Starting /dee2/code/volunteer_pipeline.sh ERR6145995 current disk space = 1542420066304 free memory = 1593422176 ERR6145995 SRAfilesize 8a5f9e557ca91a8754f8559ffc4caa76 ERR6145995.sra ERR6145995.sra file validated ERR6145995 is paired end ERR6145995 is conventional basespace ERR6145995 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.251 35.0 35.0 35.0 35.0 35.0 2 34.593 35.0 35.0 35.0 35.0 35.0 3 34.54325 35.0 35.0 35.0 34.0 35.0 4 34.5595 35.0 35.0 35.0 34.0 35.0 5 34.57475 35.0 35.0 35.0 34.0 35.0 6 39.2935 40.0 40.0 40.0 39.0 40.0 7 39.29675 40.0 40.0 40.0 39.0 40.0 8 39.34375 40.0 40.0 40.0 39.0 40.0 9 39.34525 40.0 40.0 40.0 39.0 40.0 10 39.349 40.0 40.0 40.0 39.0 40.0 11 39.31625 40.0 40.0 40.0 39.0 40.0 12 39.2855 40.0 40.0 40.0 39.0 40.0 13 39.27275 40.0 40.0 40.0 39.0 40.0 14 39.285 40.0 40.0 40.0 39.0 40.0 15 39.2945 40.0 40.0 40.0 39.0 40.0 16 39.27575 40.0 40.0 40.0 39.0 40.0 17 39.33725 40.0 40.0 40.0 39.0 40.0 18 39.30875 40.0 40.0 40.0 39.0 40.0 19 39.3365 40.0 40.0 40.0 39.0 40.0 20 39.32725 40.0 40.0 40.0 39.0 40.0 21 39.323 40.0 40.0 40.0 39.0 40.0 22 39.25425 40.0 40.0 40.0 39.0 40.0 23 39.249 40.0 40.0 40.0 39.0 40.0 24 39.2365 40.0 40.0 40.0 39.0 40.0 25 39.301 40.0 40.0 40.0 39.0 40.0 26 39.25025 40.0 40.0 40.0 39.0 40.0 27 39.31675 40.0 40.0 40.0 39.0 40.0 28 39.222 40.0 40.0 40.0 39.0 40.0 29 39.2535 40.0 40.0 40.0 39.0 40.0 30 39.2055 40.0 40.0 40.0 39.0 40.0 31 39.201 40.0 40.0 40.0 39.0 40.0 32 39.26675 40.0 40.0 40.0 39.0 40.0 33 39.26875 40.0 40.0 40.0 39.0 40.0 34 39.16875 40.0 40.0 40.0 39.0 40.0 35 39.17975 40.0 40.0 40.0 39.0 40.0 36 39.2105 40.0 40.0 40.0 39.0 40.0 37 39.26525 40.0 40.0 40.0 39.0 40.0 38 39.21825 40.0 40.0 40.0 39.0 40.0 39 39.25125 40.0 40.0 40.0 39.0 40.0 40 39.278 40.0 40.0 40.0 39.0 40.0 41 39.17625 40.0 40.0 40.0 39.0 40.0 42 39.255 40.0 40.0 40.0 39.0 40.0 43 39.25425 40.0 40.0 40.0 39.0 40.0 44 39.21425 40.0 40.0 40.0 39.0 40.0 45 39.27775 40.0 40.0 40.0 39.0 40.0 46 39.29 40.0 40.0 40.0 39.0 40.0 47 39.26225 40.0 40.0 40.0 39.0 40.0 48 39.199 40.0 40.0 40.0 39.0 40.0 49 39.16625 40.0 40.0 40.0 39.0 40.0 50 39.2355 40.0 40.0 40.0 39.0 40.0 51 39.1675 40.0 40.0 40.0 39.0 40.0 52 39.19875 40.0 40.0 40.0 39.0 40.0 53 39.1635 40.0 40.0 40.0 39.0 40.0 54 39.1605 40.0 40.0 40.0 39.0 40.0 55 39.19875 40.0 40.0 40.0 39.0 40.0 56 39.17 40.0 40.0 40.0 39.0 40.0 57 39.1945 40.0 40.0 40.0 39.0 40.0 58 39.1175 40.0 40.0 40.0 39.0 40.0 59 39.154 40.0 40.0 40.0 38.0 40.0 60 39.14775 40.0 40.0 40.0 39.0 40.0 61 39.1115 40.0 40.0 40.0 39.0 40.0 62 39.125 40.0 40.0 40.0 39.0 40.0 63 39.16175 40.0 40.0 40.0 39.0 40.0 64 39.14875 40.0 40.0 40.0 38.0 40.0 65 39.13925 40.0 40.0 40.0 38.0 40.0 66 39.127 40.0 40.0 40.0 39.0 40.0 67 39.18725 40.0 40.0 40.0 39.0 40.0 68 39.143 40.0 40.0 40.0 39.0 40.0 69 39.09925 40.0 40.0 40.0 39.0 40.0 70 39.13 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 1.0 26 3.0 27 10.0 28 20.0 29 19.0 30 23.0 31 30.0 32 42.0 33 37.0 34 47.0 35 47.0 36 70.0 37 113.0 38 245.0 39 