Starting /dee2/code/volunteer_pipeline.sh ERR6145994 current disk space = 1542360485888 free memory = 1593742768 ERR6145994 SRAfilesize f6cdba74fabed414173c8a8ee1ad8fe6 ERR6145994.sra ERR6145994.sra file validated ERR6145994 is paired end ERR6145994 is conventional basespace ERR6145994 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3185 35.0 35.0 35.0 35.0 35.0 2 34.53825 35.0 35.0 35.0 35.0 35.0 3 34.59325 35.0 35.0 35.0 35.0 35.0 4 34.58725 35.0 35.0 35.0 35.0 35.0 5 34.59875 35.0 35.0 35.0 35.0 35.0 6 39.3995 40.0 40.0 40.0 39.0 40.0 7 39.3425 40.0 40.0 40.0 39.0 40.0 8 39.258 40.0 40.0 40.0 39.0 40.0 9 39.34025 40.0 40.0 40.0 39.0 40.0 10 39.344 40.0 40.0 40.0 39.0 40.0 11 39.2865 40.0 40.0 40.0 39.0 40.0 12 39.32125 40.0 40.0 40.0 39.0 40.0 13 39.291 40.0 40.0 40.0 39.0 40.0 14 39.299 40.0 40.0 40.0 39.0 40.0 15 39.30375 40.0 40.0 40.0 39.0 40.0 16 39.27825 40.0 40.0 40.0 39.0 40.0 17 39.24075 40.0 40.0 40.0 39.0 40.0 18 39.2655 40.0 40.0 40.0 39.0 40.0 19 39.31375 40.0 40.0 40.0 39.0 40.0 20 39.347 40.0 40.0 40.0 39.0 40.0 21 39.3265 40.0 40.0 40.0 39.0 40.0 22 39.27825 40.0 40.0 40.0 39.0 40.0 23 39.22975 40.0 40.0 40.0 39.0 40.0 24 39.23275 40.0 40.0 40.0 39.0 40.0 25 39.2785 40.0 40.0 40.0 39.0 40.0 26 39.21525 40.0 40.0 40.0 39.0 40.0 27 39.24175 40.0 40.0 40.0 39.0 40.0 28 39.299 40.0 40.0 40.0 39.0 40.0 29 39.249 40.0 40.0 40.0 39.0 40.0 30 39.2985 40.0 40.0 40.0 39.0 40.0 31 39.20075 40.0 40.0 40.0 39.0 40.0 32 39.26775 40.0 40.0 40.0 39.0 40.0 33 39.21725 40.0 40.0 40.0 39.0 40.0 34 39.26275 40.0 40.0 40.0 39.0 40.0 35 39.2635 40.0 40.0 40.0 39.0 40.0 36 39.28325 40.0 40.0 40.0 39.0 40.0 37 39.201 40.0 40.0 40.0 39.0 40.0 38 39.19475 40.0 40.0 40.0 39.0 40.0 39 39.15225 40.0 40.0 40.0 39.0 40.0 40 39.24125 40.0 40.0 40.0 39.0 40.0 41 39.22925 40.0 40.0 40.0 39.0 40.0 42 39.2225 40.0 40.0 40.0 39.0 40.0 43 39.2455 40.0 40.0 40.0 39.0 40.0 44 39.17575 40.0 40.0 40.0 39.0 40.0 45 39.20025 40.0 40.0 40.0 39.0 40.0 46 39.1695 40.0 40.0 40.0 39.0 40.0 47 39.1435 40.0 40.0 40.0 39.0 40.0 48 39.211 40.0 40.0 40.0 39.0 40.0 49 39.2665 40.0 40.0 40.0 39.0 40.0 50 39.2595 40.0 40.0 40.0 39.0 40.0 51 39.2415 40.0 40.0 40.0 39.0 40.0 52 39.21925 40.0 40.0 40.0 39.0 40.0 53 39.22075 40.0 40.0 40.0 39.0 40.0 54 39.22925 40.0 40.0 40.0 39.0 40.0 55 39.2355 40.0 40.0 40.0 39.0 40.0 56 39.168 40.0 40.0 40.0 39.0 40.0 57 39.07125 40.0 40.0 40.0 38.0 40.0 58 39.08675 40.0 40.0 40.0 38.0 40.0 59 39.204 40.0 40.0 40.0 39.0 40.0 60 39.20825 40.0 40.0 40.0 39.0 40.0 61 39.248 40.0 40.0 40.0 39.0 40.0 62 39.2015 40.0 40.0 40.0 39.0 40.0 63 39.2285 40.0 40.0 40.0 39.0 40.0 64 39.1865 40.0 40.0 40.0 39.0 40.0 65 39.2095 40.0 40.0 40.0 39.0 40.0 66 39.244 40.0 40.0 40.0 39.0 40.0 67 39.263 40.0 40.0 40.0 39.0 40.0 68 39.216 40.0 40.0 40.0 39.0 40.0 69 39.13675 40.0 40.0 40.0 39.0 40.0 70 39.17875 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 2.0 26 7.0 27 10.0 28 12.0 29 20.0 30 25.0 31 25.0 32 35.0 33 26.0 34 48.0 35 61.0 36 74.0 37 117.0 38 239.0 39 3296.