Starting /dee2/code/volunteer_pipeline.sh ERR6145996 current disk space = 1542433226752 free memory = 1597471040 ERR6145996 SRAfilesize 6f79cc3295aaae929bca753ed398211e ERR6145996.sra ERR6145996.sra file validated ERR6145996 is paired end ERR6145996 is conventional basespace ERR6145996 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3855 35.0 35.0 35.0 35.0 35.0 2 34.6185 35.0 35.0 35.0 34.0 35.0 3 34.60075 35.0 35.0 35.0 34.0 35.0 4 34.61125 35.0 35.0 35.0 34.0 35.0 5 34.639 35.0 35.0 35.0 35.0 35.0 6 39.325 40.0 40.0 40.0 39.0 40.0 7 39.33975 40.0 40.0 40.0 39.0 40.0 8 39.30575 40.0 40.0 40.0 39.0 40.0 9 39.356 40.0 40.0 40.0 39.0 40.0 10 39.36575 40.0 40.0 40.0 39.0 40.0 11 39.33225 40.0 40.0 40.0 39.0 40.0 12 39.32625 40.0 40.0 40.0 39.0 40.0 13 39.28475 40.0 40.0 40.0 39.0 40.0 14 39.29875 40.0 40.0 40.0 39.0 40.0 15 39.32125 40.0 40.0 40.0 39.0 40.0 16 39.39375 40.0 40.0 40.0 39.0 40.0 17 39.339 40.0 40.0 40.0 39.0 40.0 18 39.3065 40.0 40.0 40.0 39.0 40.0 19 39.36225 40.0 40.0 40.0 39.0 40.0 20 39.36275 40.0 40.0 40.0 39.0 40.0 21 39.30675 40.0 40.0 40.0 39.0 40.0 22 39.32 40.0 40.0 40.0 39.0 40.0 23 39.2495 40.0 40.0 40.0 39.0 40.0 24 39.265 40.0 40.0 40.0 39.0 40.0 25 39.26175 40.0 40.0 40.0 39.0 40.0 26 39.24125 40.0 40.0 40.0 39.0 40.0 27 39.263 40.0 40.0 40.0 39.0 40.0 28 39.29975 40.0 40.0 40.0 39.0 40.0 29 39.22075 40.0 40.0 40.0 39.0 40.0 30 39.19775 40.0 40.0 40.0 39.0 40.0 31 39.189 40.0 40.0 40.0 39.0 40.0 32 39.22725 40.0 40.0 40.0 39.0 40.0 33 39.21125 40.0 40.0 40.0 39.0 40.0 34 39.226 40.0 40.0 40.0 39.0 40.0 35 39.23425 40.0 40.0 40.0 39.0 40.0 36 39.2525 40.0 40.0 40.0 39.0 40.0 37 39.17775 40.0 40.0 40.0 39.0 40.0 38 39.24275 40.0 40.0 40.0 39.0 40.0 39 39.144 40.0 40.0 40.0 39.0 40.0 40 39.23675 40.0 40.0 40.0 39.0 40.0 41 39.1595 40.0 40.0 40.0 39.0 40.0 42 39.24725 40.0 40.0 40.0 39.0 40.0 43 39.22775 40.0 40.0 40.0 39.0 40.0 44 39.227 40.0 40.0 40.0 39.0 40.0 45 39.2435 40.0 40.0 40.0 39.0 40.0 46 39.19825 40.0 40.0 40.0 39.0 40.0 47 39.1705 40.0 40.0 40.0 39.0 40.0 48 39.2445 40.0 40.0 40.0 39.0 40.0 49 39.263 40.0 40.0 40.0 39.0 40.0 50 39.28925 40.0 40.0 40.0 39.0 40.0 51 39.235 40.0 40.0 40.0 39.0 40.0 52 39.22275 40.0 40.0 40.0 39.0 40.0 53 39.241 40.0 40.0 40.0 39.0 40.0 54 39.1835 40.0 40.0 40.0 39.0 40.0 55 39.21 40.0 40.0 40.0 39.0 40.0 56 39.231 40.0 40.0 40.0 39.0 40.0 57 39.12225 40.0 40.0 40.0 38.0 40.0 58 39.15 40.0 40.0 40.0 38.0 40.0 59 39.1975 40.0 40.0 40.0 39.0 40.0 60 39.15075 40.0 40.0 40.0 39.0 40.0 61 39.1815 40.0 40.0 40.0 39.0 40.0 62 39.19875 40.0 40.0 40.0 39.0 40.0 63 39.218 40.0 40.0 40.0 39.0 40.0 64 39.15775 40.0 40.0 40.0 38.0 40.0 65 39.16 40.0 40.0 40.0 39.0 40.0 66 39.17075 40.0 40.0 40.0 39.0 40.0 67 39.21925 40.0 40.0 40.0 39.0 40.0 68 39.18775 40.0 40.0 40.0 39.0 40.0 69 39.1645 40.0 40.0 40.0 39.0 40.0 70 39.1765 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 3.0 26 4.0 27 8.0 28 9.0 29 19.0 30 23.0 31 33.0 32 25.0 33 31.0 34 65.0 35 57.0 36 85.0 37 121.0 38 264.0 39 3253.