Starting /dee2/code/volunteer_pipeline.sh ERR6146000 current disk space = 1542402637824 free memory = 1597192820 ERR6146000 SRAfilesize 93043cf825a9d3878cbeb0a966282e69 ERR6146000.sra ERR6146000.sra file validated ERR6146000 is paired end ERR6146000 is conventional basespace ERR6146000 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146000_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.46475 35.0 35.0 35.0 35.0 35.0 2 34.6185 35.0 35.0 35.0 35.0 35.0 3 34.5585 35.0 35.0 35.0 35.0 35.0 4 34.63525 35.0 35.0 35.0 35.0 35.0 5 34.61125 35.0 35.0 35.0 35.0 35.0 6 39.36475 40.0 40.0 40.0 39.0 40.0 7 39.3205 40.0 40.0 40.0 39.0 40.0 8 39.2845 40.0 40.0 40.0 39.0 40.0 9 39.36425 40.0 40.0 40.0 39.0 40.0 10 39.3875 40.0 40.0 40.0 39.0 40.0 11 39.38225 40.0 40.0 40.0 39.0 40.0 12 39.32775 40.0 40.0 40.0 39.0 40.0 13 39.307 40.0 40.0 40.0 39.0 40.0 14 39.269 40.0 40.0 40.0 39.0 40.0 15 39.23025 40.0 40.0 40.0 39.0 40.0 16 39.27725 40.0 40.0 40.0 39.0 40.0 17 39.2645 40.0 40.0 40.0 39.0 40.0 18 39.25825 40.0 40.0 40.0 39.0 40.0 19 39.29625 40.0 40.0 40.0 39.0 40.0 20 39.298 40.0 40.0 40.0 39.0 40.0 21 39.295 40.0 40.0 40.0 39.0 40.0 22 39.25825 40.0 40.0 40.0 39.0 40.0 23 39.23675 40.0 40.0 40.0 39.0 40.0 24 39.25725 40.0 40.0 40.0 39.0 40.0 25 39.1875 40.0 40.0 40.0 39.0 40.0 26 39.1785 40.0 40.0 40.0 39.0 40.0 27 39.2365 40.0 40.0 40.0 39.0 40.0 28 39.203 40.0 40.0 40.0 39.0 40.0 29 39.2355 40.0 40.0 40.0 39.0 40.0 30 39.202 40.0 40.0 40.0 39.0 40.0 31 39.19025 40.0 40.0 40.0 39.0 40.0 32 39.2225 40.0 40.0 40.0 39.0 40.0 33 39.2555 40.0 40.0 40.0 39.0 40.0 34 39.25275 40.0 40.0 40.0 39.0 40.0 35 39.19675 40.0 40.0 40.0 39.0 40.0 36 39.2005 40.0 40.0 40.0 39.0 40.0 37 39.2435 40.0 40.0 40.0 39.0 40.0 38 39.184 40.0 40.0 40.0 39.0 40.0 39 39.15825 40.0 40.0 40.0 39.0 40.0 40 39.21 40.0 40.0 40.0 39.0 40.0 41 39.16225 40.0 40.0 40.0 38.0 40.0 42 39.182 40.0 40.0 40.0 39.0 40.0 43 39.0985 40.0 40.0 40.0 39.0 40.0 44 39.1425 40.0 40.0 40.0 39.0 40.0 45 39.202 40.0 40.0 40.0 39.0 40.0 46 39.1545 40.0 40.0 40.0 39.0 40.0 47 39.1255 40.0 40.0 40.0 38.0 40.0 48 39.17625 40.0 40.0 40.0 39.0 40.0 49 39.20625 40.0 40.0 40.0 39.0 40.0 50 39.2275 40.0 40.0 40.0 39.0 40.0 51 39.195 40.0 40.0 40.0 39.0 40.0 52 39.20275 40.0 40.0 40.0 39.0 40.0 53 39.146 40.0 40.0 40.0 38.0 40.0 54 39.17775 40.0 40.0 40.0 38.0 40.0 55 39.1515 40.0 40.0 40.0 38.0 40.0 56 39.13375 40.0 40.0 40.0 38.0 40.0 57 38.9375 40.0 40.0 40.0 38.0 40.0 58 39.1455 40.0 40.0 40.0 38.0 40.0 59 39.16275 40.0 40.0 40.0 38.0 40.0 60 39.22675 40.0 40.0 40.0 39.0 40.0 61 39.16225 40.0 40.0 40.0 38.0 40.0 62 39.20525 40.0 40.0 40.0 39.0 40.0 63 39.17175 40.0 40.0 40.0 39.0 40.0 64 39.12225 40.0 40.0 40.0 38.0 40.0 65 39.15925 40.0 40.0 40.0 38.0 40.0 66 39.15725 40.0 40.0 40.0 39.0 40.0 67 39.1525 40.0 40.0 40.0 38.0 40.0 68 39.18675 40.0 40.0 40.0 38.0 40.0 69 39.22125 40.0 40.0 40.0 39.0 40.0 70 39.14125 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 5.0 26 3.0 27 7.0 28 18.0 29 10.0 30 25.0 31 29.0 32 29.0 33 43.0 34 53.0 35 64.0 36 85.0 37 130.0 38 249.0 39 3248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.675390035228986 