Starting /dee2/code/volunteer_pipeline.sh ERR6145997 current disk space = 1542451421184 free memory = 1602371668 ERR6145997 SRAfilesize 0271fbcd3911003c97db2725f475cf5e ERR6145997.sra ERR6145997.sra file validated ERR6145997 is paired end ERR6145997 is conventional basespace ERR6145997 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145997_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.34825 35.0 35.0 35.0 35.0 35.0 2 34.59925 35.0 35.0 35.0 35.0 35.0 3 34.59575 35.0 35.0 35.0 34.0 35.0 4 34.55825 35.0 35.0 35.0 34.0 35.0 5 34.49525 35.0 35.0 35.0 34.0 35.0 6 39.2055 40.0 40.0 40.0 39.0 40.0 7 39.242 40.0 40.0 40.0 39.0 40.0 8 39.20175 40.0 40.0 40.0 39.0 40.0 9 39.182 40.0 40.0 40.0 39.0 40.0 10 39.26075 40.0 40.0 40.0 39.0 40.0 11 39.21825 40.0 40.0 40.0 39.0 40.0 12 39.13725 40.0 40.0 40.0 38.0 40.0 13 39.14125 40.0 40.0 40.0 39.0 40.0 14 39.1955 40.0 40.0 40.0 39.0 40.0 15 39.1825 40.0 40.0 40.0 39.0 40.0 16 39.15375 40.0 40.0 40.0 39.0 40.0 17 39.168 40.0 40.0 40.0 38.0 40.0 18 39.13225 40.0 40.0 40.0 38.0 40.0 19 39.12375 40.0 40.0 40.0 38.0 40.0 20 39.04675 40.0 40.0 40.0 38.0 40.0 21 39.12975 40.0 40.0 40.0 38.0 40.0 22 39.15175 40.0 40.0 40.0 39.0 40.0 23 39.14 40.0 40.0 40.0 38.0 40.0 24 39.0645 40.0 40.0 40.0 38.0 40.0 25 39.14825 40.0 40.0 40.0 38.0 40.0 26 39.104 40.0 40.0 40.0 38.0 40.0 27 39.1595 40.0 40.0 40.0 38.0 40.0 28 39.10675 40.0 40.0 40.0 38.0 40.0 29 39.10425 40.0 40.0 40.0 38.0 40.0 30 39.09025 40.0 40.0 40.0 38.0 40.0 31 39.111 40.0 40.0 40.0 38.0 40.0 32 39.072 40.0 40.0 40.0 38.0 40.0 33 39.1215 40.0 40.0 40.0 38.0 40.0 34 39.0845 40.0 40.0 40.0 38.0 40.0 35 39.07875 40.0 40.0 40.0 38.0 40.0 36 39.048 40.0 40.0 40.0 38.0 40.0 37 39.11475 40.0 40.0 40.0 38.0 40.0 38 39.07475 40.0 40.0 40.0 38.0 40.0 39 39.123 40.0 40.0 40.0 38.0 40.0 40 39.063 40.0 40.0 40.0 38.0 40.0 41 39.0895 40.0 40.0 40.0 38.0 40.0 42 39.1615 40.0 40.0 40.0 38.0 40.0 43 39.1015 40.0 40.0 40.0 39.0 40.0 44 39.07075 40.0 40.0 40.0 38.0 40.0 45 39.097 40.0 40.0 40.0 38.0 40.0 46 39.1485 40.0 40.0 40.0 38.0 40.0 47 39.121 40.0 40.0 40.0 39.0 40.0 48 39.1 40.0 40.0 40.0 38.0 40.0 49 39.139 40.0 40.0 40.0 38.0 40.0 50 39.08225 40.0 40.0 40.0 38.0 40.0 51 39.11425 40.0 40.0 40.0 38.0 40.0 52 39.06775 40.0 40.0 40.0 38.0 40.0 53 39.1455 40.0 40.0 40.0 38.0 40.0 54 39.0415 40.0 40.0 40.0 38.0 40.0 55 39.051 40.0 40.0 40.0 38.0 40.0 56 39.05725 40.0 40.0 40.0 38.0 40.0 57 39.119 40.0 40.0 40.0 39.0 40.0 58 38.96625 40.0 40.0 40.0 38.0 40.0 59 39.00225 40.0 40.0 40.0 38.0 40.0 60 39.1155 40.0 40.0 40.0 38.0 40.0 61 38.977 40.0 40.0 40.0 38.0 40.0 62 39.02675 40.0 40.0 40.0 38.0 40.0 63 39.05475 40.0 40.0 40.0 38.0 40.0 64 39.05525 40.0 40.0 40.0 38.0 40.0 65 39.06775 40.0 40.0 40.0 38.0 40.0 66 39.1005 40.0 40.0 40.0 38.0 40.0 67 39.09 40.0 40.0 40.0 38.0 40.0 68 39.03625 40.0 40.0 40.0 38.0 40.0 69 38.93675 40.0 40.0 40.0 38.0 40.0 70 38.993 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 7.0 26 6.0 27 11.0 28 13.0 29 28.0 30 23.0 31 29.0 32 36.0 33 58.0 34 54.0 35 78.0 36 78.0 37 119.0 38 273.0 39 3185.