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.056213763549284 13.00731031005798 14.998739601714142 40.937736324678596 2 23.075000000000003 14.499999999999998 30.075000000000003 32.35 3 21.15 20.225 23.474999999999998 35.15 4 25.650000000000002 24.9 22.525000000000002 26.924999999999997 5 25.25 30.099999999999998 24.375 20.275000000000002 6 21.175 27.900000000000002 28.599999999999998 22.325 7 20.974999999999998 21.099999999999998 35.275 22.650000000000002 8 20.1 21.7 31.424999999999997 26.775 9 19.775000000000002 24.025 32.0 24.2 10 22.975 29.049999999999997 23.799999999999997 24.175 11 26.474999999999998 21.775 24.15 27.6 12 23.849999999999998 20.525 27.474999999999998 28.15 13 22.900000000000002 24.3 27.150000000000002 25.650000000000002 14 23.974999999999998 23.849999999999998 25.8 26.375 15 22.75 24.95 25.0 27.3 16 25.124999999999996 23.275000000000002 25.474999999999998 26.125 17 25.05 22.575 25.374999999999996 27.0 18 24.224999999999998 25.424999999999997 23.925 26.424999999999997 19 25.174999999999997 25.224999999999998 23.35 26.25 20 23.925 24.85 25.900000000000002 25.324999999999996 21 23.549999999999997 24.325 24.775 27.35 22 24.375 24.25 24.3 27.075 23 23.275000000000002 24.425 25.15 27.150000000000002 24 22.775000000000002 24.224999999999998 25.650000000000002 27.35 25 23.075000000000003 24.075 25.174999999999997 27.675 26 23.0 25.525 25.825 25.650000000000002 27 23.799999999999997 23.775 25.025 27.400000000000002 28 25.074999999999996 24.675 24.05 26.200000000000003 29 23.200000000000003 25.0 25.575 26.224999999999998 30 24.175 24.4 25.8 25.624999999999996 31 25.5 25.575 23.125 25.8 32 23.775 25.224999999999998 24.65 26.35 33 23.25 24.425 25.35 26.974999999999998 34 24.05 24.224999999999998 25.074999999999996 26.650000000000002 35 24.075 25.5 24.7 25.724999999999998 36 23.974999999999998 23.225 24.8 28.000000000000004 37 24.75 23.275000000000002 23.875 28.1 38 23.45 25.074999999999996 25.3 26.174999999999997 39 22.8 25.6 24.875 26.724999999999998 40 25.3 24.175 23.625 26.900000000000002 41 23.275000000000002 25.124999999999996 25.6 26.0 42 22.925 25.05 24.45 27.575 43 24.975 24.4 24.25 26.375 44 23.95 24.8 25.124999999999996 26.125 45 22.45 23.95 25.45 28.15 46 23.95 23.325000000000003 25.474999999999998 27.250000000000004 47 23.724999999999998 23.724999999999998 26.8 25.75 48 23.1 23.849999999999998 25.474999999999998 27.575 49 25.55 23.35 24.825 26.275 50 23.625 24.099999999999998 26.1 26.174999999999997 51 24.099999999999998 23.125 25.5 27.275 52 24.3 25.474999999999998 23.150000000000002 27.075 53 23.45 24.925 25.025 26.6 54 24.474999999999998 23.95 24.7 26.875 55 25.15 23.925 24.25 26.674999999999997 56 23.474999999999998 23.525 25.7 27.3 57 22.900000000000002 24.45 25.924999999999997 26.724999999999998 58 24.775 23.525 24.925 26.775 59 23.599999999999998 24.05 25.074999999999996 27.275 60 23.150000000000002 23.575 24.55 28.725 61 24.781195298824706 24.356089022255563 23.78094523630908 27.081770442610654 62 23.10577644411103 