13.563160543532964 13.8147961751384 37.94665324609965 2 24.4 15.825 28.4 31.374999999999996 3 22.725 22.7 23.025000000000002 31.55 4 26.625 25.3 22.125 25.95 5 24.7 30.425 23.775 21.099999999999998 6 21.6 26.775 28.9 22.725 7 21.224999999999998 22.0 32.824999999999996 23.95 8 21.6 21.825 28.999999999999996 27.575 9 20.724999999999998 24.675 29.175 25.424999999999997 10 24.65 28.95 21.3 25.1 11 26.674999999999997 21.55 21.375 30.4 12 22.7 23.625 25.074999999999996 28.599999999999998 13 23.275000000000002 24.95 26.35 25.424999999999997 14 23.674999999999997 23.400000000000002 26.200000000000003 26.724999999999998 15 22.2 23.525 26.3 27.975 16 26.174999999999997 23.0 24.55 26.275 17 23.625 25.324999999999996 25.074999999999996 25.974999999999998 18 23.65 24.625 24.75 26.974999999999998 19 25.35 23.625 24.65 26.375 20 24.25 24.075 25.15 26.525 21 23.35 24.474999999999998 24.9 27.275 22 23.849999999999998 25.650000000000002 25.124999999999996 25.374999999999996 23 24.725 24.05 23.849999999999998 27.375 24 22.325 24.925 26.200000000000003 26.55 25 24.75 24.925 23.95 26.375 26 24.25 24.95 24.025 26.775 27 24.275 22.875 26.575 26.275 28 24.2 23.825 24.425 27.55 29 24.9 23.125 25.0 26.974999999999998 30 22.875 24.45 26.174999999999997 26.5 31 23.7 26.35 23.125 26.825 32 25.575 25.3 24.25 24.875 33 23.125 23.724999999999998 25.174999999999997 27.975 34 24.55 25.025 23.775 26.650000000000002 35 25.874999999999996 23.474999999999998 25.0 25.650000000000002 36 23.825 24.825 24.875 26.474999999999998 37 26.025 23.375 24.099999999999998 26.5 38 24.6 25.05 24.474999999999998 25.874999999999996 39 24.025 24.525 25.3 26.150000000000002 40 24.349999999999998 24.65 23.75 27.250000000000004 41 24.075 24.6 24.6 26.724999999999998 42 23.849999999999998 24.825 24.875 26.450000000000003 43 23.825 24.725 24.45 27.0 44 24.725 24.45 24.375 26.450000000000003 45 24.3 25.324999999999996 24.55 25.825 46 24.45 24.65 22.2 28.7 47 23.724999999999998 25.6 24.099999999999998 26.575 48 23.974999999999998 24.2 25.75 26.075 49 24.975 24.875 23.200000000000003 26.950000000000003 50 23.974999999999998 25.650000000000002 24.05 26.325 51 23.075000000000003 24.2 26.075 26.650000000000002 52 24.55 24.75 24.65 26.05 53 24.875 25.15 23.799999999999997 26.174999999999997 54 24.25 24.925 23.9 26.924999999999997 55 24.6 24.05 23.375 27.975 56 23.575 24.125 25.374999999999996 26.924999999999997 57 23.3 23.775 26.400000000000002 26.525 58 25.0 23.724999999999998 23.5 27.775 59 24.775 23.45 26.700000000000003 25.074999999999996 60 22.475 24.75 24.3 28.475 61 25.15 23.325000000000003 24.95 26.575 62 24.625 23.65 25.025 26.700000000000003 63 23.575 24.025 25.775 26.625 64 24.725 23.7 23.974999999999998 27.6 65 23.71185592796398 24.412206103051524 24.937468734367183 26.93846923461731 66 25.851703406813627 23.34669338677355 24.599198396793586 26.20240480961924 67 24.283559577677224 23.80593262946204 25.590749120160883 26.31975867269985 68 25.038520801232668 23.240883410374934 24.319465844889574 27.401129943502823 69 24.422809457579973 18.27538247566064 28.178025034770513 29.123783031988875 70 