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.50758341759353 12.537917087967642 14.610717896865522 40.34378159757331 2 24.224999999999998 16.775000000000002 29.725 29.275000000000002 3 22.425 21.4 24.5 31.674999999999997 4 25.35 25.624999999999996 22.325 26.700000000000003 5 24.356089022255563 30.9827456864216 24.15603900975244 20.505126281570394 6 22.355588897224308 28.782195548887223 26.9567391847962 21.905476369092273 7 20.730182545636406 23.43085771442861 34.45861465366342 21.380345086271568 8 21.080270067516878 21.255313828457115 29.982495623905976 27.68192048012003 9 19.779944986246562 23.40585146286572 32.10802700675169 24.706176544136035 10 23.55588897224306 31.782945736434108 22.005501375343837 22.655663915978995 11 25.131282820705174 24.33108277069267 22.20555138784696 28.33208302075519 12 22.53063265816454 22.155538884721178 26.65666416604151 28.657164291072768 13 23.455863965991497 24.8062015503876 26.456614153538382 25.28132033008252 14 22.330582645661416 25.156289072268066 26.481620405101275 26.03150787696924 15 22.48062015503876 23.005751437859466 27.53188297074269 26.981745436359088 16 22.83070767691923 25.081270317579396 25.30632658164541 26.78169542385596 17 24.33108277069267 24.63115778944736 25.381345336334082 25.656414103525883 18 23.20580145036259 25.006251562890725 25.431357839459867 26.356589147286826 19 24.256064016004 25.55638909727432 24.356089022255563 25.831457864466117 20 24.381095273818453 25.731432858214554 25.056264066016503 24.831207801950487 21 22.50562640660165 24.20605151287822 26.206551637909474 27.081770442610654 22 23.705926481620406 25.056264066016503 24.281070267566893 26.9567391847962 23 23.58089522380595 24.781195298824706 25.95648912228057 25.681420355088775 24 22.330582645661416 25.206301575393848 26.18154538634659 26.281570392598148 25 23.40585146286572 24.281070267566893 24.956239059764943 27.35683920980245 26 23.730932733183295 25.806451612903224 24.656164041010253 25.806451612903224 27 23.355838959739934 24.8062015503876 25.756439109777446 26.081520380095025 28 24.48112028007002 24.60615153788447 24.55613903475869 26.356589147286826 29 24.381095273818453 24.60615153788447 25.55638909727432 25.456364091022753 30 23.43085771442861 25.30632658164541 24.956239059764943 26.30657664416104 31 24.056014003500874 24.831207801950487 24.981245311327832 26.131532883220803 32 23.55588897224306 24.8062015503876 25.85646411602901 25.78144536134033 33 23.280820205051263 24.15603900975244 25.881470367591895 26.6816704176044 34 26.431607901975497 23.85596399099775 24.706176544136035 25.006251562890725 35 24.55613903475869 24.731182795698924 24.081020255063766 26.63165791447862 36 23.43085771442861 25.331332833208304 25.081270317579396 26.156539134783696 37 24.88122030507627 24.981245311327832 24.456114028507127 25.681420355088775 38 24.15603900975244 25.731432858214554 24.8062015503876 25.30632658164541 39 23.43085771442861 24.306076519129782 25.18129532383096 27.081770442610654 40 24.18104526131533 25.381345336334082 24.85621405351338 25.581395348837212 41 24.681170292573142 24.706176544136035 25.081270317579396 25.531382845711427 42 23.355838959739934 23.980995248812203 25.431357839459867 27.231807951987996 43 24.306076519129782 24.33108277069267 24.93123280820205 26.431607901975497 44 23.95598899724931 25.406351587896975 25.381345336334082 25.256314078519633 45 24.58114528632158 25.18129532383096 24.256064016004 25.98149537384346 46 24.981245311327832 24.681170292573142 