24.48112028007002 25.206301575393848 27.206801700425103 63 22.85571392848212 24.63115778944736 26.03150787696924 26.481620405101275 64 25.6064016004001 24.056014003500874 23.53088272068017 26.806701675418854 65 24.731182795698924 23.680920230057513 25.381345336334082 26.206551637909474 66 23.37759959909797 24.229516411926834 25.181658732147334 27.211225256827866 67 25.61588738059326 22.825540472599297 24.358974358974358 27.19959778783308 68 23.50536535513541 23.12212570260603 26.673479816044964 26.699029126213592 69 24.224965706447186 18.930041152263374 27.572016460905353 29.27297668038409 70 27.67113364722926 0.0 35.747917421224194 36.580948931546544 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.0 27 2.0 28 5.0 29 9.0 30 10.0 31 14.5 32 21.0 33 23.0 34 27.5 35 46.0 36 73.5 37 87.0 38 107.5 39 138.5 40 149.0 41 170.5 42 205.0 43 218.0 44 238.5 45 271.5 46 273.0 47 262.0 48 269.0 49 250.5 50 225.0 51 221.5 52 204.5 53 191.0 54 181.5 55 159.0 56 141.0 57 136.0 58 130.5 59 119.5 60 114.0 61 112.5 62 111.0 63 111.0 64 103.5 65 87.5 66 79.5 67 80.0 68 69.5 69 48.5 70 38.0 71 33.5 72 29.0 73 29.0 74 23.5 75 12.0 76 4.5 77 3.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.22499999999999998 67 0.5499999999999999 68 2.15 69 8.875 70 30.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6145996 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145996_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.01875 35.0 35.0 35.0 31.0 35.0 2 33.81325 35.0 35.0 35.0 31.0 35.0 3 33.61875 35.0 35.0 35.0 31.0 35.0 4 33.554 35.0 35.0 35.0 31.0 35.0 5 33.39925 35.0 35.0 35.0 31.0 35.0 6 37.9615 40.0 39.0 40.0 34.0 40.0 7 37.993 40.0 39.0 40.0 34.0 40.0 8 38.01325 40.0 39.0 40.0 34.0 40.0 9 38.04025 40.0 39.0 40.0 34.0 40.0 10 38.04925 40.0 39.0 40.0 34.0 40.0 11 37.98425 40.0 39.0 40.0 34.0 40.0 12 38.08425 40.0 39.0 40.0 34.0 40.0 13 38.1425 40.0 39.0 40.0 34.0 40.0 14 38.16725 40.0 39.0 40.0 35.0 40.0 15 38.1375 40.0 39.0 40.0 34.0 40.0 16 38.12725 40.0 39.0 40.0 34.0 40.0 17 38.018 40.0 39.0 40.0 34.0 40.0 18 38.079 40.0 39.0 40.0 34.0 40.0 19 38.041 40.0 39.0 40.0 34.0 40.0 20 38.122 40.0 39.0 40.0 34.0 40.0 21 38.09275 40.0 39.0 40.0 35.0 40.0 22 38.06925 40.0 39.0 40.0 34.0 40.0 23 38.07725 40.0 39.0 40.0 34.0 40.0 24 38.077 40.0 39.0 40.0 34.0 40.0 25 38.1135 40.0 39.0 40.0 34.0 40.0 26 38.18675 40.0 39.0 40.0 35.0 40.0 27 38.08825 40.0 39.0 40.0 35.0 40.0 28 37.996 40.0 39.0 40.0 34.0 40.0 29 38.049 40.0 39.0 40.0 34.0 40.0 30 38.12375 40.0 39.0 40.0 34.0 40.0 31 38.07125 40.0 39.0 40.0 34.0 40.0 32 38.07 40.0 39.0 40.0 35.0 40.0 33 38.15375 40.0 39.0 40.0 35.0 40.0 34 37.9325 40.0 39.0 40.0 34.0 40.0 35 38.075 40.0 39.0 40.0 34.0 40.0 36 38.03525 40.0 39.0 40.0 34.0 40.0 37 38.04475 40.0 39.0 40.0 34.0 40.0 38 38.021 40.0 39.0 40.0 34.0 40.0 39 38.05175 40.0 39.0 40.0 34.0 40.0 40 38.0245 40.0 39.0 40.0 34.0 40.0 41 38.0445 40.0 39.0 40.0 35.0 40.0 42 37.988 40.0 39.0 40.0 34.0 40.0 43 37.93925 40.0 39.0 40.0 34.0 40.0 44 37.97775 40.0 39.0 