26.22155911973144 0.0 34.61395001864976 39.1644908616188 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 4.0 27 5.0 28 5.5 29 5.5 30 5.0 31 11.0 32 25.5 33 34.0 34 32.0 35 53.5 36 85.0 37 93.0 38 108.5 39 145.5 40 167.0 41 176.5 42 195.0 43 204.0 44 215.5 45 238.0 46 247.0 47 245.0 48 263.5 49 261.5 50 241.0 51 221.0 52 184.5 53 168.0 54 192.5 55 183.5 56 147.5 57 145.0 58 134.0 59 121.5 60 120.0 61 104.0 62 93.0 63 98.0 64 100.0 65 89.0 66 67.5 67 59.0 68 57.0 69 54.5 70 54.0 71 49.0 72 43.0 73 42.0 74 31.0 75 17.5 76 14.0 77 13.0 78 10.5 79 5.5 80 3.0 81 2.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.05 66 0.2 67 0.5499999999999999 68 2.65 69 10.125 70 32.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.025 33 0.0 0.0 0.0 0.0 0.025 34 0.0 0.0 0.0 0.0 0.025 35 0.0 0.0 0.0 0.0 0.025 36 0.0 0.0 0.0 0.0 0.025 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 39 0.0 0.0 0.0 0.0 0.025 40 0.0 0.0 0.0 0.0 0.025 41 0.0 0.0 0.0 0.0 0.025 42 0.0 0.0 0.0 0.0 0.025 43 0.0 0.0 0.0 0.0 0.025 44 0.0 0.0 0.0 0.0 0.025 45 0.0 0.0 0.0 0.0 0.025 46 0.0 0.0 0.0 0.0 0.025 47 0.0 0.0 0.0 0.0 0.025 48 0.0 0.0 0.0 0.0 0.025 49 0.0 0.0 0.0 0.0 0.025 50 0.0 0.0 0.0 0.0 0.025 51 0.0 0.0 0.0 0.0 0.025 52 0.0 0.0 0.0 0.0 0.025 53 0.0 0.0 0.0 0.0 0.025 54 0.0 0.0 0.0 0.0 0.025 55 0.0 0.0 0.0 0.0 0.025 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6146000 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146000_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.152 35.0 35.0 35.0 33.0 35.0 2 33.9475 35.0 35.0 35.0 32.0 35.0 3 33.74625 35.0 35.0 35.0 31.0 35.0 4 33.6515 35.0 35.0 35.0 31.0 35.0 5 33.6075 35.0 35.0 35.0 31.0 35.0 6 38.005 40.0 40.0 40.0 34.0 40.0 7 37.8585 40.0 39.0 40.0 34.0 40.0 8 37.86 40.0 39.0 40.0 34.0 40.0 9 38.038 40.0 40.0 40.0 34.0 40.0 10 38.04725 40.0 40.0 40.0 34.0 40.0 11 38.102 40.0 40.0 40.0 35.0 40.0 12 38.0365 40.0 40.0 40.0 35.0 40.0 13 38.07275 40.0 40.0 40.0 35.0 40.0 14 37.99825 40.0 40.0 40.0 34.0 40.0 15 38.042 40.0 40.0 40.0 34.0 40.0 16 38.09975 40.0 40.0 40.0 35.0 40.0 17 37.99725 40.0 40.0 40.0 34.0 40.0 18 38.02775 40.0 40.0 40.0 34.0 40.0 19 38.0255 40.0 40.0 40.0 34.0 40.0 20 38.04175 40.0 40.0 40.0 34.0 40.0 21 38.182 40.0 40.0 40.0 35.0 40.0 22 38.10425 40.0 40.0 40.0 35.0 40.0 23 38.10575 40.0 40.0 40.0 35.0 40.0 24 38.03475 40.0 40.0 40.0 35.0 40.0 25 38.03175 40.0 40.0 40.0 34.0 40.0 26 38.1065 40.0 40.0 40.0 35.0 40.0 27 37.98225 40.0 40.0 40.0 34.0 40.0 28 38.10075 40.0 40.0 40.0 34.0 40.0 29 38.09175 40.0 40.0 40.0 35.0 40.0 30 38.077 40.0 40.0 40.0 34.0 40.0 31 38.1385 40.0 40.0 40.0 35.0 40.0 32 38.0855 40.0 40.0 40.0 35.0 40.0 33 38.107 40.0 40.0 40.0 35.0 40.0 34 38.10575 40.0 40.0 40.0 35.0 40.0 35 38.03875 40.0 40.0 40.0 34.0 40.0 36 38.00325 40.0 40.0 40.0 35.0 40.0 37 38.095 40.0 40.0 40.0 35.0 40.0 38 38.01275 40.0 40.0 40.0 34.0 40.0 39 37.9615 40.0 40.0 40.0 34.0 40.0 40 38.0215 40.0 40.0 40.0 34.0 40.0 41 38.03075 40.0 40.0 40.0 34.0 40.0 42 37.997 40.0 39.0 40.0 35.0 40.0 43 37.90675 40.0 39.0 40.0 34.0 40.0 44 37.9465 40.0 39.0 40.0 34.0 40.0 45 38.041 40.0 39.0 40.0 34.0 40.0 46 38.053 