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.72768532526475 12.405446293494705 16.38930912758447 41.477559253656075 2 22.475 13.075000000000001 29.675 34.775 3 21.05 19.975 23.549999999999997 35.425000000000004 4 26.05 24.5 22.625 26.825 5 24.474999999999998 30.65 25.0 19.875 6 19.775000000000002 28.199999999999996 29.049999999999997 22.975 7 20.75 23.35 32.175 23.724999999999998 8 20.225 21.325 32.025 26.424999999999997 9 20.95 24.95 30.8 23.3 10 25.05 27.950000000000003 23.400000000000002 23.599999999999998 11 25.624999999999996 21.825 24.05 28.499999999999996 12 23.7 22.15 26.5 27.650000000000002 13 23.7 24.325 26.200000000000003 25.775 14 23.925 24.125 26.25 25.7 15 22.375 24.575 26.200000000000003 26.85 16 24.65 24.15 23.35 27.85 17 23.5 24.25 25.575 26.674999999999997 18 23.724999999999998 24.375 24.65 27.250000000000004 19 25.650000000000002 23.65 24.2 26.5 20 23.775 24.474999999999998 26.85 24.9 21 24.2 24.349999999999998 25.674999999999997 25.775 22 24.349999999999998 23.775 24.375 27.500000000000004 23 24.15 24.6 25.4 25.85 24 23.3 23.849999999999998 25.7 27.150000000000002 25 23.599999999999998 24.05 24.575 27.775 26 24.25 25.35 25.724999999999998 24.675 27 24.25 23.974999999999998 26.25 25.525 28 23.724999999999998 24.825 24.0 27.450000000000003 29 24.8 24.5 24.8 25.900000000000002 30 22.900000000000002 23.200000000000003 27.450000000000003 26.450000000000003 31 23.849999999999998 25.424999999999997 24.175 26.55 32 23.175 25.25 25.55 26.025 33 24.474999999999998 24.25 25.324999999999996 25.95 34 25.074999999999996 24.825 24.45 25.650000000000002 35 23.875 24.224999999999998 24.925 26.974999999999998 36 22.725 23.375 25.75 28.15 37 24.975 23.875 23.875 27.275 38 24.15 24.325 23.799999999999997 27.725 39 23.200000000000003 24.15 25.5 27.150000000000002 40 25.75 23.625 24.099999999999998 26.525 41 25.474999999999998 24.775 24.05 25.7 42 23.05 24.575 24.875 27.500000000000004 43 23.75 24.6 24.55 27.1 44 23.9 23.275000000000002 26.375 26.450000000000003 45 23.3 24.775 24.65 27.275 46 25.374999999999996 23.9 23.849999999999998 26.875 47 23.325000000000003 23.825 26.55 26.3 48 23.775 23.575 25.074999999999996 27.575 49 24.6 24.8 22.525000000000002 28.075 50 23.799999999999997 25.124999999999996 24.925 26.150000000000002 51 22.8 24.5 25.55 27.150000000000002 52 24.099999999999998 23.974999999999998 25.074999999999996 26.85 53 24.5 25.374999999999996 24.425 25.7 54 23.05 25.074999999999996 23.575 28.299999999999997 55 24.125 25.0 24.325 26.55 56 24.825 24.0 24.15 27.025 57 23.95 24.25 24.85 26.950000000000003 58 25.2 24.325 23.3 27.175 59 24.175 24.4 25.924999999999997 25.5 60 23.680920230057513 24.48112028007002 23.93098274568642 27.906976744186046 61 24.81240620310155 23.311655827913956 24.512256128064035 27.363681840920464 62 23.88694347173587 24.562281140570285 25.76288144072036 25.78789394697349 63 23.51175587793897 24.187093546773387 25.68784392196098 26.613306653326664 64 25.437718859429715 