Starting /dee2/code/volunteer_pipeline.sh ERR6145998 current disk space = 1542438629376 free memory = 1601027884 ERR6145998 SRAfilesize 073c549d63760bee4aff6747d40c3681 ERR6145998.sra ERR6145998.sra file validated ERR6145998 is paired end ERR6145998 is conventional basespace ERR6145998 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145998_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.505 35.0 35.0 35.0 35.0 35.0 2 34.602 35.0 35.0 35.0 35.0 35.0 3 34.634 35.0 35.0 35.0 35.0 35.0 4 34.588 35.0 35.0 35.0 34.0 35.0 5 34.60125 35.0 35.0 35.0 34.0 35.0 6 39.298 40.0 40.0 40.0 39.0 40.0 7 39.256 40.0 40.0 40.0 39.0 40.0 8 39.20825 40.0 40.0 40.0 39.0 40.0 9 39.21775 40.0 40.0 40.0 39.0 40.0 10 39.27575 40.0 40.0 40.0 39.0 40.0 11 39.235 40.0 40.0 40.0 39.0 40.0 12 39.24775 40.0 40.0 40.0 39.0 40.0 13 39.212 40.0 40.0 40.0 39.0 40.0 14 39.265 40.0 40.0 40.0 39.0 40.0 15 39.25125 40.0 40.0 40.0 39.0 40.0 16 39.2025 40.0 40.0 40.0 38.0 40.0 17 39.1325 40.0 40.0 40.0 39.0 40.0 18 39.177 40.0 40.0 40.0 39.0 40.0 19 39.23675 40.0 40.0 40.0 39.0 40.0 20 39.22175 40.0 40.0 40.0 39.0 40.0 21 39.19725 40.0 40.0 40.0 39.0 40.0 22 39.20575 40.0 40.0 40.0 39.0 40.0 23 39.182 40.0 40.0 40.0 39.0 40.0 24 39.14 40.0 40.0 40.0 38.0 40.0 25 39.1815 40.0 40.0 40.0 39.0 40.0 26 39.17025 40.0 40.0 40.0 39.0 40.0 27 39.139 40.0 40.0 40.0 38.0 40.0 28 39.18 40.0 40.0 40.0 38.0 40.0 29 39.1345 40.0 40.0 40.0 38.0 40.0 30 39.13975 40.0 40.0 40.0 38.0 40.0 31 39.117 40.0 40.0 40.0 39.0 40.0 32 39.18925 40.0 40.0 40.0 39.0 40.0 33 39.1715 40.0 40.0 40.0 39.0 40.0 34 39.17325 40.0 40.0 40.0 39.0 40.0 35 39.23625 40.0 40.0 40.0 39.0 40.0 36 39.21 40.0 40.0 40.0 39.0 40.0 37 39.134 40.0 40.0 40.0 39.0 40.0 38 39.10675 40.0 40.0 40.0 38.0 40.0 39 39.01775 40.0 40.0 40.0 38.0 40.0 40 39.10925 40.0 40.0 40.0 39.0 40.0 41 39.11225 40.0 40.0 40.0 38.0 40.0 42 39.0895 40.0 40.0 40.0 39.0 40.0 43 39.1235 40.0 40.0 40.0 38.0 40.0 44 39.0935 40.0 40.0 40.0 38.0 40.0 45 39.09225 40.0 40.0 40.0 38.0 40.0 46 39.10125 40.0 40.0 40.0 38.0 40.0 47 39.03675 40.0 40.0 40.0 38.0 40.0 48 39.1095 40.0 40.0 40.0 38.0 40.0 49 39.09575 40.0 40.0 40.0 38.0 40.0 50 39.127 40.0 40.0 40.0 38.0 40.0 51 39.0505 40.0 40.0 40.0 38.0 40.0 52 39.11825 40.0 40.0 40.0 38.0 40.0 53 39.09375 40.0 40.0 40.0 38.0 40.0 54 39.1175 40.0 40.0 40.0 39.0 40.0 55 39.053 40.0 40.0 40.0 38.0 40.0 56 39.0135 40.0 40.0 40.0 38.0 40.0 57 38.947 40.0 40.0 40.0 38.0 40.0 58 39.0425 40.0 40.0 40.0 38.0 40.0 59 39.11775 40.0 40.0 40.0 38.0 40.0 60 39.07425 40.0 40.0 40.0 38.0 40.0 61 39.1015 40.0 40.0 40.0 38.0 40.0 62 39.123 40.0 40.0 40.0 38.0 40.0 63 39.125 40.0 40.0 40.0 38.0 40.0 64 39.03975 40.0 40.0 40.0 38.0 40.0 65 39.14225 40.0 40.0 40.0 38.0 40.0 66 39.0975 40.0 40.0 40.0 38.0 40.0 67 39.06825 40.0 40.0 40.0 38.0 40.0 68 39.0575 40.0 40.0 40.0 38.0 40.0 69 39.09975 40.0 40.0 40.0 39.0 40.0 70 39.04975 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 6.0 26 7.0 27 13.0 28 10.0 29 15.0 30 27.0 31 36.0 32 39.0 33 41.0 34 58.0 35 62.0 36 97.0 37 125.0 38 260.0 39 3203.