3290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.112964366944656 12.105130149102855 15.567349001769019 43.214556482183475 2 23.125 13.850000000000001 29.7 33.324999999999996 3 22.75 18.9 23.549999999999997 34.8 4 26.25 24.45 22.475 26.825 5 23.575 29.15 26.575 20.7 6 21.725 26.075 29.45 22.75 7 20.825 22.25 35.225 21.7 8 20.575 21.125 31.125000000000004 27.175 9 19.950000000000003 23.474999999999998 31.15 25.424999999999997 10 23.825 28.275 22.75 25.15 11 24.9 22.675 22.975 29.45 12 23.625 22.425 26.25 27.700000000000003 13 24.099999999999998 24.025 25.650000000000002 26.224999999999998 14 23.549999999999997 24.099999999999998 26.400000000000002 25.95 15 23.65 23.1 24.7 28.549999999999997 16 23.65 23.974999999999998 25.474999999999998 26.900000000000002 17 23.25 24.4 25.35 27.0 18 22.725 23.200000000000003 26.55 27.525 19 25.2 25.025 23.674999999999997 26.1 20 24.2 24.45 26.125 25.224999999999998 21 24.175 24.125 24.975 26.724999999999998 22 24.175 25.5 24.175 26.150000000000002 23 23.575 23.875 26.474999999999998 26.075 24 23.95 25.5 25.324999999999996 25.224999999999998 25 24.05 24.9 23.925 27.125 26 23.925 23.9 26.450000000000003 25.724999999999998 27 24.075 23.775 25.35 26.8 28 23.425 22.975 24.85 28.749999999999996 29 23.775 24.425 25.650000000000002 26.150000000000002 30 22.400000000000002 24.2 25.374999999999996 28.025 31 23.9 23.474999999999998 26.025 26.6 32 23.65 23.825 24.525 28.000000000000004 33 22.85 23.65 25.900000000000002 27.6 34 24.175 23.45 23.575 28.799999999999997 35 23.925 24.725 25.374999999999996 25.974999999999998 36 22.925 23.65 26.375 27.05 37 24.65 22.75 24.85 27.750000000000004 38 24.075 23.45 26.55 25.924999999999997 39 24.05 23.799999999999997 24.099999999999998 28.050000000000004 40 24.675 23.7 23.125 28.499999999999996 41 23.525 24.9 25.874999999999996 25.7 42 23.175 24.2 25.3 27.325 43 24.55 23.75 23.875 27.825 44 24.525 23.599999999999998 25.174999999999997 26.700000000000003 45 23.525 24.3 25.224999999999998 26.950000000000003 46 22.875 25.7 24.725 26.700000000000003 47 23.95 24.474999999999998 25.575 26.0 48 24.025 23.625 24.925 27.425 49 24.099999999999998 25.124999999999996 24.45 26.325 50 24.05 25.124999999999996 25.424999999999997 25.4 51 23.575 23.75 25.324999999999996 27.35 52 25.05 24.825 22.975 27.150000000000002 53 24.15 25.025 24.474999999999998 26.35 54 23.799999999999997 24.325 25.275 26.6 55 25.35 22.35 25.525 26.775 56 23.799999999999997 24.25 25.025 26.924999999999997 57 23.5 24.075 26.3 26.125 58 24.975 24.099999999999998 23.65 27.275 59 24.63115778944736 23.85596399099775 24.60615153788447 26.906726681670417 60 23.25581395348837 23.330832708177045 25.531382845711427 27.881970492623154 61 25.46273136568284 24.212106053026513 23.686843421710854 26.638319159579787 62 25.01876407305479 23.167375531648737 25.869402051538653 25.94445834375782 63 23.667750813109834 23.667750813109834 25.769326995246434 26.8951713785339 64 25.39404553415061 23.2424318238679 24.49337002752064 26.870152614460846 65 