Starting /dee2/code/volunteer_pipeline.sh ERR6145999 current disk space = 1542402637824 free memory = 1598720036 ERR6145999 SRAfilesize 111095ed0de75cc1ab367c8299b72ac0 ERR6145999.sra ERR6145999.sra file validated ERR6145999 is paired end ERR6145999 is conventional basespace ERR6145999 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145999_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.37625 35.0 35.0 35.0 35.0 35.0 2 34.57975 35.0 35.0 35.0 35.0 35.0 3 34.59 35.0 35.0 35.0 35.0 35.0 4 34.645 35.0 35.0 35.0 35.0 35.0 5 34.6005 35.0 35.0 35.0 35.0 35.0 6 39.39775 40.0 40.0 40.0 39.0 40.0 7 39.3675 40.0 40.0 40.0 39.0 40.0 8 39.33575 40.0 40.0 40.0 39.0 40.0 9 39.323 40.0 40.0 40.0 39.0 40.0 10 39.3425 40.0 40.0 40.0 39.0 40.0 11 39.361 40.0 40.0 40.0 39.0 40.0 12 39.31625 40.0 40.0 40.0 39.0 40.0 13 39.312 40.0 40.0 40.0 39.0 40.0 14 39.33275 40.0 40.0 40.0 39.0 40.0 15 39.28 40.0 40.0 40.0 39.0 40.0 16 39.34475 40.0 40.0 40.0 39.0 40.0 17 39.3665 40.0 40.0 40.0 39.0 40.0 18 39.35925 40.0 40.0 40.0 39.0 40.0 19 39.32625 40.0 40.0 40.0 39.0 40.0 20 39.38975 40.0 40.0 40.0 39.0 40.0 21 39.386 40.0 40.0 40.0 39.0 40.0 22 39.33425 40.0 40.0 40.0 39.0 40.0 23 39.36125 40.0 40.0 40.0 39.0 40.0 24 39.2865 40.0 40.0 40.0 39.0 40.0 25 39.32025 40.0 40.0 40.0 39.0 40.0 26 39.35375 40.0 40.0 40.0 39.0 40.0 27 39.30025 40.0 40.0 40.0 39.0 40.0 28 39.2655 40.0 40.0 40.0 39.0 40.0 29 39.323 40.0 40.0 40.0 39.0 40.0 30 39.3535 40.0 40.0 40.0 39.0 40.0 31 39.317 40.0 40.0 40.0 39.0 40.0 32 39.32075 40.0 40.0 40.0 39.0 40.0 33 39.31725 40.0 40.0 40.0 39.0 40.0 34 39.253 40.0 40.0 40.0 39.0 40.0 35 39.2675 40.0 40.0 40.0 39.0 40.0 36 39.24975 40.0 40.0 40.0 39.0 40.0 37 39.29475 40.0 40.0 40.0 39.0 40.0 38 39.282 40.0 40.0 40.0 39.0 40.0 39 39.3105 40.0 40.0 40.0 39.0 40.0 40 39.382 40.0 40.0 40.0 39.0 40.0 41 39.28025 40.0 40.0 40.0 39.0 40.0 42 39.24025 40.0 40.0 40.0 39.0 40.0 43 39.27925 40.0 40.0 40.0 39.0 40.0 44 39.3335 40.0 40.0 40.0 39.0 40.0 45 39.313 40.0 40.0 40.0 39.0 40.0 46 39.32825 40.0 40.0 40.0 39.0 40.0 47 39.27275 40.0 40.0 40.0 39.0 40.0 48 39.3245 40.0 40.0 40.0 39.0 40.0 49 39.27725 40.0 40.0 40.0 39.0 40.0 50 39.25675 40.0 40.0 40.0 39.0 40.0 51 39.24125 40.0 40.0 40.0 39.0 40.0 52 39.27025 40.0 40.0 40.0 39.0 40.0 53 39.296 40.0 40.0 40.0 39.0 40.0 54 39.18925 40.0 40.0 40.0 39.0 40.0 55 39.2385 40.0 40.0 40.0 39.0 40.0 56 39.2715 40.0 40.0 40.0 39.0 40.0 57 39.25875 40.0 40.0 40.0 39.0 40.0 58 39.18775 40.0 40.0 40.0 39.0 40.0 59 39.191 40.0 40.0 40.0 39.0 40.0 60 39.252 40.0 40.0 40.0 39.0 40.0 61 39.20275 40.0 40.0 40.0 39.0 40.0 62 39.21175 40.0 40.0 40.0 39.0 40.0 63 39.28475 40.0 40.0 40.0 39.0 40.0 64 39.238 40.0 40.0 40.0 39.0 40.0 65 39.25225 40.0 40.0 40.0 39.0 40.0 66 39.202 40.0 40.0 40.0 39.0 40.0 67 39.2295 40.0 40.0 40.0 39.0 40.0 68 39.25525 40.0 40.0 40.0 39.0 40.0 69 39.22525 40.0 40.0 40.0 39.0 40.0 70 39.28175 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 5.0 26 4.0 27 8.0 28 11.0 29 13.0 30 19.0 31 22.0 32 33.0 33 27.0 34 44.0 35 59.0 36 87.0 37 112.0 38 231.0 39 3321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.017163048965166 