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.082935410907265 12.515707464186981 16.612214124151798 40.78914300075396 2 21.155288822205552 14.253563390847713 29.182295573893473 35.408852213053265 3 22.025 19.475 24.675 33.825 4 25.7 23.95 23.65 26.700000000000003 5 24.725 29.75 25.025 20.5 6 20.825 27.375 29.375 22.425 7 20.45 23.474999999999998 33.275 22.8 8 19.225 21.775 33.4 25.6 9 21.175 23.95 31.574999999999996 23.3 10 23.674999999999997 29.225 23.075000000000003 24.025 11 24.0 22.85 24.275 28.875 12 22.15 22.75 27.05 28.050000000000004 13 23.724999999999998 24.025 26.025 26.224999999999998 14 23.5 25.074999999999996 26.3 25.124999999999996 15 23.05 23.724999999999998 26.075 27.150000000000002 16 24.325 23.3 24.3 28.075 17 22.5 26.575 25.2 25.724999999999998 18 22.7 25.974999999999998 25.275 26.05 19 25.424999999999997 24.45 23.974999999999998 26.150000000000002 20 24.075 25.1 24.95 25.874999999999996 21 24.175 24.85 25.074999999999996 25.900000000000002 22 24.3 24.125 25.4 26.174999999999997 23 22.2 25.324999999999996 24.725 27.750000000000004 24 22.175 24.05 25.525 28.249999999999996 25 24.6 24.325 25.5 25.575 26 24.175 23.825 26.05 25.95 27 24.075 23.75 25.25 26.924999999999997 28 23.875 24.05 25.275 26.8 29 23.799999999999997 25.124999999999996 25.15 25.924999999999997 30 23.275000000000002 24.7 24.95 27.075 31 24.65 24.5 24.474999999999998 26.375 32 23.875 25.15 25.85 25.124999999999996 33 22.900000000000002 24.3 25.7 27.1 34 25.05 24.125 23.275000000000002 27.55 35 23.35 24.9 25.650000000000002 26.1 36 22.8 23.7 25.05 28.449999999999996 37 24.349999999999998 23.9 25.074999999999996 26.674999999999997 38 23.674999999999997 25.25 25.55 25.525 39 24.8 23.9 24.175 27.125 40 23.905976494123532 24.056014003500874 25.081270317579396 26.9567391847962 41 24.131032758189548 24.33108277069267 24.85621405351338 26.6816704176044 42 22.705676419104776 24.33108277069267 26.456614153538382 26.506626656664167 43 23.85596399099775 25.456364091022753 25.081270317579396 25.6064016004001 44 24.10602650662666 24.356089022255563 24.756189047261813 26.78169542385596 45 23.080770192548137 23.730932733183295 25.206301575393848 27.981995498874717 46 24.406101525381345 23.705926481620406 24.731182795698924 27.156789197299325 47 23.455863965991497 24.031007751937985 25.18129532383096 27.33183295823956 48 24.056014003500874 22.05551387846962 26.056514128532132 27.831957989497376 49 24.5311327831958 24.356089022255563 24.031007751937985 27.081770442610654 50 23.980995248812203 24.981245311327832 25.406351587896975 25.63140785196299 51 24.681170292573142 25.081270317579396 23.80595148787197 26.431607901975497 52 24.15603900975244 23.1807951987997 24.756189047261813 27.906976744186046 53 23.830957739434858 24.5311327831958 25.63140785196299 26.006501625406354 54 23.280820205051263 25.056264066016503 25.23130782695674 26.431607901975497 55 24.63115778944736 24.256064016004 25.156289072268066 25.95648912228057 56 23.63090772693173 25.331332833208304 24.60615153788447 26.431607901975497 57 24.50612653163291 23.055763940985248 24.50612653163291 27.93198299574894 58 24.706176544136035 24.406101525381345 24.406101525381345 26.481620405101275 59 24.731182795698924 23.705926481620406 25.756439109777446 25.806451612903224 60 25.081270317579396 23.980995248812203 24.90622655663916 26.03150787696924 61 25.331332833208304 23.23080770192548 23.980995248812203 27.45686421605401 62 23.905976494123532 24.956239059764943 26.18154538634659 24.956239059764943 63 23.980995248812203 