24.256064016004 26.081520380095025 47 24.656164041010253 23.980995248812203 25.28132033008252 26.081520380095025 48 23.705926481620406 22.755688922230558 25.78144536134033 27.7569392348087 49 25.006251562890725 24.006001500375092 23.50587646911728 27.481870467616904 50 23.95598899724931 24.48112028007002 25.056264066016503 26.506626656664167 51 22.080520130032507 25.78144536134033 25.30632658164541 26.831707926981746 52 24.681170292573142 23.830957739434858 24.981245311327832 26.506626656664167 53 24.306076519129782 25.78144536134033 24.8062015503876 25.10627656914228 54 24.406101525381345 24.306076519129782 24.8062015503876 26.481620405101275 55 25.481370342585645 24.081020255063766 23.755938984746187 26.6816704176044 56 24.50612653163291 24.381095273818453 25.331332833208304 25.78144536134033 57 22.88072018004501 25.131282820705174 24.381095273818453 27.60690172543136 58 23.680920230057513 25.431357839459867 23.95598899724931 26.93173293323331 59 23.030757689422355 25.056264066016503 25.95648912228057 25.95648912228057 60 22.255563890972745 23.85596399099775 25.85646411602901 28.032008002000502 61 24.781195298824706 24.63115778944736 24.48112028007002 26.106526631657918 62 23.85596399099775 24.306076519129782 25.85646411602901 25.98149537384346 63 23.50587646911728 22.95573893473368 26.756689172293076 26.78169542385596 64 24.012006003001503 23.536768384192097 25.062531265632813 27.388694347173587 65 25.212606303151574 23.88694347173587 24.912456228114056 25.987993996998497 66 22.67267267267267 24.64964964964965 25.75075075075075 26.926926926926924 67 24.60377358490566 24.12578616352201 23.572327044025158 27.69811320754717 68 25.21806054386865 23.242688558234992 25.423293996921497 26.115956900974858 69 23.766197959746346 18.66556382685415 28.232699200441136 29.335539012958368 70 27.086383601756953 0.0 34.2606149341142 38.65300146412884 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.0 24 1.5 25 2.0 26 3.5 27 6.0 28 8.0 29 12.5 30 15.0 31 19.5 32 30.5 33 37.0 34 41.0 35 59.5 36 91.0 37 108.0 38 124.0 39 157.0 40 174.0 41 193.5 42 219.5 43 226.0 44 233.5 45 240.5 46 239.5 47 239.0 48 246.5 49 239.5 50 225.0 51 205.0 52 208.5 53 232.0 54 192.5 55 162.0 56 151.5 57 132.0 58 115.5 59 104.5 60 110.0 61 112.0 62 95.0 63 76.0 64 75.0 65 81.5 66 80.0 67 71.0 68 69.0 69 55.5 70 44.0 71 41.0 72 29.5 73 21.0 74 20.0 75 13.0 76 5.0 77 3.0 78 6.0 79 6.0 80 3.0 81 3.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10 0.025 11 0.025 12 0.025 13 0.025 14 0.025 15 0.025 16 0.025 17 0.025 18 0.025 19 0.025 20 0.025 21 0.025 22 0.025 23 0.025 24 0.025 25 0.025 26 0.025 27 0.025 28 0.025 29 0.025 30 0.025 31 0.025 32 0.025 33 0.025 34 0.025 35 0.025 36 0.025 37 0.025 38 0.025 39 0.025 40 0.025 41 0.025 42 0.025 43 0.025 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.05 65 0.05 66 0.1 67 0.625 68 2.55 69 9.325 70 31.7 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6145994 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145994_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.17475 35.0 35.0 35.0 33.0 35.0 2 33.92125 35.0 35.0 35.0 32.0 35.0 3 33.8075 35.0 35.0 35.0 31.0 35.0 4 33.7155 35.0 35.0 35.0 31.0 35.0 5 33.67 35.0 35.0 35.0 31.0 35.0 6 38.27275 40.0 39.0 40.0 36.0 40.0 7 