40.0 34.0 40.0 45 38.00775 40.0 39.0 40.0 34.0 40.0 46 37.9865 40.0 39.0 40.0 34.0 40.0 47 37.88 40.0 39.0 40.0 34.0 40.0 48 37.9545 40.0 39.0 40.0 34.0 40.0 49 37.90175 40.0 39.0 40.0 34.0 40.0 50 37.856 40.0 39.0 40.0 34.0 40.0 51 37.988 40.0 39.0 40.0 34.0 40.0 52 37.91425 40.0 39.0 40.0 34.0 40.0 53 37.9125 40.0 39.0 40.0 34.0 40.0 54 37.876 40.0 39.0 40.0 34.0 40.0 55 37.927 40.0 39.0 40.0 34.0 40.0 56 37.807 40.0 39.0 40.0 34.0 40.0 57 37.9265 40.0 39.0 40.0 34.0 40.0 58 37.9285 40.0 39.0 40.0 34.0 40.0 59 37.83975 40.0 39.0 40.0 34.0 40.0 60 37.9635 40.0 39.0 40.0 34.0 40.0 61 37.89075 40.0 39.0 40.0 34.0 40.0 62 37.968 40.0 39.0 40.0 34.0 40.0 63 37.8515 40.0 39.0 40.0 34.0 40.0 64 37.881 40.0 39.0 40.0 34.0 40.0 65 37.91425 40.0 39.0 40.0 34.0 40.0 66 37.89425 40.0 39.0 40.0 34.0 40.0 67 37.8365 40.0 39.0 40.0 34.0 40.0 68 37.922 40.0 39.0 40.0 34.0 40.0 69 37.83325 40.0 39.0 40.0 34.0 40.0 70 37.7945 40.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 18.0 19 29.0 20 17.0 21 25.0 22 28.0 23 26.0 24 36.0 25 22.0 26 37.0 27 33.0 28 31.0 29 28.0 30 33.0 31 28.0 32 41.0 33 46.0 34 53.0 35 57.0 36 85.0 37 119.0 38 279.0 39 2926.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.999999999999996 19.825 18.9 32.275 2 28.425 25.35 23.125 23.1 3 21.9 25.575 25.025 27.500000000000004 4 25.8 29.025000000000002 20.575 24.6 5 25.7 31.95 20.75 21.6 6 23.425 28.599999999999998 22.75 25.224999999999998 7 24.025 20.075000000000003 29.175 26.724999999999998 8 22.675 22.7 25.35 29.275000000000002 9 24.025 24.075 25.174999999999997 26.724999999999998 10 27.35 28.000000000000004 20.0 24.65 11 28.775000000000002 22.225 19.8 29.2 12 26.424999999999997 22.125 22.8 28.65 13 25.6 24.05 22.95 27.400000000000002 14 26.875 24.0 22.75 26.375 15 25.1 24.2 24.0 26.700000000000003 16 26.575 24.275 22.1 27.05 17 27.275 24.525 22.375 25.825 18 25.15 25.2 23.3 26.35 19 25.95 25.1 23.225 25.724999999999998 20 27.175 25.0 22.325 25.5 21 26.0 24.325 23.75 25.924999999999997 22 27.85 23.875 22.55 25.724999999999998 23 26.724999999999998 25.874999999999996 23.25 24.15 24 24.775 25.575 23.775 25.874999999999996 25 26.450000000000003 24.8 23.175 25.575 26 27.200000000000003 24.95 23.5 24.349999999999998 27 25.8 24.45 23.375 26.375 28 27.1 24.45 21.9 26.55 29 25.025 25.900000000000002 23.400000000000002 25.674999999999997 30 25.7 24.425 24.725 25.15 31 27.125 24.3 23.275000000000002 25.3 32 27.1 25.674999999999997 22.575 24.65 33 26.724999999999998 24.3 23.599999999999998 25.374999999999996 34 26.875 24.275 24.224999999999998 24.625 35 27.35 24.349999999999998 23.075000000000003 25.224999999999998 36 25.35 24.325 24.5 25.825 37 26.075 25.324999999999996 22.325 26.275 38 25.8 26.724999999999998 22.75 24.725 39 25.324999999999996 26.275 22.475 25.924999999999997 40 26.5 24.925 23.200000000000003 25.374999999999996 41 26.474999999999998 25.525 21.475 26.525 42 26.8 24.4 23.1 25.7 43 27.1 24.5 23.549999999999997 24.85 44 27.175 24.85 22.75 25.224999999999998 45 25.724999999999998 