13.37708228167592 14.109035840484605 36.49671882887431 2 25.05 16.725 28.375 29.849999999999998 3 23.075000000000003 20.75 23.95 32.225 4 24.224999999999998 26.75 22.650000000000002 26.375 5 24.975 31.175000000000004 22.45 21.4 6 21.875 27.950000000000003 27.775 22.400000000000002 7 21.15 23.275000000000002 32.775 22.8 8 20.674999999999997 22.275 29.625 27.425 9 21.325 25.174999999999997 29.275000000000002 24.224999999999998 10 23.95 30.3 21.125 24.625 11 26.150000000000002 21.625 22.225 30.0 12 24.325 22.0 26.674999999999997 27.0 13 23.05 24.075 25.7 27.175 14 24.15 24.125 25.35 26.375 15 24.099999999999998 23.674999999999997 26.275 25.95 16 23.75 24.5 24.075 27.675 17 23.1 25.4 24.975 26.525 18 23.599999999999998 25.650000000000002 24.025 26.724999999999998 19 25.424999999999997 24.325 24.175 26.075 20 23.724999999999998 25.775 25.45 25.05 21 24.8 24.224999999999998 24.95 26.025 22 24.725 24.525 25.1 25.650000000000002 23 24.8 24.7 24.675 25.825 24 24.3 24.075 24.675 26.950000000000003 25 23.275000000000002 25.6 24.3 26.825 26 24.0 25.525 23.35 27.125 27 23.200000000000003 24.675 25.674999999999997 26.450000000000003 28 23.974999999999998 22.900000000000002 25.124999999999996 28.000000000000004 29 24.125 26.1 24.224999999999998 25.55 30 24.775 23.95 24.975 26.3 31 24.15 25.374999999999996 22.875 27.6 32 24.95 23.875 25.6 25.575 33 24.075 24.125 24.6 27.200000000000003 34 23.225 26.05 24.224999999999998 26.5 35 24.349999999999998 26.55 23.674999999999997 25.424999999999997 36 23.200000000000003 24.6 25.525 26.674999999999997 37 24.275 24.15 23.75 27.825 38 25.124999999999996 24.875 24.85 25.15 39 24.15 24.125 25.2 26.525 40 24.025 24.275 24.2 27.500000000000004 41 23.275000000000002 24.725 24.65 27.35 42 23.575 24.5 24.9 27.025 43 24.75 24.575 22.775000000000002 27.900000000000002 44 25.1 23.799999999999997 25.55 25.55 45 24.775 24.224999999999998 23.724999999999998 27.275 46 24.975 23.974999999999998 24.75 26.3 47 24.6 24.474999999999998 26.150000000000002 24.775 48 24.075 23.799999999999997 24.45 27.675 49 24.525 24.275 24.175 27.025 50 24.25 24.975 24.4 26.375 51 23.775 24.725 24.85 26.650000000000002 52 24.875 23.075000000000003 25.025 27.025 53 24.4 23.674999999999997 25.650000000000002 26.275 54 24.474999999999998 23.25 24.6 27.675 55 25.35 23.625 24.075 26.950000000000003 56 24.781195298824706 24.88122030507627 24.90622655663916 25.431357839459867 57 23.85596399099775 23.655913978494624 24.90622655663916 27.581895473868467 58 25.806451612903224 25.431357839459867 23.280820205051263 25.481370342585645 59 24.60615153788447 23.85596399099775 24.60615153788447 26.93173293323331 60 22.705676419104776 24.58114528632158 25.481370342585645 27.231807951987996 61 25.206301575393848 26.406601650412604 22.405601400350086 25.98149537384346 62 25.206301575393848 24.93123280820205 23.680920230057513 26.18154538634659 63 25.156289072268066 25.056264066016503 24.031007751937985 25.756439109777446 64 25.35633908477119 23.605901475368842 24.706176544136035 26.331582895723933 65 24.93123280820205 23.830957739434858 25.03125781445361 26.206551637909474 66 