35.0 4 33.86425 35.0 35.0 35.0 32.0 35.0 5 33.7005 35.0 35.0 35.0 31.0 35.0 6 38.4175 40.0 39.0 40.0 36.0 40.0 7 38.43725 40.0 39.0 40.0 36.0 40.0 8 38.4345 40.0 40.0 40.0 36.0 40.0 9 38.4345 40.0 40.0 40.0 36.0 40.0 10 38.41375 40.0 40.0 40.0 36.0 40.0 11 38.4225 40.0 40.0 40.0 36.0 40.0 12 38.423 40.0 40.0 40.0 36.0 40.0 13 38.4945 40.0 40.0 40.0 36.0 40.0 14 38.5415 40.0 40.0 40.0 36.0 40.0 15 38.502 40.0 40.0 40.0 36.0 40.0 16 38.4685 40.0 40.0 40.0 36.0 40.0 17 38.51475 40.0 40.0 40.0 37.0 40.0 18 38.4825 40.0 40.0 40.0 37.0 40.0 19 38.40475 40.0 40.0 40.0 36.0 40.0 20 38.444 40.0 40.0 40.0 36.0 40.0 21 38.4345 40.0 40.0 40.0 36.0 40.0 22 38.379 40.0 40.0 40.0 36.0 40.0 23 38.49425 40.0 40.0 40.0 36.0 40.0 24 38.439 40.0 40.0 40.0 36.0 40.0 25 38.442 40.0 40.0 40.0 36.0 40.0 26 38.46825 40.0 40.0 40.0 36.0 40.0 27 38.474 40.0 40.0 40.0 36.0 40.0 28 38.42775 40.0 40.0 40.0 36.0 40.0 29 38.47875 40.0 40.0 40.0 36.0 40.0 30 38.4785 40.0 40.0 40.0 36.0 40.0 31 38.47875 40.0 40.0 40.0 36.0 40.0 32 38.48775 40.0 40.0 40.0 36.0 40.0 33 38.421 40.0 40.0 40.0 36.0 40.0 34 38.4805 40.0 40.0 40.0 36.0 40.0 35 38.38925 40.0 40.0 40.0 36.0 40.0 36 38.346 40.0 40.0 40.0 36.0 40.0 37 38.415 40.0 40.0 40.0 36.0 40.0 38 38.41825 40.0 40.0 40.0 36.0 40.0 39 38.398 40.0 40.0 40.0 36.0 40.0 40 38.3615 40.0 40.0 40.0 36.0 40.0 41 38.425 40.0 40.0 40.0 36.0 40.0 42 38.36625 40.0 40.0 40.0 36.0 40.0 43 38.39775 40.0 40.0 40.0 36.0 40.0 44 38.38075 40.0 40.0 40.0 36.0 40.0 45 38.3455 40.0 40.0 40.0 36.0 40.0 46 38.315 40.0 40.0 40.0 36.0 40.0 47 38.43375 40.0 40.0 40.0 36.0 40.0 48 38.2955 40.0 40.0 40.0 36.0 40.0 49 38.317 40.0 39.0 40.0 36.0 40.0 50 38.327 40.0 39.0 40.0 36.0 40.0 51 38.35425 40.0 40.0 40.0 36.0 40.0 52 38.25175 40.0 39.0 40.0 35.0 40.0 53 38.28025 40.0 39.0 40.0 36.0 40.0 54 38.22625 40.0 39.0 40.0 35.0 40.0 55 38.3155 40.0 39.0 40.0 36.0 40.0 56 38.24925 40.0 40.0 40.0 36.0 40.0 57 38.24025 40.0 39.0 40.0 35.0 40.0 58 38.3395 40.0 39.0 40.0 36.0 40.0 59 38.2995 40.0 39.0 40.0 36.0 40.0 60 38.36225 40.0 40.0 40.0 36.0 40.0 61 38.41025 40.0 39.0 40.0 36.0 40.0 62 38.33175 40.0 39.0 40.0 36.0 40.0 63 38.17725 40.0 39.0 40.0 35.0 40.0 64 38.249 40.0 39.0 40.0 36.0 40.0 65 38.28175 40.0 39.0 40.0 36.0 40.0 66 38.282 40.0 39.0 40.0 36.0 40.0 67 38.299 40.0 39.0 40.0 36.0 40.0 68 38.14725 40.0 39.0 40.0 35.0 40.0 69 38.231 40.0 39.0 40.0 36.0 40.0 70 38.11675 40.0 39.0 40.0 35.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 6.0 18 8.0 19 17.0 20 22.0 21 27.0 22 15.0 23 26.0 24 22.0 25 23.0 26 26.0 27 18.0 28 22.0 29 26.0 30 36.0 31 28.0 32 26.0 33 34.0 34 45.0 35 56.0 36 71.0 37 92.0 38 231.0 39 3123.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.525 19.5 17.075000000000003 31.900000000000002 2 30.75 24.474999999999998 23.3 21.475 3 21.6 27.85 25.124999999999996 25.424999999999997 4 24.65 30.15 20.674999999999997 24.525 5 28.175 32.15 19.175 20.5 6 24.05 28.125 23.025000000000002 24.8 7 25.575 18.875 29.65 25.900000000000002 8 24.625 21.525 23.325000000000003 30.525000000000002 9 23.225 24.224999999999998 25.775 26.775 10 26.5 28.125 20.375 25.0 11 28.625 22.175 20.625 28.575 12 26.625 21.7 23.45 28.225 13 26.375 23.175 23.75 26.700000000000003 14 26.224999999999998 24.025 23.0 26.75 15 26.450000000000003 25.324999999999996 23.225 25.0 16 26.875 23.775 23.05 26.3 17 27.500000000000004 25.2 22.25 25.05 18 25.35 24.65 22.975 27.025 19 26.35 25.0 23.325000000000003 25.324999999999996 20 25.974999999999998 