24.65 24.224999999999998 25.4 46 27.250000000000004 25.674999999999997 21.525 25.55 47 26.55 25.775 22.7 24.975 48 26.5 24.65 23.35 25.5 49 27.6 24.224999999999998 22.625 25.55 50 27.250000000000004 24.375 23.25 25.124999999999996 51 26.700000000000003 24.7 23.474999999999998 25.124999999999996 52 26.275 24.325 23.65 25.75 53 26.950000000000003 24.625 23.200000000000003 25.224999999999998 54 27.175 25.35 22.2 25.275 55 27.675 25.025 22.75 24.55 56 26.950000000000003 24.9 23.575 24.575 57 27.175 24.05 23.925 24.85 58 27.825 24.7 22.45 25.025 59 27.900000000000002 24.65 22.025 25.424999999999997 60 26.35 24.75 22.75 26.150000000000002 61 27.68192048012003 23.95598899724931 23.605901475368842 24.756189047261813 62 27.106776694173547 25.681420355088775 21.880470117529384 25.331332833208304 63 27.33183295823956 24.456114028507127 23.380845211302827 24.831207801950487 64 27.056764191047762 24.48112028007002 23.20580145036259 25.256314078519633 65 28.33208302075519 25.03125781445361 23.030757689422355 23.605901475368842 66 26.058631921824105 24.429967426710096 24.129290904535207 25.382109746930592 67 27.07808564231738 24.130982367758186 22.997481108312343 25.793450881612088 68 27.16271884654995 23.403707518022657 23.094747682801238 26.33882595262616 69 26.920935412026726 19.014476614699333 26.419821826280625 27.644766146993316 70 29.71281296023564 0.0 33.210603829160526 37.07658321060383 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 2.5 29 3.0 30 3.0 31 8.5 32 13.5 33 13.0 34 20.0 35 33.0 36 53.0 37 67.0 38 79.5 39 130.5 40 169.0 41 169.0 42 201.0 43 233.0 44 242.0 45 252.5 46 244.0 47 234.0 48 231.5 49 233.5 50 238.0 51 224.0 52 190.5 53 171.0 54 171.5 55 171.5 56 160.0 57 149.0 58 139.5 59 120.5 60 111.0 61 124.5 62 122.5 63 107.0 64 106.0 65 108.0 66 103.0 67 95.0 68 92.0 69 76.5 70 64.0 71 53.0 72 35.0 73 28.0 74 25.5 75 25.5 76 17.5 77 7.0 78 4.5 79 3.0 80 4.0 81 2.0 82 1.0 83 2.0 84 1.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.22499999999999998 67 0.75 68 2.9000000000000004 69 10.2 70 32.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205920 spots for ERR6145996.sra Written 205920 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra Read 205904 spots for ERR6145996.sra Written 205904 spots for ERR6145996.sra SRR ids: ['ERR6145996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zcd7yg13 ERR6145996.sra spots: 4118096 blocks: [[1, 205904], [205905, 411808], [411809, 617712], [617713, 823616], [823617, 1029520], [1029521, 1235424], [1235425, 1441328], [1441329, 1647232], [1647233, 1853136], [1853137, 2059040], [2059041, 2264944], [2264945, 2470848], [2470849, 2676752], [2676753, 2882656], [2882657, 3088560], [3088561, 3294464], [3294465, 3500368], [3500369, 3706272], [3706273, 3912176], [3912177, 4118096]] ERR6145996 file size 729758 ERR6145996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6145996 ERR6145996_1.fastq ERR6145996_2.fastq Input file: ERR6145996_1.fastq Paired file: ERR6145996_2.fastq trimmed: ERR6145996-trimmed-pair1.fastq, ERR6145996-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:23:08 2024 >> started Sat Dec 7 15:23:14 2024 >> done (6.034s) 4118096 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 68 ( 0.00%) empty read pairs filtered out after trimming by size control 4118028 (100.00%) read pairs available; of these: 16 ( 0.00%) trimmed read pairs available after processing 4118012 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 15 0.00% 70 4118012 100.00% 4118028 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=35 prefix-density=0.10 prefix-fanout=2.7 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=494.79 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=32.0 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=119.24 fanout-score-rank=11 prefix-density=1.05 prefix-fanout=18.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=762.46 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=17.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR6145996 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:23:53 Started mapping on | Dec 07 15:23:53 Finished on | Dec 07 15:24:10 Mapping speed, Million of reads per hour | 872.05 Number of input reads | 4118028 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3932445 Uniquely mapped reads % | 95.49% Average mapped length | 138.75 Number of splices: Total | 1952416 Number of splices: Annotated (sjdb) | 1851895 Number of splices: GT/AG | 1924992 Number of splices: GC/AG | 24544 Number of splices: AT/AC | 1456 Number of splices: Non-canonical | 1424 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 57154 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 4602 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 128429 128429 128429 N_multimapping 57154 57154 57154 N_noFeature 71387 3847364 93616 N_ambiguous 69913 346 7214 UnstrandedReadsAssigned:3791145 PositiveStrandReadsAssigned:84735 NegativeStrandReadsAssigned:3831615 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6145996 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6145996-trimmed-pair1.fastq ERR6145996-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,118,028 reads, 3,945,178 reads pseudoaligned [quant] estimated average fragment length: 190.677 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 ERR6145996.ke.tsv 35125 ERR6145996.se.tsv 88098 total ==> ERR6145996.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.731 42.7693 20.5779 PNS24247 1044 854.323 5.29363 2.22621 PNS24249 1928 1738.32 25.5875 5.28848 PNS24246 1044 854.323 5.29363 2.22621 PNS24248 1044 854.323 5.29363 2.22621 PNS24244 1471 1281.32 5.76227 1.61573 PNS24243 293 121.975 0 0 KQK14069 1603 1413.32 745.293 189.461 KQK14071 474 287.821 25.783 32.1843 ==> ERR6145996.se.tsv <== BRADI_1g14170v3 820 BRADI_1g53295v3 11 BRADI_1g59795v3 66 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 347 BRADI_1g74790v3 37 BRADI_1g09890v3 0 BRADI_1g77505v3 43 BRADI_1g48960v3 0 ERR6145996 completed mapping pipeline successfully