24.55613903475869 26.556639159789945 24.90622655663916 64 24.831207801950487 23.980995248812203 24.10602650662666 27.081770442610654 65 23.267450587940957 24.568426319739807 25.544158118588946 26.619964973730298 66 24.192336589030806 23.99198597545705 25.19408965689958 26.62158777861257 67 24.030226700251887 23.727959697733 24.911838790931988 27.329974811083126 68 23.994878361075543 22.97055057618438 25.04481434058899 27.98975672215109 69 24.20066152149945 19.101433296582137 27.921719955898567 28.776185226019845 70 26.27710400588019 0.0 34.87688349871371 38.8460124954061 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 3.5 26 6.0 27 5.0 28 4.5 29 6.5 30 9.0 31 17.0 32 23.5 33 22.0 34 34.0 35 60.0 36 74.5 37 75.0 38 102.5 39 153.5 40 177.0 41 193.5 42 224.5 43 239.0 44 247.0 45 242.0 46 235.0 47 241.0 48 248.0 49 249.0 50 243.0 51 216.0 52 197.5 53 206.0 54 203.5 55 183.0 56 153.0 57 141.0 58 132.5 59 122.5 60 121.0 61 110.5 62 90.0 63 80.0 64 81.0 65 79.0 66 70.5 67 65.0 68 56.5 69 44.0 70 40.0 71 41.5 72 35.0 73 27.0 74 24.5 75 15.5 76 8.0 77 7.0 78 6.0 79 3.5 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.525 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.025 42 0.025 43 0.025 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.075 66 0.17500000000000002 67 0.75 68 2.375 69 9.3 70 31.974999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6145998 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145998_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.9575 35.0 35.0 35.0 31.0 35.0 2 33.6225 35.0 35.0 35.0 31.0 35.0 3 33.42175 35.0 35.0 35.0 31.0 35.0 4 33.40025 35.0 35.0 35.0 31.0 35.0 5 33.12725 35.0 34.0 35.0 30.0 35.0 6 37.7335 40.0 39.0 40.0 34.0 40.0 7 37.78325 40.0 39.0 40.0 34.0 40.0 8 37.618 40.0 39.0 40.0 31.0 40.0 9 37.72525 40.0 39.0 40.0 34.0 40.0 10 37.7955 40.0 39.0 40.0 34.0 40.0 11 37.8925 40.0 39.0 40.0 34.0 40.0 12 37.8225 40.0 39.0 40.0 34.0 40.0 13 37.845 40.0 39.0 40.0 34.0 40.0 14 37.73 40.0 39.0 40.0 34.0 40.0 15 37.809 40.0 39.0 40.0 34.0 40.0 16 37.7345 40.0 39.0 40.0 34.0 40.0 17 37.70925 40.0 39.0 40.0 31.0 40.0 18 37.68175 40.0 39.0 40.0 31.0 40.0 19 37.7275 40.0 39.0 40.0 34.0 40.0 20 37.7505 40.0 39.0 40.0 31.0 40.0 21 37.7535 40.0 39.0 40.0 34.0 40.0 22 37.804 40.0 39.0 40.0 34.0 40.0 23 37.76975 40.0 39.0 40.0 34.0 40.0 24 37.75075 40.0 39.0 40.0 34.0 40.0 25 37.73 40.0 39.0 40.0 34.0 40.0 26 37.7725 40.0 39.0 40.0 34.0 40.0 27 37.73325 40.0 39.0 40.0 34.0 40.0 28 37.716 40.0 39.0 40.0 34.0 40.0 29 37.71575 40.0 39.0 40.0 34.0 40.0 30 37.715 40.0 39.0 40.0 31.0 40.0 31 37.67025 40.0 39.0 40.0 31.0 40.0 32 37.73325 40.0 39.0 40.0 34.0 40.0 33 37.8025 40.0 39.0 40.0 34.0 40.0 34 37.7345 40.0 39.0 40.0 34.0 40.0 35 37.6925 40.0 39.0 40.0 34.0 40.0 36 37.73 40.0 39.0 40.0 34.0 40.0 37 37.66375 40.0 39.0 40.0 31.0 40.0 38 37.80075 40.0 39.0 40.0 34.0 40.0 39 37.6265 40.0 39.0 40.0 31.0 40.0 40 37.72775 40.0 39.0 40.0 34.0 40.0 41 37.71 40.0 39.0 40.0 34.0 40.0 42 37.719 40.0 39.0 40.0 34.0 40.0 43 37.56975 40.0 39.0 40.0 31.0 40.0 44 37.53625 40.0 39.0 40.0 31.0 40.0 45 37.6215 40.0 39.0 40.0 31.0 40.0 46 37.651 40.0 39.0 40.0 34.0 40.0 47 37.67375 40.0 39.0 40.0 31.0 40.0 48 37.65025 40.0 39.0 40.0 34.0 40.0 49 37.6995 40.0 39.0 40.0 34.0 40.0 50 37.60925 