24.54954954954955 24.2992992992993 24.8998998998999 26.25125125125125 66 24.153498871331827 23.6267870579383 26.21018309505894 26.00953097567093 67 24.527350642803125 24.04839929417696 23.216536425510462 28.207713637509453 68 25.0 22.41555783009212 25.61412487205732 26.970317297850567 69 24.25485370522286 18.34837298331966 27.973748974569318 29.423024336888158 70 26.97274031563845 0.0 34.03873744619799 38.98852223816356 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 3.0 27 4.0 28 3.5 29 7.0 30 11.0 31 13.5 32 23.0 33 30.0 34 34.5 35 48.5 36 69.5 37 81.0 38 95.0 39 145.5 40 182.0 41 187.0 42 211.5 43 231.0 44 236.0 45 247.0 46 260.5 47 268.0 48 269.5 49 232.5 50 194.0 51 200.0 52 191.5 53 177.0 54 180.5 55 171.5 56 151.5 57 144.0 58 144.5 59 140.5 60 136.0 61 121.5 62 96.5 63 86.0 64 87.0 65 88.5 66 87.0 67 85.0 68 67.0 69 46.5 70 44.0 71 37.0 72 30.0 73 30.0 74 27.0 75 18.5 76 9.0 77 5.0 78 5.5 79 5.5 80 5.0 81 3.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.025 60 0.025 61 0.05 62 0.075 63 0.075 64 0.075 65 0.1 66 0.325 67 0.8250000000000001 68 2.3 69 8.575000000000001 70 30.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6145995 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145995_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.0765 35.0 35.0 35.0 32.0 35.0 2 33.77925 35.0 35.0 35.0 31.0 35.0 3 33.6385 35.0 35.0 35.0 31.0 35.0 4 33.561 35.0 35.0 35.0 31.0 35.0 5 33.6 35.0 35.0 35.0 31.0 35.0 6 38.1225 40.0 39.0 40.0 35.0 40.0 7 37.95075 40.0 39.0 40.0 34.0 40.0 8 38.07175 40.0 39.0 40.0 34.0 40.0 9 38.17375 40.0 39.0 40.0 35.0 40.0 10 38.1485 40.0 39.0 40.0 35.0 40.0 11 38.17375 40.0 39.0 40.0 35.0 40.0 12 38.20575 40.0 40.0 40.0 35.0 40.0 13 38.135 40.0 39.0 40.0 35.0 40.0 14 38.2025 40.0 39.0 40.0 35.0 40.0 15 38.19525 40.0 40.0 40.0 35.0 40.0 16 38.127 40.0 39.0 40.0 34.0 40.0 17 38.168 40.0 40.0 40.0 34.0 40.0 18 38.2195 40.0 40.0 40.0 35.0 40.0 19 38.148 40.0 40.0 40.0 35.0 40.0 20 38.15025 40.0 39.0 40.0 35.0 40.0 21 38.168 40.0 39.0 40.0 34.0 40.0 22 38.135 40.0 39.0 40.0 35.0 40.0 23 38.03675 40.0 39.0 40.0 34.0 40.0 24 38.138 40.0 39.0 40.0 34.0 40.0 25 38.13575 40.0 39.0 40.0 35.0 40.0 26 38.11975 40.0 39.0 40.0 35.0 40.0 27 38.20725 40.0 39.0 40.0 35.0 40.0 28 38.07025 40.0 39.0 40.0 34.0 40.0 29 38.05425 40.0 39.0 40.0 34.0 40.0 30 38.1115 40.0 39.0 40.0 34.0 40.0 31 38.09575 40.0 39.0 40.0 34.0 40.0 32 38.06175 40.0 39.0 40.0 35.0 40.0 33 38.15475 40.0 39.0 40.0 35.0 40.0 34 38.1375 40.0 39.0 40.0 35.0 40.0 35 38.0965 40.0 39.0 40.0 34.0 40.0 36 38.06125 40.0 39.0 40.0 34.0 40.0 37 38.121 40.0 39.0 40.0 34.0 40.0 38 38.10775 40.0 39.0 40.0 35.0 40.0 39 38.12975 40.0 39.0 40.0 34.0 40.0 40 38.13675 40.0 39.0 40.0 34.0 40.0 41 38.09675 40.0 39.0 40.0 35.0 40.0 42 38.07225 40.0 39.0 40.0 34.0 40.0 43 37.9465 40.0 39.0 40.0 34.0 40.0 44 38.029 40.0 39.0 40.0 34.0 40.0 45 37.92975 40.0 39.0 40.0 34.0 40.0 46 37.98725 40.0 39.0 40.0 34.0 40.0 47 37.91175 40.0 39.0 40.0 34.0 40.0 48 37.85725 40.0 39.0 40.0 34.0 40.0 