24.637318659329665 23.28664332166083 26.638319159579787 65 24.993745308981737 23.44258193645234 25.243932949712285 26.319739804853644 66 23.940837302582104 23.539734269240412 24.617698671346204 27.901729756831283 67 25.4911838790932 23.95465994962217 23.90428211586902 26.64987405541562 68 24.032795285677683 22.982321291314374 25.77504483730464 27.209838585703306 69 23.87399834208345 19.56341530809616 26.25034539928157 30.312240950538822 70 25.34120250829952 0.0 35.780154924382146 38.87864256731833 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 4.0 28 5.5 29 10.0 30 13.0 31 12.5 32 24.0 33 36.0 34 36.5 35 53.0 36 77.0 37 85.0 38 105.5 39 135.5 40 145.0 41 177.5 42 226.0 43 242.0 44 250.0 45 261.5 46 255.5 47 246.0 48 238.5 49 240.5 50 250.0 51 218.5 52 197.5 53 208.0 54 182.0 55 164.5 56 152.0 57 131.0 58 124.5 59 105.5 60 93.0 61 104.5 62 106.5 63 97.0 64 93.0 65 86.5 66 79.0 67 74.0 68 68.0 69 57.5 70 53.0 71 47.0 72 32.0 73 23.0 74 23.5 75 18.0 76 9.5 77 7.0 78 7.0 79 6.0 80 5.0 81 3.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.05 62 0.05 63 0.05 64 0.05 65 0.075 66 0.27499999999999997 67 0.75 68 2.4250000000000003 69 9.525 70 32.225 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6145997 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145997_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.9495 35.0 35.0 35.0 31.0 35.0 2 33.6075 35.0 35.0 35.0 31.0 35.0 3 33.45875 35.0 35.0 35.0 31.0 35.0 4 33.3965 35.0 34.0 35.0 31.0 35.0 5 33.26075 35.0 34.0 35.0 31.0 35.0 6 37.93225 40.0 39.0 40.0 34.0 40.0 7 37.76175 40.0 39.0 40.0 34.0 40.0 8 37.931 40.0 39.0 40.0 34.0 40.0 9 37.924 40.0 39.0 40.0 34.0 40.0 10 37.884 40.0 39.0 40.0 34.0 40.0 11 37.8125 40.0 39.0 40.0 34.0 40.0 12 38.00725 40.0 39.0 40.0 34.0 40.0 13 37.95525 40.0 39.0 40.0 34.0 40.0 14 37.9565 40.0 39.0 40.0 34.0 40.0 15 38.0285 40.0 39.0 40.0 34.0 40.0 16 37.9475 40.0 39.0 40.0 34.0 40.0 17 37.9835 40.0 39.0 40.0 34.0 40.0 18 37.94675 40.0 39.0 40.0 34.0 40.0 19 38.01175 40.0 39.0 40.0 34.0 40.0 20 37.8935 40.0 39.0 40.0 34.0 40.0 21 37.934 40.0 39.0 40.0 34.0 40.0 22 37.9 40.0 39.0 40.0 34.0 40.0 23 37.94325 40.0 39.0 40.0 34.0 40.0 24 37.931 40.0 39.0 40.0 34.0 40.0 25 37.999 40.0 39.0 40.0 34.0 40.0 26 37.99825 40.0 39.0 40.0 34.0 40.0 27 37.98975 40.0 39.0 40.0 34.0 40.0 28 37.946 40.0 39.0 40.0 34.0 40.0 29 37.91175 40.0 39.0 40.0 34.0 40.0 30 37.9115 40.0 39.0 40.0 34.0 40.0 31 37.92075 40.0 39.0 40.0 34.0 40.0 32 37.9025 40.0 39.0 40.0 34.0 40.0 33 37.99 40.0 39.0 40.0 34.0 40.0 34 37.91275 40.0 39.0 40.0 34.0 40.0 35 37.95325 40.0 39.0 40.0 34.0 40.0 36 37.7755 40.0 39.0 40.0 34.0 40.0 37 37.825 40.0 39.0 40.0 34.0 40.0 38 37.81175 40.0 39.0 40.0 34.0 40.0 39 37.78 40.0 39.0 40.0 34.0 40.0 40 37.7925 40.0 39.0 40.0 34.0 40.0 41 37.802 40.0 39.0 40.0 34.0 40.0 42 37.70475 40.0 39.0 40.0 34.0 40.0 43 37.86275 40.0 39.0 40.0 34.0 40.0 44 37.9505 40.0 39.0 40.0 34.0 40.0 45 37.853 40.0 39.0 40.0 34.0 40.0 46 37.8695 40.0 39.0 40.0 34.0 40.0 47 37.7035 40.0 39.0 40.0 34.0 40.0 48 