38.213 40.0 39.0 40.0 35.0 40.0 8 38.185 40.0 40.0 40.0 35.0 40.0 9 38.2255 40.0 40.0 40.0 36.0 40.0 10 38.2885 40.0 40.0 40.0 36.0 40.0 11 38.3025 40.0 40.0 40.0 35.0 40.0 12 38.2655 40.0 40.0 40.0 36.0 40.0 13 38.30475 40.0 40.0 40.0 36.0 40.0 14 38.3575 40.0 40.0 40.0 36.0 40.0 15 38.3195 40.0 40.0 40.0 36.0 40.0 16 38.29675 40.0 40.0 40.0 36.0 40.0 17 38.274 40.0 40.0 40.0 35.0 40.0 18 38.21575 40.0 40.0 40.0 35.0 40.0 19 38.336 40.0 40.0 40.0 36.0 40.0 20 38.39 40.0 40.0 40.0 36.0 40.0 21 38.319 40.0 40.0 40.0 36.0 40.0 22 38.37425 40.0 40.0 40.0 36.0 40.0 23 38.3155 40.0 40.0 40.0 36.0 40.0 24 38.24625 40.0 40.0 40.0 36.0 40.0 25 38.25475 40.0 40.0 40.0 36.0 40.0 26 38.33475 40.0 40.0 40.0 36.0 40.0 27 38.23575 40.0 40.0 40.0 36.0 40.0 28 38.351 40.0 40.0 40.0 36.0 40.0 29 38.28225 40.0 40.0 40.0 36.0 40.0 30 38.27275 40.0 40.0 40.0 36.0 40.0 31 38.25275 40.0 40.0 40.0 36.0 40.0 32 38.309 40.0 40.0 40.0 36.0 40.0 33 38.27675 40.0 40.0 40.0 36.0 40.0 34 38.291 40.0 40.0 40.0 36.0 40.0 35 38.2625 40.0 40.0 40.0 36.0 40.0 36 38.232 40.0 40.0 40.0 36.0 40.0 37 38.28125 40.0 40.0 40.0 36.0 40.0 38 38.2855 40.0 40.0 40.0 36.0 40.0 39 38.195 40.0 40.0 40.0 35.0 40.0 40 38.312 40.0 40.0 40.0 36.0 40.0 41 38.27825 40.0 40.0 40.0 36.0 40.0 42 38.20825 40.0 40.0 40.0 36.0 40.0 43 38.2545 40.0 39.0 40.0 36.0 40.0 44 38.24875 40.0 39.0 40.0 35.0 40.0 45 38.2145 40.0 40.0 40.0 35.0 40.0 46 38.25 40.0 39.0 40.0 36.0 40.0 47 38.142 40.0 39.0 40.0 35.0 40.0 48 38.18175 40.0 39.0 40.0 35.0 40.0 49 38.22125 40.0 39.0 40.0 36.0 40.0 50 38.098 40.0 39.0 40.0 35.0 40.0 51 38.1715 40.0 39.0 40.0 36.0 40.0 52 38.23175 40.0 39.0 40.0 35.0 40.0 53 38.1025 40.0 39.0 40.0 35.0 40.0 54 38.11725 40.0 39.0 40.0 35.0 40.0 55 38.11025 40.0 39.0 40.0 35.0 40.0 56 38.10175 40.0 39.0 40.0 35.0 40.0 57 38.1605 40.0 39.0 40.0 35.0 40.0 58 38.1305 40.0 39.0 40.0 35.0 40.0 59 38.13125 40.0 39.0 40.0 35.0 40.0 60 38.066 40.0 39.0 40.0 35.0 40.0 61 38.1555 40.0 39.0 40.0 35.0 40.0 62 38.1985 40.0 39.0 40.0 36.0 40.0 63 38.14275 40.0 39.0 40.0 35.0 40.0 64 38.052 40.0 39.0 40.0 35.0 40.0 65 38.14575 40.0 39.0 40.0 35.0 40.0 66 38.02375 40.0 39.0 40.0 35.0 40.0 67 38.1335 40.0 39.0 40.0 35.0 40.0 68 38.1 40.0 39.0 40.0 35.0 40.0 69 38.155 40.0 39.0 40.0 35.0 40.0 70 38.16175 40.0 39.0 40.0 35.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 5.0 18 13.0 19 20.0 20 33.0 21 41.0 22 32.0 23 20.0 24 22.0 25 16.0 26 19.0 27 20.0 28 26.0 29 19.0 30 28.0 31 31.0 32 19.0 33 39.0 34 39.0 35 55.0 36 63.0 37 127.0 38 256.0 39 3056.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.374999999999996 18.25 17.575 32.800000000000004 2 30.2 24.349999999999998 23.05 22.400000000000002 3 22.3 26.424999999999997 26.424999999999997 24.85 4 24.875 29.25 20.974999999999998 24.9 5 27.731932983245812 31.632908227056767 18.579644911227806 22.05551387846962 6 24.61230615307654 29.189594797398698 22.011005502751377 24.187093546773387 7 26.456614153538382 18.479619904976243 29.40735183795949 25.656414103525883 8 24.63115778944736 21.905476369092273 22.280570142535634 31.182795698924732 9 23.50587646911728 23.93098274568642 24.956239059764943 27.60690172543136 10 25.381345336334082 28.832208052013 20.930232558139537 24.85621405351338 11 27.981995498874717 