23.227261338010525 25.00626409421198 24.680531195189175 27.08594337258832 67 25.84297936587821 23.175641670860596 24.257674886763965 26.723704076497235 68 25.115089514066497 23.19693094629156 24.501278772378516 27.186700767263428 69 23.862068965517242 18.537931034482757 28.386206896551723 29.21379310344828 70 26.138032305433185 0.0 35.5726872246696 38.28928046989721 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.5 25 1.0 26 0.5 27 1.0 28 5.0 29 10.5 30 12.0 31 16.5 32 21.0 33 21.0 34 29.0 35 53.0 36 79.5 37 90.0 38 112.0 39 139.0 40 144.0 41 150.5 42 193.5 43 230.0 44 236.5 45 264.5 46 279.0 47 272.0 48 254.5 49 240.0 50 243.0 51 227.0 52 203.5 53 196.0 54 188.5 55 162.0 56 139.0 57 135.0 58 137.5 59 125.0 60 110.0 61 100.0 62 86.0 63 82.0 64 92.5 65 97.0 66 83.0 67 75.0 68 67.5 69 47.0 70 34.0 71 38.0 72 40.0 73 38.0 74 27.5 75 17.5 76 16.5 77 15.0 78 8.5 79 1.5 80 1.0 81 1.5 82 2.0 83 2.0 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.22499999999999998 67 0.65 68 2.25 69 9.375 70 31.900000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6145999 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6145999_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2185 35.0 35.0 35.0 33.0 35.0 2 34.05925 35.0 35.0 35.0 33.0 35.0 3 33.75925 35.0 35.0 35.0 32.0 35.0 4 33.79 35.0 35.0 35.0 32.0 35.0 5 33.76875 35.0 35.0 35.0 31.0 35.0 6 38.257 40.0 40.0 40.0 35.0 40.0 7 38.11325 40.0 39.0 40.0 35.0 40.0 8 38.1665 40.0 39.0 40.0 35.0 40.0 9 38.21325 40.0 40.0 40.0 35.0 40.0 10 38.26675 40.0 40.0 40.0 35.0 40.0 11 38.27175 40.0 40.0 40.0 36.0 40.0 12 38.27475 40.0 40.0 40.0 36.0 40.0 13 38.25325 40.0 40.0 40.0 36.0 40.0 14 38.23225 40.0 40.0 40.0 36.0 40.0 15 38.28025 40.0 40.0 40.0 36.0 40.0 16 38.27125 40.0 40.0 40.0 35.0 40.0 17 38.22975 40.0 40.0 40.0 35.0 40.0 18 38.2875 40.0 40.0 40.0 36.0 40.0 19 38.2615 40.0 40.0 40.0 36.0 40.0 20 38.287 40.0 40.0 40.0 36.0 40.0 21 38.29425 40.0 40.0 40.0 35.0 40.0 22 38.2075 40.0 40.0 40.0 35.0 40.0 23 38.2625 40.0 40.0 40.0 36.0 40.0 24 38.28 40.0 40.0 40.0 36.0 40.0 25 38.28575 40.0 40.0 40.0 36.0 40.0 26 38.25475 40.0 40.0 40.0 35.0 40.0 27 38.1745 40.0 40.0 40.0 35.0 40.0 28 38.23875 40.0 40.0 40.0 36.0 40.0 29 38.22175 40.0 40.0 40.0 35.0 40.0 30 38.19475 40.0 40.0 40.0 35.0 40.0 31 38.20925 40.0 40.0 40.0 35.0 40.0 32 38.256 40.0 40.0 40.0 35.0 40.0 33 38.30725 40.0 40.0 40.0 36.0 40.0 34 38.18825 40.0 40.0 40.0 36.0 40.0 35 38.1635 40.0 40.0 40.0 35.0 40.0 36 38.206 40.0 40.0 40.0 35.0 40.0 37 38.17475 40.0 40.0 40.0 35.0 40.0 38 38.12825 40.0 40.0 40.0 35.0 40.0 39 38.15825 40.0 40.0 40.0 35.0 40.0 40 38.203 40.0 40.0 40.0 35.0 40.0 41 38.2295 40.0 40.0 40.0 35.0 40.0 42 38.122 40.0 40.0 40.0 35.0 40.0 43 38.16625 40.0 40.0 40.0 35.0 40.0 44 38.25875 40.0 40.0 40.0 36.0 40.0 45 38.1005 40.0 40.0 40.0 35.0 40.0 46 38.125 40.0 40.0 40.0 35.0 40.0 47 38.13275 40.0 40.0 40.0 35.0 40.0 48 37.998 40.0 39.0 40.0 34.0 40.0 49 38.067 40.0 39.0 40.0 34.0 40.0 50 38.08325 40.0 39.0 40.0 34.0 40.0 51 38.07525 40.0 39.0 40.0 35.0 40.0 52 38.04175 40.0 39.0 40.0 34.0 40.0 53 38.069 40.0 39.0 40.0 34.0 40.0 54 38.0795 40.0 39.0 40.0 