40.0 39.0 40.0 34.0 40.0 47 37.9755 40.0 39.0 40.0 34.0 40.0 48 37.971 40.0 39.0 40.0 34.0 40.0 49 38.008 40.0 39.0 40.0 35.0 40.0 50 37.9855 40.0 39.0 40.0 34.0 40.0 51 37.9555 40.0 39.0 40.0 34.0 40.0 52 37.97525 40.0 39.0 40.0 34.0 40.0 53 37.92925 40.0 39.0 40.0 34.0 40.0 54 37.94625 40.0 39.0 40.0 34.0 40.0 55 37.9295 40.0 39.0 40.0 34.0 40.0 56 37.93025 40.0 39.0 40.0 34.0 40.0 57 38.04725 40.0 39.0 40.0 34.0 40.0 58 37.87325 40.0 39.0 40.0 34.0 40.0 59 37.97025 40.0 39.0 40.0 34.0 40.0 60 37.983 40.0 39.0 40.0 34.0 40.0 61 37.89475 40.0 39.0 40.0 34.0 40.0 62 37.965 40.0 39.0 40.0 34.0 40.0 63 38.0285 40.0 39.0 40.0 34.0 40.0 64 37.833 40.0 39.0 40.0 34.0 40.0 65 37.92275 40.0 39.0 40.0 34.0 40.0 66 37.8275 40.0 39.0 40.0 34.0 40.0 67 37.887 40.0 39.0 40.0 34.0 40.0 68 37.908 40.0 39.0 40.0 34.0 40.0 69 37.928 40.0 39.0 40.0 34.0 40.0 70 37.94075 40.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 7.0 18 33.0 19 24.0 20 35.0 21 33.0 22 36.0 23 35.0 24 30.0 25 30.0 26 27.0 27 15.0 28 22.0 29 22.0 30 16.0 31 21.0 32 25.0 33 36.0 34 33.0 35 36.0 36 77.0 37 113.0 38 253.0 39 3040.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.55 17.849999999999998 17.849999999999998 29.75 2 29.525000000000002 25.6 22.675 22.2 3 24.5 27.900000000000002 23.825 23.775 4 28.175 28.599999999999998 19.05 24.175 5 25.474999999999998 33.1 20.625 20.8 6 24.099999999999998 28.749999999999996 23.45 23.7 7 24.875 19.575 27.650000000000002 27.900000000000002 8 23.875 21.349999999999998 25.525 29.25 9 23.0 25.624999999999996 24.224999999999998 27.150000000000002 10 27.075 27.675 20.474999999999998 24.775 11 27.1 21.3 20.474999999999998 31.125000000000004 12 25.674999999999997 22.35 24.625 27.35 13 24.775 23.25 25.55 26.424999999999997 14 25.45 24.775 23.7 26.075 15 27.175 23.150000000000002 22.55 27.125 16 25.8 24.375 23.175 26.650000000000002 17 27.474999999999998 25.025 23.575 23.925 18 26.450000000000003 24.8 22.6 26.150000000000002 19 27.650000000000002 24.5 22.1 25.75 20 27.3 25.575 22.25 24.875 21 26.400000000000002 23.7 23.575 26.325 22 25.95 24.45 22.85 26.75 23 26.150000000000002 25.525 22.625 25.7 24 25.924999999999997 24.875 24.075 25.124999999999996 25 27.474999999999998 23.5 22.325 26.700000000000003 26 26.400000000000002 25.174999999999997 23.075000000000003 25.35 27 26.0 24.275 24.025 25.7 28 27.55 24.3 22.1 26.05 29 26.674999999999997 25.874999999999996 22.6 24.85 30 26.150000000000002 24.825 23.325000000000003 25.7 31 25.85 24.25 24.175 25.724999999999998 32 26.700000000000003 24.725 23.125 25.45 33 25.825 25.05 24.474999999999998 24.65 34 27.325 23.45 22.95 26.275 35 25.5 24.9 24.55 25.05 36 27.175 24.8 22.5 25.525 37 26.75 23.825 23.025000000000002 26.400000000000002 38 26.424999999999997 24.625 23.375 25.575 39 25.85 24.6 23.75 25.8 40 27.250000000000004 24.349999999999998 23.075000000000003 25.324999999999996 41 26.625 24.825 23.1 25.45 42 26.5 24.5 23.9 25.1 43 28.525 23.05 23.674999999999997 24.75 44 27.075 25.75 22.475 24.7 45 24.375 24.224999999999998 24.825 26.575 46 26.700000000000003 25.025 23.05 25.224999999999998 47 26.974999999999998 24.474999999999998 