37.75525 40.0 39.0 40.0 34.0 40.0 49 37.76125 40.0 39.0 40.0 34.0 40.0 50 37.78525 40.0 39.0 40.0 34.0 40.0 51 37.7455 40.0 39.0 40.0 34.0 40.0 52 37.676 40.0 39.0 40.0 34.0 40.0 53 37.64175 40.0 39.0 40.0 31.0 40.0 54 37.636 40.0 39.0 40.0 31.0 40.0 55 37.6995 40.0 39.0 40.0 34.0 40.0 56 37.67625 40.0 39.0 40.0 34.0 40.0 57 37.696 40.0 39.0 40.0 34.0 40.0 58 37.75875 40.0 39.0 40.0 34.0 40.0 59 37.73375 40.0 39.0 40.0 34.0 40.0 60 37.71825 40.0 39.0 40.0 34.0 40.0 61 37.7915 40.0 39.0 40.0 34.0 40.0 62 37.773 40.0 39.0 40.0 34.0 40.0 63 37.68275 40.0 39.0 40.0 34.0 40.0 64 37.70675 40.0 39.0 40.0 34.0 40.0 65 37.778 40.0 39.0 40.0 34.0 40.0 66 37.77975 40.0 39.0 40.0 34.0 40.0 67 37.63325 40.0 39.0 40.0 34.0 40.0 68 37.72625 40.0 39.0 40.0 34.0 40.0 69 37.62375 40.0 39.0 40.0 31.0 40.0 70 37.71425 40.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 8.0 18 13.0 19 22.0 20 38.0 21 35.0 22 28.0 23 36.0 24 35.0 25 27.0 26 30.0 27 28.0 28 32.0 29 40.0 30 35.0 31 33.0 32 26.0 33 40.0 34 65.0 35 63.0 36 61.0 37 152.0 38 269.0 39 2884.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.749999999999996 20.5 19.35 31.4 2 28.425 25.75 23.45 22.375 3 22.225 26.05 26.325 25.4 4 25.424999999999997 30.525000000000002 20.875 23.175 5 25.674999999999997 31.8 21.05 21.475 6 22.75 27.6 24.25 25.4 7 25.775 18.8 29.45 25.974999999999998 8 22.7 22.6 26.674999999999997 28.025 9 23.05 25.3 25.7 25.95 10 26.75 26.674999999999997 20.0 26.575 11 27.325 22.825 21.4 28.449999999999996 12 26.575 21.8 23.1 28.525 13 26.224999999999998 23.35 24.075 26.35 14 27.1 24.05 23.1 25.75 15 25.825 25.025 23.225 25.924999999999997 16 26.85 24.6 23.05 25.5 17 26.325 23.65 22.975 27.05 18 25.424999999999997 25.1 21.975 27.500000000000004 19 26.8 24.425 22.925 25.85 20 26.200000000000003 25.0 22.925 25.874999999999996 21 25.85 24.85 23.25 26.05 22 26.075 24.224999999999998 24.224999999999998 25.474999999999998 23 27.250000000000004 24.875 22.225 25.650000000000002 24 24.45 26.325 24.525 24.7 25 26.75 25.35 22.3 25.6 26 27.35 23.799999999999997 23.525 25.324999999999996 27 25.874999999999996 24.675 24.3 25.15 28 25.650000000000002 25.05 23.225 26.075 29 25.974999999999998 23.225 23.625 27.175 30 25.275 24.6 24.425 25.7 31 27.750000000000004 22.775000000000002 24.15 25.324999999999996 32 27.474999999999998 24.925 22.8 24.8 33 24.925 25.624999999999996 24.65 24.8 34 26.3 24.15 23.35 26.200000000000003 35 26.3 24.325 22.8 26.575 36 25.85 24.375 23.925 25.85 37 26.85 24.625 23.075000000000003 25.45 38 26.424999999999997 24.65 23.75 25.174999999999997 39 26.1 24.65 22.475 26.775 40 27.224999999999998 22.900000000000002 23.025000000000002 26.85 41 26.974999999999998 23.849999999999998 22.925 26.25 42 26.775 25.374999999999996 23.474999999999998 24.375 43 26.25 26.05 22.875 24.825 44 26.0 25.224999999999998 23.425 25.35 45 26.974999999999998 24.425 24.5 24.099999999999998 46 28.275 22.8 22.875 26.05 47 28.15 23.200000000000003 23.150000000000002 25.5 48 25.224999999999998 25.874999999999996 23.674999999999997 