40.0 39.0 40.0 31.0 40.0 51 37.716 40.0 39.0 40.0 34.0 40.0 52 37.6995 40.0 39.0 40.0 31.0 40.0 53 37.56525 40.0 39.0 40.0 31.0 40.0 54 37.63225 40.0 39.0 40.0 31.0 40.0 55 37.682 40.0 39.0 40.0 34.0 40.0 56 37.65975 40.0 39.0 40.0 34.0 40.0 57 37.56025 40.0 39.0 40.0 31.0 40.0 58 37.56425 40.0 39.0 40.0 31.0 40.0 59 37.47475 40.0 39.0 40.0 31.0 40.0 60 37.53175 40.0 39.0 40.0 31.0 40.0 61 37.70475 40.0 39.0 40.0 34.0 40.0 62 37.6225 40.0 39.0 40.0 31.0 40.0 63 37.57475 40.0 39.0 40.0 31.0 40.0 64 37.5705 40.0 39.0 40.0 31.0 40.0 65 37.53775 40.0 39.0 40.0 30.0 40.0 66 37.58575 40.0 39.0 40.0 31.0 40.0 67 37.5535 40.0 39.0 40.0 31.0 40.0 68 37.60975 40.0 39.0 40.0 31.0 40.0 69 37.608 40.0 39.0 40.0 31.0 40.0 70 37.56675 40.0 39.0 40.0 31.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 5.0 18 20.0 19 39.0 20 33.0 21 42.0 22 38.0 23 37.0 24 31.0 25 39.0 26 39.0 27 22.0 28 35.0 29 26.0 30 22.0 31 36.0 32 34.0 33 34.0 34 57.0 35 70.0 36 71.0 37 114.0 38 253.0 39 2901.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.325 20.9 21.025 30.75 2 28.675 23.875 23.825 23.625 3 21.625 26.35 25.25 26.775 4 25.35 29.225 22.3 23.125 5 25.0 31.574999999999996 21.65 21.775 6 22.48062015503876 27.38184546136534 25.03125781445361 25.10627656914228 7 25.674999999999997 19.55 29.049999999999997 25.724999999999998 8 23.9 21.825 25.35 28.925 9 23.325000000000003 24.55 25.474999999999998 26.650000000000002 10 26.700000000000003 26.375 21.0 25.924999999999997 11 28.575 21.775 20.325 29.325000000000003 12 27.1 20.474999999999998 23.925 28.499999999999996 13 26.875 22.95 23.674999999999997 26.5 14 24.65 25.1 24.125 26.125 15 25.775 24.075 23.425 26.724999999999998 16 27.575 23.549999999999997 23.05 25.825 17 27.875 23.45 22.2 26.474999999999998 18 26.8 24.8 22.475 25.924999999999997 19 26.6 25.8 22.125 25.474999999999998 20 27.625 25.25 22.175 24.95 21 25.6 25.2 23.5 25.7 22 25.775 24.325 24.099999999999998 25.8 23 25.5 24.224999999999998 24.125 26.150000000000002 24 25.900000000000002 24.05 23.599999999999998 26.450000000000003 25 26.674999999999997 23.525 23.575 26.224999999999998 26 26.400000000000002 25.275 23.474999999999998 24.85 27 25.924999999999997 24.2 24.474999999999998 25.4 28 25.8 24.675 23.674999999999997 25.85 29 27.125 24.275 23.7 24.9 30 26.375 24.85 23.125 25.650000000000002 31 26.700000000000003 24.975 22.575 25.75 32 27.025 24.0 24.125 24.85 33 26.55 25.624999999999996 22.825 25.0 34 27.625 24.125 22.725 25.525 35 27.325 23.974999999999998 23.325000000000003 25.374999999999996 36 26.450000000000003 23.674999999999997 24.0 25.874999999999996 37 25.874999999999996 24.675 22.15 27.3 38 28.15 25.224999999999998 21.65 24.975 39 26.0 24.6 23.525 25.874999999999996 40 25.506376594148538 25.256314078519633 24.281070267566893 24.956239059764943 41 27.231807951987996 24.406101525381345 22.95573893473368 25.406351587896975 42 26.206551637909474 24.656164041010253 23.605901475368842 25.531382845711427 43 26.6816704176044 24.5311327831958 22.655663915978995 26.131532883220803 44 27.581895473868467 24.981245311327832 22.9057264316079 24.5311327831958 45 25.506376594148538 24.55613903475869 23.830957739434858 26.106526631657918 46 26.281570392598148 24.431107776944234 24.981245311327832 24.306076519129782 47 27.081770442610654 25.081270317579396 