49 37.8965 40.0 39.0 40.0 34.0 40.0 50 37.96875 40.0 39.0 40.0 34.0 40.0 51 37.9065 40.0 39.0 40.0 34.0 40.0 52 37.85925 40.0 39.0 40.0 34.0 40.0 53 37.93275 40.0 39.0 40.0 34.0 40.0 54 37.80025 40.0 39.0 40.0 34.0 40.0 55 37.9765 40.0 39.0 40.0 34.0 40.0 56 37.86525 40.0 39.0 40.0 34.0 40.0 57 38.01925 40.0 39.0 40.0 34.0 40.0 58 38.04375 40.0 39.0 40.0 34.0 40.0 59 38.01125 40.0 39.0 40.0 34.0 40.0 60 38.00475 40.0 39.0 40.0 34.0 40.0 61 37.976 40.0 39.0 40.0 34.0 40.0 62 37.98875 40.0 39.0 40.0 34.0 40.0 63 37.925 40.0 39.0 40.0 34.0 40.0 64 37.95425 40.0 39.0 40.0 34.0 40.0 65 37.88725 40.0 39.0 40.0 34.0 40.0 66 37.8775 40.0 39.0 40.0 34.0 40.0 67 37.825 40.0 39.0 40.0 34.0 40.0 68 37.85925 40.0 39.0 40.0 34.0 40.0 69 37.8835 40.0 39.0 40.0 34.0 40.0 70 37.89025 40.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 8.0 18 14.0 19 18.0 20 30.0 21 30.0 22 15.0 23 31.0 24 22.0 25 31.0 26 29.0 27 25.0 28 40.0 29 33.0 30 31.0 31 34.0 32 35.0 33 43.0 34 55.0 35 51.0 36 84.0 37 124.0 38 267.0 39 2949.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75 19.7 18.0 32.550000000000004 2 28.975 24.75 23.375 22.900000000000002 3 20.724999999999998 24.7 26.424999999999997 28.15 4 25.1 29.599999999999998 20.45 24.85 5 27.224999999999998 31.125000000000004 19.85 21.8 6 23.65 27.875 23.7 24.775 7 25.6 18.9 30.025000000000002 25.474999999999998 8 23.5 21.65 26.325 28.525 9 22.400000000000002 23.7 26.174999999999997 27.725 10 26.5 28.625 20.3 24.575 11 27.700000000000003 21.65 20.925 29.725 12 26.200000000000003 20.349999999999998 25.074999999999996 28.375 13 26.275 22.75 24.099999999999998 26.875 14 25.35 24.525 24.075 26.05 15 25.3 24.474999999999998 23.5 26.724999999999998 16 27.150000000000002 24.8 22.400000000000002 25.650000000000002 17 25.650000000000002 25.525 23.375 25.45 18 27.375 24.125 22.35 26.150000000000002 19 26.775 25.374999999999996 22.55 25.3 20 26.55 25.724999999999998 23.275000000000002 24.45 21 25.650000000000002 24.95 23.674999999999997 25.724999999999998 22 25.7 24.375 23.0 26.924999999999997 23 26.8 25.05 22.375 25.775 24 26.174999999999997 24.875 22.35 26.6 25 26.05 24.575 23.35 26.025 26 26.974999999999998 23.925 24.0 25.1 27 26.525 24.125 22.8 26.55 28 24.975 24.525 22.875 27.625 29 25.424999999999997 24.7 24.25 25.624999999999996 30 25.474999999999998 25.775 23.625 25.124999999999996 31 28.075 23.849999999999998 23.425 24.65 32 27.474999999999998 24.625 22.55 25.35 33 25.5 25.8 22.925 25.775 34 27.900000000000002 24.125 22.15 25.825 35 27.224999999999998 23.9 22.575 26.3 36 25.45 24.6 24.4 25.55 37 26.625 24.025 23.1 26.25 38 25.275 26.625 23.0 25.1 39 26.424999999999997 24.8 23.275000000000002 25.5 40 26.724999999999998 23.775 23.45 26.05 41 26.900000000000002 25.15 22.35 25.6 42 25.874999999999996 24.65 24.325 25.15 43 27.250000000000004 23.575 23.849999999999998 25.324999999999996 44 24.325 24.375 24.775 26.525 45 26.075 24.5 23.7 25.724999999999998 46 26.924999999999997 23.775 23.9 25.4 47 26.6 25.074999999999996 22.975 25.35 