21.305326331582897 20.580145036259065 30.132533133283324 12 26.006501625406354 20.655163790947736 23.50587646911728 29.83245811452863 13 25.906476619154787 22.980745186296573 23.93098274568642 27.181795448862218 14 26.556639159789945 23.15578894723681 22.455613903475868 27.831957989497376 15 26.981745436359088 23.380845211302827 23.305826456614152 26.331582895723933 16 26.356589147286826 25.456364091022753 23.005751437859466 25.18129532383096 17 26.156539134783696 24.93123280820205 22.455613903475868 26.456614153538382 18 25.456364091022753 25.331332833208304 22.655663915978995 26.556639159789945 19 27.68192048012003 24.256064016004 23.080770192548137 24.981245311327832 20 26.881720430107524 25.35633908477119 21.73043260815204 26.03150787696924 21 26.406601650412604 23.78094523630908 22.980745186296573 26.831707926981746 22 26.331582895723933 24.33108277069267 22.50562640660165 26.831707926981746 23 26.506626656664167 25.23130782695674 22.48062015503876 25.78144536134033 24 25.206301575393848 25.806451612903224 23.55588897224306 25.431357839459867 25 26.531632908227053 23.980995248812203 23.830957739434858 25.656414103525883 26 27.081770442610654 23.755938984746187 24.031007751937985 25.131282820705174 27 27.181795448862218 23.830957739434858 23.280820205051263 25.70642660665166 28 26.85671417854464 23.80595148787197 23.43085771442861 25.906476619154787 29 27.406851712928233 23.905976494123532 22.73068267066767 25.95648912228057 30 25.406351587896975 25.831457864466117 22.85571392848212 25.906476619154787 31 27.831957989497376 23.680920230057513 23.605901475368842 24.88122030507627 32 26.78169542385596 25.006251562890725 22.605651412853213 25.6064016004001 33 26.481620405101275 25.28132033008252 23.15578894723681 25.081270317579396 34 26.331582895723933 23.755938984746187 23.030757689422355 26.881720430107524 35 26.981745436359088 25.081270317579396 22.255563890972745 25.681420355088775 36 26.556639159789945 25.331332833208304 22.43060765191298 25.681420355088775 37 26.831707926981746 24.58114528632158 23.25581395348837 25.331332833208304 38 26.281570392598148 24.58114528632158 23.55588897224306 25.581395348837212 39 26.756689172293076 24.431107776944234 23.80595148787197 25.006251562890725 40 27.406851712928233 24.431107776944234 22.255563890972745 25.906476619154787 41 26.731682920730183 25.006251562890725 23.005751437859466 25.256314078519633 42 26.331582895723933 24.55613903475869 24.8062015503876 24.306076519129782 43 27.506876719179797 23.605901475368842 23.85596399099775 25.03125781445361 44 27.656914228557138 23.85596399099775 22.305576394098527 26.18154538634659 45 25.85646411602901 24.20605151287822 24.15603900975244 25.78144536134033 46 26.506626656664167 24.15603900975244 22.83070767691923 26.506626656664167 47 28.857214303575894 23.655913978494624 23.20580145036259 24.281070267566893 48 27.206801700425103 24.90622655663916 22.80570142535634 25.081270317579396 49 27.131782945736433 23.58089522380595 23.63090772693173 25.656414103525883 50 26.081520380095025 25.431357839459867 23.455863965991497 25.03125781445361 51 26.93173293323331 24.281070267566893 22.83070767691923 25.95648912228057 52 26.881720430107524 25.28132033008252 23.705926481620406 24.131032758189548 53 