34.0 40.0 55 38.07925 40.0 39.0 40.0 34.0 40.0 56 38.11375 40.0 39.0 40.0 35.0 40.0 57 38.1135 40.0 39.0 40.0 35.0 40.0 58 38.165 40.0 40.0 40.0 35.0 40.0 59 38.125 40.0 39.0 40.0 35.0 40.0 60 38.16475 40.0 39.0 40.0 35.0 40.0 61 38.084 40.0 39.0 40.0 34.0 40.0 62 38.20275 40.0 40.0 40.0 35.0 40.0 63 38.0845 40.0 39.0 40.0 34.0 40.0 64 38.0295 40.0 39.0 40.0 35.0 40.0 65 38.0935 40.0 39.0 40.0 34.0 40.0 66 38.058 40.0 39.0 40.0 35.0 40.0 67 38.1355 40.0 39.0 40.0 35.0 40.0 68 38.125 40.0 39.0 40.0 34.0 40.0 69 38.04725 40.0 39.0 40.0 35.0 40.0 70 38.06425 40.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 3.0 18 11.0 19 34.0 20 35.0 21 29.0 22 27.0 23 31.0 24 25.0 25 28.0 26 16.0 27 25.0 28 22.0 29 25.0 30 18.0 31 24.0 32 30.0 33 30.0 34 44.0 35 46.0 36 66.0 37 112.0 38 226.0 39 3091.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.324999999999996 19.400000000000002 18.025 29.25 2 29.475 25.224999999999998 22.075 23.225 3 24.075 26.424999999999997 24.775 24.725 4 26.8 29.799999999999997 19.650000000000002 23.75 5 27.375 31.874999999999996 18.8 21.95 6 23.1 27.400000000000002 25.45 24.05 7 24.625 18.05 29.825000000000003 27.500000000000004 8 23.150000000000002 22.55 24.725 29.575000000000003 9 24.925 24.925 23.799999999999997 26.35 10 26.55 27.950000000000003 20.5 25.0 11 27.35 22.225 20.974999999999998 29.45 12 27.700000000000003 21.2 22.775000000000002 28.325 13 26.224999999999998 23.65 23.275000000000002 26.85 14 27.325 23.575 23.5 25.6 15 26.474999999999998 24.15 23.075000000000003 26.3 16 28.050000000000004 23.875 22.525000000000002 25.55 17 26.325 24.825 23.150000000000002 25.7 18 26.450000000000003 24.25 22.275 27.025 19 27.35 23.625 22.900000000000002 26.125 20 26.775 23.7 23.599999999999998 25.924999999999997 21 26.224999999999998 23.599999999999998 24.3 25.874999999999996 22 26.75 24.925 23.400000000000002 24.925 23 26.1 25.374999999999996 22.275 26.25 24 26.224999999999998 23.95 23.95 25.874999999999996 25 27.0 25.025 22.075 25.900000000000002 26 26.400000000000002 25.650000000000002 21.925 26.025 27 25.15 25.05 23.9 25.900000000000002 28 28.15 24.15 22.275 25.424999999999997 29 26.224999999999998 25.7 22.875 25.2 30 25.4 25.0 23.0 26.6 31 27.1 23.9 23.974999999999998 25.025 32 27.975 24.349999999999998 23.225 24.45 33 27.175 23.925 22.6 26.3 34 25.650000000000002 23.200000000000003 23.400000000000002 27.750000000000004 35 25.724999999999998 24.9 23.325000000000003 26.05 36 26.424999999999997 25.025 22.425 26.125 37 27.375 23.474999999999998 22.825 26.325 38 27.35 23.674999999999997 23.1 25.874999999999996 39 26.474999999999998 25.124999999999996 22.725 25.674999999999997 40 28.299999999999997 22.75 23.150000000000002 25.8 41 27.750000000000004 23.200000000000003 23.724999999999998 25.324999999999996 42 26.25 23.849999999999998 24.325 25.575 43 26.424999999999997 23.5 22.825 27.250000000000004 44 27.150000000000002 23.5 22.75 26.6 45 26.575 24.15 23.875 25.4 46 27.1 24.2 23.075000000000003 25.624999999999996 47 27.075 24.7 23.375 24.85 48 26.575 25.174999999999997 23.974999999999998 24.275 49 26.6 23.7 22.45 27.250000000000004 50 26.875 24.15 22.825 