22.5 26.05 48 26.625 23.65 24.525 25.2 49 27.925 22.900000000000002 24.224999999999998 24.95 50 26.424999999999997 24.474999999999998 24.0 25.1 51 25.85 24.7 23.7 25.75 52 27.325 23.724999999999998 23.35 25.6 53 26.25 26.424999999999997 22.95 24.375 54 26.075 24.125 23.225 26.575 55 27.474999999999998 23.125 24.3 25.1 56 26.825 24.65 23.525 25.0 57 28.000000000000004 23.775 23.599999999999998 24.625 58 27.500000000000004 23.775 22.625 26.1 59 27.025 24.474999999999998 23.974999999999998 24.525 60 27.224999999999998 24.349999999999998 22.775000000000002 25.650000000000002 61 27.106776694173547 24.93123280820205 23.10577644411103 24.85621405351338 62 25.906476619154787 26.18154538634659 24.15603900975244 23.755938984746187 63 26.6816704176044 23.53088272068017 23.93098274568642 25.85646411602901 64 26.713356678339167 23.78689344672336 23.986993496748372 25.512756378189096 65 26.776776776776778 25.05005005005005 23.623623623623622 24.54954954954955 66 26.452905811623246 24.649298597194388 23.296593186372746 25.60120240480962 67 27.24981094025712 23.796319637005293 23.670279808419462 25.283589614318124 68 26.363168724279834 23.09670781893004 24.25411522633745 26.286008230452673 69 26.768377253814148 19.445214979195562 26.352288488210817 27.434119278779473 70 30.48780487804878 0.0 32.37250554323725 37.13968957871397 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 1.5 7 3.0 8 1.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.5 17 3.0 18 2.0 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 2.5 25 3.5 26 5.0 27 6.0 28 5.0 29 7.5 30 11.0 31 11.0 32 16.5 33 22.0 34 24.5 35 45.0 36 74.5 37 86.0 38 92.0 39 123.5 40 149.0 41 151.5 42 173.5 43 193.0 44 203.5 45 224.0 46 242.0 47 250.0 48 233.5 49 224.0 50 231.0 51 223.5 52 201.0 53 186.0 54 170.0 55 158.5 56 162.0 57 161.0 58 142.5 59 129.5 60 135.0 61 130.5 62 117.5 63 109.0 64 113.5 65 104.5 66 94.5 67 98.0 68 89.5 69 76.5 70 72.0 71 64.5 72 50.5 73 44.0 74 34.0 75 24.5 76 18.5 77 12.0 78 9.5 79 5.5 80 4.0 81 3.0 82 1.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.025 62 0.025 63 0.025 64 0.05 65 0.1 66 0.2 67 0.8250000000000001 68 2.8000000000000003 69 9.875 70 32.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202064 spots for ERR6146000.sra Written 202064 spots for ERR6146000.sra Read 202071 spots for ERR6146000.sra Written 202071 spots for ERR6146000.sra SRR ids: ['ERR6146000.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ebf3zs1 ERR6146000.sra spots: 4041287 blocks: [[1, 202064], [202065, 404128], [404129, 606192], [606193, 808256], [808257, 1010320], [1010321, 1212384], [1212385, 1414448], [1414449, 1616512], [1616513, 1818576], [1818577, 2020640], [2020641, 2222704], [2222705, 2424768], [2424769, 2626832], [2626833, 2828896], [2828897, 3030960], [3030961, 3233024], [3233025, 3435088], [3435089, 3637152], [3637153, 3839216], [3839217, 4041287]] ERR6146000 file size 716106 ERR6146000 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6146000 ERR6146000_1.fastq ERR6146000_2.fastq Input file: ERR6146000_1.fastq Paired file: ERR6146000_2.fastq trimmed: ERR6146000-trimmed-pair1.fastq, ERR6146000-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:31:09 2024 >> started Sat Dec 7 15:31:13 2024 >> done (4.060s) 4041287 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 93 ( 0.00%) empty read pairs filtered out after trimming by size control 4041194 (100.00%) read pairs available; of these: 21 ( 0.00%) trimmed read pairs available after processing 4041173 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 52 1 0.00% 53 0 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 19 0.00% 70 4041173 100.00% 4041194 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=38 prefix-density=0.10 prefix-fanout=2.6 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=560.80 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=34.6 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=113.56 fanout-score-rank=16 prefix-density=0.96 prefix-fanout=18.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=820.59 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=17.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGA ERR6146000 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:31:37 Started mapping on | Dec 07 15:31:37 Finished on | Dec 07 15:32:01 Mapping speed, Million of reads per hour | 606.18 Number of input reads | 4041194 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 3674914 Uniquely mapped reads % | 90.94% Average mapped length | 138.73 Number of splices: Total | 1753095 Number of splices: Annotated (sjdb) | 1665715 Number of splices: GT/AG | 1729173 Number of splices: GC/AG | 21268 Number of splices: AT/AC | 1266 Number of splices: Non-canonical | 1388 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 56127 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 8753 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.85% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 310153 310153 310153 N_multimapping 56127 56127 56127 N_noFeature 74248 3591072 99520 N_ambiguous 65666 333 7299 UnstrandedReadsAssigned:3535000 PositiveStrandReadsAssigned:83509 NegativeStrandReadsAssigned:3568095 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6146000 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6146000-trimmed-pair1.fastq ERR6146000-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,041,194 reads, 3,710,073 reads pseudoaligned [quant] estimated average fragment length: 184.438 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 ERR6146000.ke.tsv 35125 ERR6146000.se.tsv 88098 total ==> ERR6146000.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.842 1.05096 0.536857 PNS24247 1044 860.562 14.7556 6.594 PNS24249 1928 1744.56 44.118 9.72533 PNS24246 1044 860.562 14.7556 6.594 PNS24248 1044 860.562 14.7556 6.594 PNS24244 1471 1287.56 22.5644 6.73956 PNS24243 293 123.767 1 3.10721 KQK14069 1603 1419.56 547.924 148.437 KQK14071 474 293.377 7.33602 9.61634 ==> ERR6146000.se.tsv <== BRADI_1g14170v3 591 BRADI_1g53295v3 15 BRADI_1g59795v3 43 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 296 BRADI_1g74790v3 48 BRADI_1g09890v3 0 BRADI_1g77505v3 30 BRADI_1g48960v3 0 ERR6146000 completed mapping pipeline successfully