25.006251562890725 22.83070767691923 48 27.38184546136534 23.605901475368842 23.830957739434858 25.18129532383096 49 25.98149537384346 25.056264066016503 23.20580145036259 25.756439109777446 50 26.93173293323331 25.581395348837212 22.930732683170792 24.55613903475869 51 27.28182045511378 24.081020255063766 24.381095273818453 24.256064016004 52 27.28182045511378 24.056014003500874 23.10577644411103 25.55638909727432 53 26.581645411352838 25.831457864466117 23.58089522380595 24.006001500375092 54 26.831707926981746 24.50612653163291 23.655913978494624 25.006251562890725 55 25.93148287071768 24.281070267566893 23.93098274568642 25.85646411602901 56 27.231807951987996 24.781195298824706 23.380845211302827 24.60615153788447 57 27.28182045511378 24.5311327831958 22.83070767691923 25.35633908477119 58 26.406601650412604 23.93098274568642 23.080770192548137 26.581645411352838 59 25.55638909727432 25.28132033008252 24.23105776444111 24.93123280820205 60 26.65666416604151 24.88122030507627 23.15578894723681 25.30632658164541 61 26.881720430107524 23.85596399099775 23.680920230057513 25.581395348837212 62 26.78169542385596 23.85596399099775 24.006001500375092 25.35633908477119 63 25.731432858214554 24.731182795698924 24.056014003500874 25.481370342585645 64 27.68192048012003 24.256064016004 23.20580145036259 24.85621405351338 65 27.72079059294471 25.494120590442833 23.592694520890667 23.19239429572179 66 27.29553437029604 25.33868539889614 22.854992473657802 24.510787757150023 67 27.103274559193956 23.224181360201513 24.231738035264485 25.440806045340054 68 27.61635381846233 23.142195937258936 24.093597325790693 25.147852918488045 69 27.616926503340757 18.624721603563472 26.141425389755014 27.616926503340757 70 28.53965900667161 0.0 34.87768717568569 36.582653817642694 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.5 22 0.5 23 0.0 24 0.5 25 2.5 26 3.0 27 2.0 28 3.5 29 4.0 30 3.0 31 10.0 32 20.5 33 24.0 34 28.0 35 43.0 36 65.5 37 77.0 38 93.5 39 124.5 40 139.0 41 165.5 42 188.0 43 184.0 44 201.0 45 236.5 46 258.0 47 261.0 48 256.5 49 238.5 50 225.0 51 232.5 52 196.0 53 152.0 54 169.5 55 166.5 56 141.0 57 136.0 58 131.5 59 128.0 60 129.0 61 120.0 62 112.5 63 114.0 64 106.5 65 95.5 66 84.0 67 76.0 68 78.5 69 77.0 70 73.0 71 59.0 72 45.0 73 45.0 74 39.5 75 27.0 76 16.5 77 13.0 78 11.5 79 7.5 80 5.0 81 3.5 82 1.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.025 42 0.025 43 0.025 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.075 66 0.35000000000000003 67 0.75 68 2.775 69 10.2 70 32.550000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190925 spots for ERR6145998.sra Written 190925 spots for ERR6145998.sra Read 190942 spots for ERR6145998.sra Written 190942 spots for ERR6145998.sra SRR ids: ['ERR6145998.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w2red8rh ERR6145998.sra spots: 3818517 blocks: [[1, 190925], [190926, 381850], [381851, 572775], [572776, 763700], [763701, 954625], [954626, 1145550], [1145551, 1336475], [1336476, 1527400], [1527401, 1718325], [1718326, 1909250], [1909251, 2100175], [2100176, 2291100], [2291101, 2482025], [2482026, 2672950], [2672951, 2863875], [2863876, 3054800], [3054801, 3245725], [3245726, 3436650], [3436651, 3627575], [3627576, 3818517]] ERR6145998 file size 676512 