26.150000000000002 51 26.025 24.85 24.275 24.85 52 27.950000000000003 24.224999999999998 22.2 25.624999999999996 53 27.05 25.2 22.625 25.124999999999996 54 26.5 24.875 23.175 25.45 55 27.700000000000003 24.125 21.349999999999998 26.825 56 27.93198299574894 25.28132033008252 22.305576394098527 24.48112028007002 57 24.88122030507627 26.081520380095025 22.83070767691923 26.206551637909474 58 27.53188297074269 24.431107776944234 22.705676419104776 25.331332833208304 59 27.781945486371594 24.20605151287822 23.030757689422355 24.981245311327832 60 25.03125781445361 24.48112028007002 25.03125781445361 25.456364091022753 61 25.962981490745374 24.637318659329665 23.486743371685844 25.912956478239117 62 26.96348174087044 25.137568784392194 23.1615807903952 24.73736868434217 63 25.237618809404704 25.812906453226613 22.661330665332667 26.28814407203602 64 27.102102102102105 25.125125125125123 23.123123123123122 24.64964964964965 65 27.334167709637047 24.080100125156445 25.281602002503128 23.30413016270338 66 27.074454750564055 23.7152168463274 24.066182000501378 25.14414640260717 67 26.764112903225808 22.933467741935484 24.39516129032258 25.90725806451613 68 26.47814910025707 22.956298200514137 24.267352185089976 26.29820051413882 69 27.244926327495133 18.876841812621628 26.383097025298863 27.495134834584377 70 29.80734278444202 0.0 34.78735005452563 35.405307161032354 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 2.0 14 1.5 15 1.0 16 1.0 17 1.0 18 1.5 19 1.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 3.0 28 5.0 29 5.0 30 3.0 31 5.5 32 14.5 33 21.0 34 22.0 35 38.0 36 53.0 37 53.0 38 73.0 39 114.5 40 136.0 41 142.5 42 168.5 43 188.0 44 197.5 45 222.0 46 243.0 47 249.0 48 250.0 49 244.5 50 238.0 51 238.0 52 215.5 53 193.0 54 186.0 55 177.5 56 166.0 57 156.0 58 152.0 59 142.5 60 137.0 61 126.5 62 125.5 63 135.0 64 120.5 65 102.5 66 90.5 67 82.0 68 76.5 69 70.5 70 70.0 71 60.5 72 47.0 73 43.0 74 36.0 75 21.0 76 10.0 77 7.0 78 9.5 79 8.0 80 4.0 81 2.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.05 62 0.05 63 0.05 64 0.1 65 0.125 66 0.27499999999999997 67 0.8 68 2.75 69 10.075000000000001 70 31.225 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197588 spots for ERR6145999.sra Written 197588 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra Read 197580 spots for ERR6145999.sra Written 197580 spots for ERR6145999.sra SRR ids: ['ERR6145999.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yzu9pquy ERR6145999.sra spots: 3951608 blocks: [[1, 197580], [197581, 395160], [395161, 592740], [592741, 790320], [790321, 987900], [987901, 1185480], [1185481, 1383060], [1383061, 1580640], [1580641, 1778220], [1778221, 1975800], [1975801, 2173380], [2173381, 2370960], [2370961, 2568540], [2568541, 2766120], [2766121, 2963700], [2963701, 3161280], [3161281, 3358860], [3358861, 3556440], [3556441, 3754020], [3754021, 3951608]] ERR6145999 file size 700167 ERR6145999 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6145999 ERR6145999_1.fastq ERR6145999_2.fastq Input file: ERR6145999_1.fastq Paired file: ERR6145999_2.fastq trimmed: ERR6145999-trimmed-pair1.fastq, ERR6145999-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:30:42 2024 >> started Sat Dec 7 15:30:46 2024 >> done (3.163s) 3951608 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 82 ( 0.00%) empty read pairs filtered out after trimming by size control 3951525 (100.00%) read pairs available; of these: 14 ( 0.00%) trimmed read pairs available after processing 3951511 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 47 1 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 12 0.00% 70 3951511 100.00% 3951525 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=41 prefix-density=0.10 prefix-fanout=2.5 sequence=ATGCCCTCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=547.72 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=34.5 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=112.24 fanout-score-rank=13 prefix-density=0.99 prefix-fanout=18.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=800.37 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=17.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGA ERR6145999 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:31:19 Started mapping on | Dec 07 15:31:19 Finished on | Dec 07 15:31:36 Mapping speed, Million of reads per hour | 836.79 Number of input reads | 3951525 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3598434 Uniquely mapped reads % | 91.06% Average mapped length | 138.74 Number of splices: Total | 1716786 Number of splices: Annotated (sjdb) | 1630007 Number of splices: GT/AG | 1693091 Number of splices: GC/AG | 20946 Number of splices: AT/AC | 1302 Number of splices: Non-canonical | 1447 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 54829 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 8598 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.72% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298262 298262 298262 N_multimapping 54829 54829 54829 N_noFeature 72341 3516534 97155 N_ambiguous 63905 282 7005 UnstrandedReadsAssigned:3462188 PositiveStrandReadsAssigned:81618 NegativeStrandReadsAssigned:3494274 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6145999 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6145999-trimmed-pair1.fastq ERR6145999-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,951,525 reads, 3,627,934 reads pseudoaligned [quant] estimated average fragment length: 183.166 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 ERR6145999.ke.tsv 35125 ERR6145999.se.tsv 88098 total ==> ERR6145999.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 754.069 25.4674 13.282 PNS24247 1044 861.834 10.6631 4.86574 PNS24249 1928 1745.83 30.1236 6.7857 PNS24246 1044 861.834 10.6631 4.86574 PNS24248 1044 861.834 10.6631 4.86574 PNS24244 1471 1288.83 21.4197 6.53591 PNS24243 293 124.462 0 0 KQK14069 1603 1420.83 563.633 156.007 KQK14071 474 294.701 27.8606 37.1791 ==> ERR6145999.se.tsv <== BRADI_1g14170v3 608 BRADI_1g53295v3 9 BRADI_1g59795v3 41 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 327 BRADI_1g74790v3 43 BRADI_1g09890v3 0 BRADI_1g77505v3 41 BRADI_1g48960v3 1 ERR6145999 completed mapping pipeline successfully