25.5 22.75 25.775 21 25.074999999999996 24.675 24.85 25.4 22 26.974999999999998 24.275 22.525000000000002 26.224999999999998 23 26.525 24.725 22.975 25.775 24 26.474999999999998 24.9 22.975 25.650000000000002 25 25.724999999999998 25.124999999999996 23.225 25.924999999999997 26 26.775 24.975 22.8 25.45 27 27.250000000000004 24.975 22.725 25.05 28 27.35 23.674999999999997 22.275 26.700000000000003 29 28.075 24.625 22.35 24.95 30 26.0 24.775 22.95 26.275 31 26.525 24.375 22.575 26.525 32 26.650000000000002 24.775 22.5 26.075 33 25.775 25.775 23.075000000000003 25.374999999999996 34 28.249999999999996 24.5 22.3 24.95 35 28.025 25.4 22.2 24.375 36 25.75 25.825 24.175 24.25 37 25.900000000000002 24.125 23.7 26.275 38 27.125 24.575 22.55 25.75 39 26.400000000000002 23.599999999999998 23.375 26.625 40 27.800000000000004 25.174999999999997 22.15 24.875 41 26.75 24.474999999999998 22.8 25.974999999999998 42 25.7 24.9 23.1 26.3 43 27.025 24.925 23.0 25.05 44 28.65 26.174999999999997 21.025 24.15 45 25.474999999999998 25.424999999999997 23.400000000000002 25.7 46 27.450000000000003 24.375 23.125 25.05 47 26.950000000000003 24.025 23.125 25.900000000000002 48 26.900000000000002 24.0 23.625 25.474999999999998 49 27.375 23.849999999999998 23.525 25.25 50 28.325 24.05 22.6 25.025 51 25.6 24.5 24.7 25.2 52 28.249999999999996 24.099999999999998 22.95 24.7 53 26.75 25.2 23.45 24.6 54 27.025 24.675 24.525 23.775 55 27.0 24.975 22.725 25.3 56 27.400000000000002 24.9 23.400000000000002 24.3 57 26.650000000000002 24.825 22.55 25.974999999999998 58 26.724999999999998 24.175 24.025 25.074999999999996 59 26.700000000000003 23.625 25.074999999999996 24.6 60 26.400000000000002 23.7 24.099999999999998 25.8 61 26.55 23.95 23.875 25.624999999999996 62 26.825 24.349999999999998 23.525 25.3 63 26.3 24.85 22.775000000000002 26.075 64 28.349999999999998 22.85 23.5 25.3 65 27.388694347173587 24.83741870935468 22.211105552776388 25.56278139069535 66 27.054108216432866 23.647294589178355 23.772545090180362 25.526052104208418 67 27.204030226700255 23.047858942065492 23.299748110831235 26.448362720403022 68 28.479712378017464 23.215202876219827 23.651771956856702 24.65331278890601 69 27.666666666666668 18.083333333333336 26.194444444444443 28.055555555555557 70 28.910818713450293 0.0 34.393274853801174 36.69590643274854 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.0 26 3.0 27 4.0 28 2.5 29 5.0 30 9.0 31 11.0 32 15.5 33 18.0 34 24.0 35 32.5 36 48.5 37 62.0 38 78.5 39 110.0 40 125.0 41 144.5 42 177.5 43 191.0 44 204.5 45 223.0 46 244.5 47 261.0 48 257.0 49 255.0 50 257.0 51 245.0 52 211.5 53 190.0 54 182.5 55 174.0 56 170.0 57 167.0 58 155.5 59 141.5 60 139.0 61 135.0 62 122.5 63 114.0 64 103.0 65 95.0 66 86.5 67 75.0 68 75.5 69 73.0 70 70.0 71 59.5 72 39.0 73 29.0 74 30.0 75 22.0 76 14.0 77 15.0 78 12.0 79 4.5 80 0.0 81 1.0 82 2.5 83 3.0 84 2.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.05 66 0.2 67 0.75 68 2.65 69 10.0 70 31.6 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268803 spots for ERR6145993.sra Written 268803 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra Read 268798 spots for ERR6145993.sra Written 268798 spots for ERR6145993.sra SRR ids: ['ERR6145993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q7v_6fvv ERR6145993.sra spots: 5375965 blocks: [[1, 268798], [268799, 537596], [537597, 806394], [806395, 1075192], [1075193, 1343990], [1343991, 1612788], [1612789, 1881586], [1881587, 2150384], [2150385, 