25.224999999999998 49 25.75 24.099999999999998 23.549999999999997 26.6 50 26.775 24.375 22.675 26.174999999999997 51 25.55 25.55 24.95 23.95 52 26.700000000000003 24.075 23.5 25.724999999999998 53 27.825 24.05 24.125 24.0 54 25.825 24.325 24.725 25.124999999999996 55 27.025 24.125 23.549999999999997 25.3 56 27.425 24.075 23.674999999999997 24.825 57 25.775 25.3 24.099999999999998 24.825 58 25.7 23.275000000000002 24.125 26.900000000000002 59 25.924999999999997 25.4 23.575 25.1 60 26.581645411352838 24.20605151287822 24.8062015503876 24.406101525381345 61 27.745809357017766 23.892919689767325 23.34250688016012 25.01876407305479 62 27.445584188141105 23.267450587940957 23.517638228671505 25.769326995246434 63 25.969477107830873 24.36827620715537 23.46760070052539 26.194645984488368 64 26.54490868151113 25.04378283712785 24.218163622717036 24.193144858643983 65 27.57757757757758 25.025025025025027 22.67267267267267 24.724724724724727 66 25.288220551378448 24.962406015037594 24.962406015037594 24.786967418546364 67 27.050830397584296 23.855057876195268 24.05636638147962 25.037745344740813 68 28.413473900745696 22.782206222679353 23.347904345590127 25.456415530984827 69 27.539440907832823 19.955715471907002 24.74398007196236 27.760863548297817 70 28.990825688073397 0.0 34.4954128440367 36.51376146788991 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.5 26 3.0 27 4.0 28 5.5 29 7.0 30 7.0 31 11.0 32 19.5 33 24.0 34 30.0 35 42.0 36 57.0 37 66.0 38 89.5 39 136.5 40 160.0 41 174.0 42 201.5 43 215.0 44 225.5 45 233.0 46 259.5 47 289.0 48 249.0 49 216.5 50 224.0 51 212.5 52 187.0 53 173.0 54 168.0 55 153.0 56 140.0 57 137.0 58 135.0 59 125.0 60 117.0 61 117.5 62 111.0 63 104.0 64 107.0 65 107.5 66 106.0 67 107.0 68 95.5 69 80.0 70 76.0 71 59.5 72 41.5 73 40.0 74 31.5 75 18.5 76 14.0 77 14.0 78 10.5 79 5.0 80 3.0 81 2.5 82 1.5 83 1.0 84 0.5 85 0.0 86 1.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.025 61 0.075 62 0.075 63 0.075 64 0.075 65 0.1 66 0.25 67 0.65 68 2.775 69 9.675 70 31.874999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187472 spots for ERR6145997.sra Written 187472 spots for ERR6145997.sra Read 187479 spots for ERR6145997.sra Written 187479 spots for ERR6145997.sra SRR ids: ['ERR6145997.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_42459hq1 ERR6145997.sra spots: 3749447 blocks: [[1, 187472], [187473, 374944], [374945, 562416], [562417, 749888], [749889, 937360], [937361, 1124832], [1124833, 1312304], [1312305, 1499776], [1499777, 1687248], [1687249, 1874720], [1874721, 2062192], [2062193, 2249664], [2249665, 2437136], [2437137, 2624608], [2624609, 2812080], [2812081, 2999552], [2999553, 3187024], [3187025, 3374496], [3374497, 3561968], [3561969, 3749447]] ERR6145997 file size 664236 ERR6145997 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6145997 ERR6145997_1.fastq ERR6145997_2.fastq Input file: ERR6145997_1.fastq Paired file: ERR6145997_2.fastq trimmed: ERR6145997-trimmed-pair1.fastq, ERR6145997-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:28:41 