48 26.85 24.75 23.375 25.025 49 27.800000000000004 24.275 23.125 24.8 50 26.525 25.1 22.35 26.025 51 26.825 25.25 22.275 25.650000000000002 52 27.075 25.6 23.025000000000002 24.3 53 25.5 24.9 23.325000000000003 26.275 54 26.5 24.325 23.974999999999998 25.2 55 27.35 25.074999999999996 22.575 25.0 56 27.825 24.224999999999998 23.375 24.575 57 26.25 24.4 23.974999999999998 25.374999999999996 58 27.525 22.975 24.4 25.1 59 25.95648912228057 26.231557889472366 22.605651412853213 25.206301575393848 60 26.406601650412604 25.081270317579396 23.53088272068017 24.981245311327832 61 26.93173293323331 25.381345336334082 22.155538884721178 25.531382845711427 62 27.7569392348087 24.081020255063766 23.20580145036259 24.956239059764943 63 25.431357839459867 24.63115778944736 23.705926481620406 26.231557889472366 64 27.288644322161083 24.287143571785894 23.311655827913956 25.11255627813907 65 27.62071553665249 24.768576432324245 23.117338003502628 24.49337002752064 66 27.08594337258832 23.37759959909797 23.903783512904035 25.63267351540967 67 28.21807168096921 22.564361433619386 23.42251388187784 25.795053003533567 68 27.992776057791534 23.581011351909183 23.71001031991744 24.71620227038184 69 28.861675480100196 17.478430281102142 26.468132479821875 27.191761758975787 70 30.65934065934066 0.0 32.637362637362635 36.7032967032967 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 2.5 26 2.0 27 1.0 28 1.0 29 2.0 30 3.0 31 7.5 32 13.0 33 14.0 34 17.0 35 29.5 36 56.5 37 74.0 38 87.5 39 119.5 40 138.0 41 157.5 42 185.5 43 194.0 44 218.5 45 243.0 46 251.0 47 259.0 48 262.0 49 243.0 50 221.0 51 214.5 52 202.0 53 196.0 54 189.0 55 168.0 56 149.5 57 145.0 58 149.0 59 144.5 60 136.0 61 123.5 62 120.5 63 130.0 64 118.0 65 98.5 66 91.5 67 92.0 68 80.5 69 65.0 70 61.0 71 56.5 72 39.5 73 27.0 74 28.5 75 22.5 76 13.5 77 12.0 78 8.5 79 4.5 80 4.0 81 3.5 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.05 65 0.075 66 0.22499999999999998 67 0.95 68 3.1 69 10.174999999999999 70 31.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201130 spots for ERR6145995.sra Written 201130 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra Read 201113 spots for ERR6145995.sra Written 201113 spots for ERR6145995.sra SRR ids: ['ERR6145995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zc7n2lzd ERR6145995.sra spots: 4022277 blocks: [[1, 201113], [201114, 402226], [402227, 603339], [603340, 804452], [804453, 1005565], [1005566, 1206678], [1206679, 1407791], [1407792, 1608904], [1608905, 1810017], [1810018, 2011130], [2011131, 2212243], [2212244, 2413356], [2413357, 2614469], [2614470, 2815582], [2815583, 3016695], [3016696, 3217808], [3217809, 3418921], [3418922, 3620034], [3620035, 3821147], [3821148, 4022277]] ERR6145995 file size 712727 ERR6145995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6145995 ERR6145995_1.fastq ERR6145995_2.fastq Input file: ERR6145995_1.fastq Paired file: ERR6145995_2.fastq trimmed: ERR6145995-trimmed-pair1.fastq, ERR6145995-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:21:54 