ERR6145998 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6145998 ERR6145998_1.fastq ERR6145998_2.fastq Input file: ERR6145998_1.fastq Paired file: ERR6145998_2.fastq trimmed: ERR6145998-trimmed-pair1.fastq, ERR6145998-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:29:23 2024 >> started Sat Dec 7 15:29:26 2024 >> done (2.880s) 3818517 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 17 ( 0.00%) empty read pairs filtered out after trimming by size control 3818500 (100.00%) read pairs available; of these: 24 ( 0.00%) trimmed read pairs available after processing 3818476 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 3 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 19 0.00% 70 3818476 100.00% 3818500 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=37 prefix-density=0.09 prefix-fanout=2.5 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=556.39 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=33.9 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=115.94 fanout-score-rank=15 prefix-density=1.15 prefix-fanout=18.0 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=467.00 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=15.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGC ERR6145998 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:29:59 Started mapping on | Dec 07 15:30:00 Finished on | Dec 07 15:30:13 Mapping speed, Million of reads per hour | 1057.43 Number of input reads | 3818500 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3617263 Uniquely mapped reads % | 94.73% Average mapped length | 138.72 Number of splices: Total | 1852555 Number of splices: Annotated (sjdb) | 1754774 Number of splices: GT/AG | 1827554 Number of splices: GC/AG | 22157 Number of splices: AT/AC | 1371 Number of splices: Non-canonical | 1473 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 55480 % of reads mapped to multiple loci | 1.45% Number of reads mapped to too many loci | 4760 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 145757 145757 145757 N_multimapping 55480 55480 55480 N_noFeature 73871 3545899 93857 N_ambiguous 58535 347 7331 UnstrandedReadsAssigned:3484857 PositiveStrandReadsAssigned:71017 NegativeStrandReadsAssigned:3516075 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6145998 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6145998-trimmed-pair1.fastq ERR6145998-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,818,500 reads, 3,643,730 reads pseudoaligned [quant] estimated average fragment length: 195.527 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52973 ERR6145998.ke.tsv 35125 ERR6145998.se.tsv 88098 total ==> ERR6145998.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.764 0 0 PNS24247 1044 849.473 8.93908 4.29311 PNS24249 1928 1733.47 26.5748 6.25434 PNS24246 1044 849.473 8.93908 4.29311 PNS24248 1044 849.473 8.93908 4.29311 PNS24244 1471 1276.47 19.608 6.26685 PNS24243 293 119.619 0 0 KQK14069 1603 1408.47 459.068 132.971 KQK14071 474 283.916 9.65011 13.8666 ==> ERR6145998.se.tsv <== BRADI_1g14170v3 504 BRADI_1g53295v3 4 BRADI_1g59795v3 44 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 377 BRADI_1g74790v3 32 BRADI_1g09890v3 0 BRADI_1g77505v3 24 BRADI_1g48960v3 0 ERR6145998 completed mapping pipeline successfully