2024 >> started Sat Dec 7 15:28:44 2024 >> done (3.234s) 3749447 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 19 ( 0.00%) empty read pairs filtered out after trimming by size control 3749428 (100.00%) read pairs available; of these: 5 ( 0.00%) trimmed read pairs available after processing 3749423 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 69 5 0.00% 70 3749423 100.00% 3749428 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=37 prefix-density=0.09 prefix-fanout=2.6 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=590.18 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=35.3 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=116.87 fanout-score-rank=16 prefix-density=1.18 prefix-fanout=18.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=35 fanout-score=504.07 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=16.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGC ERR6145997 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:29:19 Started mapping on | Dec 07 15:29:19 Finished on | Dec 07 15:29:31 Mapping speed, Million of reads per hour | 1124.83 Number of input reads | 3749428 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3556999 Uniquely mapped reads % | 94.87% Average mapped length | 138.74 Number of splices: Total | 1821232 Number of splices: Annotated (sjdb) | 1723973 Number of splices: GT/AG | 1796851 Number of splices: GC/AG | 21713 Number of splices: AT/AC | 1318 Number of splices: Non-canonical | 1350 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 54654 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 4732 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.23% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 137775 137775 137775 N_multimapping 54654 54654 54654 N_noFeature 72294 3486150 92093 N_ambiguous 57923 316 7057 UnstrandedReadsAssigned:3426782 PositiveStrandReadsAssigned:70533 NegativeStrandReadsAssigned:3457849 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6145997 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6145997-trimmed-pair1.fastq ERR6145997-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,749,428 reads, 3,578,063 reads pseudoaligned [quant] estimated average fragment length: 195.704 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52973 ERR6145997.ke.tsv 35125 ERR6145997.se.tsv 88098 total ==> ERR6145997.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.629 5.81024 3.25276 PNS24247 1044 849.296 7.88821 3.85624 PNS24249 1928 1733.3 22.2906 5.3394 PNS24246 1044 849.296 7.88821 3.85624 PNS24248 1044 849.296 7.88821 3.85624 PNS24244 1471 1276.3 29.2346 9.5102 PNS24243 293 119.688 0 0 KQK14069 1603 1408.3 369.54 108.946 KQK14071 474 283.936 13.3282 19.4892 ==> ERR6145997.se.tsv <== BRADI_1g14170v3 419 BRADI_1g53295v3 9 BRADI_1g59795v3 54 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 353 BRADI_1g74790v3 36 BRADI_1g09890v3 0 BRADI_1g77505v3 30 BRADI_1g48960v3 0 ERR6145997 completed mapping pipeline successfully