2024 >> started Sat Dec 7 15:21:58 2024 >> done (3.542s) 4022277 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 66 ( 0.00%) empty read pairs filtered out after trimming by size control 4022211 (100.00%) read pairs available; of these: 9 ( 0.00%) trimmed read pairs available after processing 4022202 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 1 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 5 0.00% 70 4022202 100.00% 4022211 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=31 prefix-density=0.10 prefix-fanout=2.7 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=489.85 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=33.0 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=116.92 fanout-score-rank=12 prefix-density=1.09 prefix-fanout=18.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=726.73 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=17.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGG ERR6145995 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:22:26 Started mapping on | Dec 07 15:22:26 Finished on | Dec 07 15:22:38 Mapping speed, Million of reads per hour | 1206.66 Number of input reads | 4022211 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3845750 Uniquely mapped reads % | 95.61% Average mapped length | 138.76 Number of splices: Total | 1911264 Number of splices: Annotated (sjdb) | 1812576 Number of splices: GT/AG | 1884488 Number of splices: GC/AG | 24001 Number of splices: AT/AC | 1388 Number of splices: Non-canonical | 1387 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 56013 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 4488 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 120448 120448 120448 N_multimapping 56013 56013 56013 N_noFeature 68825 3763424 90178 N_ambiguous 68072 337 7256 UnstrandedReadsAssigned:3708853 PositiveStrandReadsAssigned:81989 NegativeStrandReadsAssigned:3748316 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6145995 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6145995-trimmed-pair1.fastq ERR6145995-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,022,211 reads, 3,854,824 reads pseudoaligned [quant] estimated average fragment length: 189.996 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52973 ERR6145995.ke.tsv 35125 ERR6145995.se.tsv 88098 total ==> ERR6145995.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 747.253 17.7119 8.70246 PNS24247 1044 855.004 17.1767 7.37595 PNS24249 1928 1739 25.0816 5.29541 PNS24246 1044 855.004 17.1767 7.37595 PNS24248 1044 855.004 17.1767 7.37595 PNS24244 1471 1282 7.67642 2.19844 PNS24243 293 122.337 0 0 KQK14069 1603 1414 710.487 184.481 KQK14071 474 288.253 20.6168 26.2599 ==> ERR6145995.se.tsv <== BRADI_1g14170v3 779 BRADI_1g53295v3 10 BRADI_1g59795v3 53 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 298 BRADI_1g74790v3 30 BRADI_1g09890v3 0 BRADI_1g77505v3 45 BRADI_1g48960v3 0 ERR6145995 completed mapping pipeline successfully