27.306826706676667 23.50587646911728 24.10602650662666 25.081270317579396 54 26.70667666916729 24.15603900975244 24.15603900975244 24.981245311327832 55 28.032008002000502 23.13078269567392 22.380595148787197 26.456614153538382 56 27.881970492623154 24.431107776944234 23.20580145036259 24.48112028007002 57 27.00675168792198 24.281070267566893 23.88097024256064 24.831207801950487 58 26.78169542385596 24.58114528632158 23.380845211302827 25.256314078519633 59 28.032008002000502 24.981245311327832 21.880470117529384 25.10627656914228 60 26.556639159789945 24.831207801950487 23.380845211302827 25.23130782695674 61 27.481870467616904 24.20605151287822 23.605901475368842 24.706176544136035 62 26.85671417854464 24.731182795698924 23.50587646911728 24.90622655663916 63 27.25681420355089 24.15603900975244 23.58089522380595 25.006251562890725 64 28.8144072036018 23.986993496748372 22.436218109054526 24.7623811905953 65 26.82011508631474 24.243182386790092 22.91718789091819 26.019514635976982 66 26.95390781563126 24.473947895791586 23.74749498997996 24.824649298597194 67 26.335685483870968 23.387096774193548 23.034274193548388 27.242943548387093 68 28.07971014492754 22.903726708074533 24.197722567287787 24.818840579710145 69 27.231638418079097 18.870056497175142 25.847457627118644 28.05084745762712 70 30.38162282326788 0.0 34.19785105594665 35.42052612078548 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 2.5 20 5.0 21 3.0 22 1.0 23 1.0 24 1.5 25 1.0 26 1.5 27 3.0 28 4.5 29 8.0 30 10.0 31 8.0 32 15.5 33 25.0 34 30.0 35 42.5 36 54.5 37 59.0 38 71.0 39 110.0 40 137.0 41 144.5 42 163.0 43 174.0 44 201.5 45 237.0 46 245.5 47 246.0 48 249.5 49 252.5 50 252.0 51 233.5 52 188.5 53 162.0 54 176.0 55 180.5 56 158.5 57 146.0 58 140.0 59 127.5 60 121.0 61 128.0 62 124.0 63 113.0 64 113.5 65 101.5 66 99.0 67 109.0 68 91.5 69 68.5 70 63.0 71 64.5 72 55.0 73 44.0 74 35.5 75 23.0 76 16.0 77 13.0 78 9.0 79 6.0 80 7.0 81 4.5 82 1.5 83 1.0 84 0.5 85 0.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.05 7 0.025 8 0.025 9 0.025 10 0.025 11 0.025 12 0.025 13 0.025 14 0.025 15 0.025 16 0.025 17 0.025 18 0.025 19 0.025 20 0.025 21 0.025 22 0.025 23 0.025 24 0.025 25 0.025 26 0.025 27 0.025 28 0.025 29 0.025 30 0.025 31 0.025 32 0.025 33 0.025 34 0.025 35 0.025 36 0.025 37 0.025 38 0.025 39 0.025 40 0.025 41 0.025 42 0.025 43 0.025 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.05 65 0.075 66 0.2 67 0.8 68 3.4000000000000004 69 11.5 70 32.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276573 spots for ERR6145994.sra Written 276573 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra Read 276566 spots for ERR6145994.sra Written 276566 spots for ERR6145994.sra SRR ids: ['ERR6145994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qyvdwz_r ERR6145994.sra spots: 5531327 blocks: [[1, 276566], [276567, 553132], [553133, 829698], [829699, 1106264], [1106265, 1382830], [1382831, 1659396], [1659397, 1935962], [1935963, 2212528], [2212529, 2489094], [2489095, 2765660], [2765661, 3042226], [3042227, 3318792], [3318793, 3595358], [3595359, 3871924], [3871925, 4148490], [4148491, 4425056], [4425057, 4701622], [4701623, 4978188], [4978189, 5254754], [5254755, 5531327]] ERR6145994 file size 980937 