2419182], [2419183, 2687980], [2687981, 2956778], [2956779, 3225576], [3225577, 3494374], [3494375, 3763172], [3763173, 4031970], [4031971, 4300768], [4300769, 4569566], [4569567, 4838364], [4838365, 5107162], [5107163, 5375965]] ERR6145993 file size 953324 ERR6145993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6145993 ERR6145993_1.fastq ERR6145993_2.fastq Input file: ERR6145993_1.fastq Paired file: ERR6145993_2.fastq trimmed: ERR6145993-trimmed-pair1.fastq, ERR6145993-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:19:44 2024 >> started Sat Dec 7 15:19:50 2024 >> done (5.233s) 5375965 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 102 ( 0.00%) empty read pairs filtered out after trimming by size control 5375863 (100.00%) read pairs available; of these: 7 ( 0.00%) trimmed read pairs available after processing 5375856 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 6 0.00% 70 5375856 100.00% 5375863 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=38 prefix-density=0.10 prefix-fanout=2.6 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=18 fanout-score=499.05 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=32.4 sequence=CTTCTTCTTCTGCTTGC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=101.81 fanout-score-rank=13 prefix-density=1.11 prefix-fanout=17.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=312.54 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=17.3 sequence=CGCCGCCGCCGG ERR6145993 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:20:26 Started mapping on | Dec 07 15:20:27 Finished on | Dec 07 15:20:46 Mapping speed, Million of reads per hour | 1018.58 Number of input reads | 5375863 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 5144525 Uniquely mapped reads % | 95.70% Average mapped length | 138.72 Number of splices: Total | 2470875 Number of splices: Annotated (sjdb) | 2345327 Number of splices: GT/AG | 2436426 Number of splices: GC/AG | 30699 Number of splices: AT/AC | 1750 Number of splices: Non-canonical | 2000 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 74579 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 5446 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 156759 156759 156759 N_multimapping 74579 74579 74579 N_noFeature 94066 5024453 125203 N_ambiguous 98641 420 9924 UnstrandedReadsAssigned:4951818 PositiveStrandReadsAssigned:119652 NegativeStrandReadsAssigned:5009398 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6145993 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6145993-trimmed-pair1.fastq ERR6145993-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,375,863 reads, 5,146,572 reads pseudoaligned [quant] estimated average fragment length: 202.337 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52973 ERR6145993.ke.tsv 35125 ERR6145993.se.tsv 88098 total ==> ERR6145993.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.931 31.5598 11.1896 PNS24247 1044 842.663 5.94628 1.83874 PNS24249 1928 1726.66 21.5416 3.25087 PNS24246 1044 842.663 5.94628 1.83874 PNS24248 1044 842.663 5.94628 1.83874 PNS24244 1471 1269.66 53.0598 10.8895 PNS24243 293 112.34 0 0 KQK14069 1603 1401.66 847.779 157.604 KQK14071 474 275.419 31.1575 29.478 ==> ERR6145993.se.tsv <== BRADI_1g14170v3 923 BRADI_1g53295v3 7 BRADI_1g59795v3 94 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 455 BRADI_1g74790v3 50 BRADI_1g09890v3 0 BRADI_1g77505v3 71 BRADI_1g48960v3 0 ERR6145993 completed mapping pipeline successfully