ERR6145994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6145994 ERR6145994_1.fastq ERR6145994_2.fastq Input file: ERR6145994_1.fastq Paired file: ERR6145994_2.fastq trimmed: ERR6145994-trimmed-pair1.fastq, ERR6145994-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:21:38 2024 >> started Sat Dec 7 15:21:46 2024 >> done (7.344s) 5531327 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 89 ( 0.00%) empty read pairs filtered out after trimming by size control 5531238 (100.00%) read pairs available; of these: 25 ( 0.00%) trimmed read pairs available after processing 5531213 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 52 2 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 21 0.00% 70 5531213 100.00% 5531238 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=32 prefix-density=0.09 prefix-fanout=2.9 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=498.15 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=31.2 sequence=CTTCTTCTTCTG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=106.28 fanout-score-rank=15 prefix-density=1.09 prefix-fanout=17.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=328.22 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=17.7 sequence=CGCCGCCGCCAT ERR6145994 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:22:11 Started mapping on | Dec 07 15:22:12 Finished on | Dec 07 15:22:25 Mapping speed, Million of reads per hour | 1531.73 Number of input reads | 5531238 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 5286790 Uniquely mapped reads % | 95.58% Average mapped length | 138.72 Number of splices: Total | 2543425 Number of splices: Annotated (sjdb) | 2414565 Number of splices: GT/AG | 2507844 Number of splices: GC/AG | 31500 Number of splices: AT/AC | 1911 Number of splices: Non-canonical | 2170 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 77561 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 5554 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 166887 166887 166887 N_multimapping 77561 77561 77561 N_noFeature 97255 5164033 128615 N_ambiguous 101657 448 10486 UnstrandedReadsAssigned:5087878 PositiveStrandReadsAssigned:122309 NegativeStrandReadsAssigned:5147689 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6145994 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6145994-trimmed-pair1.fastq ERR6145994-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,531,238 reads, 5,294,795 reads pseudoaligned [quant] estimated average fragment length: 202.589 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 ERR6145994.ke.tsv 35125 ERR6145994.se.tsv 88098 total ==> ERR6145994.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.706 0.0323151 0.0111497 PNS24247 1044 842.411 2.82458 0.849967 PNS24249 1928 1726.41 33.5808 4.93081 PNS24246 1044 842.411 2.82458 0.849967 PNS24248 1044 842.411 2.82458 0.849967 PNS24244 1471 1269.41 88.9132 17.7556 PNS24243 293 112.333 0 0 KQK14069 1603 1401.41 818.935 148.134 KQK14071 474 275.776 35.5762 32.702 ==> ERR6145994.se.tsv <== BRADI_1g14170v3 886 BRADI_1g53295v3 7 BRADI_1g59795v3 100 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 477 BRADI_1g74790v3 51 BRADI_1g09890v3 0 BRADI_1g77505v3 54 BRADI_1g48960v3 0 ERR6145994 completed mapping pipeline successfully