Starting /dee2/code/volunteer_pipeline.sh ERR6146001 current disk space = 1542382743552 free memory = 1599746412 ERR6146001 SRAfilesize dcdb98c2d691dc65a1daef03ced70816 ERR6146001.sra ERR6146001.sra file validated ERR6146001 is paired end ERR6146001 is conventional basespace ERR6146001 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146001_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.475 35.0 35.0 35.0 35.0 35.0 2 34.65025 35.0 35.0 35.0 35.0 35.0 3 34.6915 35.0 35.0 35.0 35.0 35.0 4 34.70825 35.0 35.0 35.0 35.0 35.0 5 34.68475 35.0 35.0 35.0 35.0 35.0 6 39.46125 40.0 40.0 40.0 39.0 40.0 7 39.479 40.0 40.0 40.0 39.0 40.0 8 39.474 40.0 40.0 40.0 39.0 40.0 9 39.477 40.0 40.0 40.0 39.0 40.0 10 39.45275 40.0 40.0 40.0 39.0 40.0 11 39.4595 40.0 40.0 40.0 39.0 40.0 12 39.45625 40.0 40.0 40.0 39.0 40.0 13 39.442 40.0 40.0 40.0 39.0 40.0 14 39.44825 40.0 40.0 40.0 39.0 40.0 15 39.43175 40.0 40.0 40.0 39.0 40.0 16 39.429 40.0 40.0 40.0 39.0 40.0 17 39.433 40.0 40.0 40.0 39.0 40.0 18 39.412 40.0 40.0 40.0 39.0 40.0 19 39.446 40.0 40.0 40.0 39.0 40.0 20 39.40625 40.0 40.0 40.0 39.0 40.0 21 39.4455 40.0 40.0 40.0 39.0 40.0 22 39.40275 40.0 40.0 40.0 39.0 40.0 23 39.34775 40.0 40.0 40.0 39.0 40.0 24 39.32825 40.0 40.0 40.0 39.0 40.0 25 39.412 40.0 40.0 40.0 39.0 40.0 26 39.2935 40.0 40.0 40.0 39.0 40.0 27 39.42225 40.0 40.0 40.0 39.0 40.0 28 39.3835 40.0 40.0 40.0 39.0 40.0 29 39.38525 40.0 40.0 40.0 39.0 40.0 30 39.38675 40.0 40.0 40.0 39.0 40.0 31 39.39325 40.0 40.0 40.0 39.0 40.0 32 39.45225 40.0 40.0 40.0 39.0 40.0 33 39.37125 40.0 40.0 40.0 39.0 40.0 34 39.3725 40.0 40.0 40.0 39.0 40.0 35 39.36825 40.0 40.0 40.0 39.0 40.0 36 39.39425 40.0 40.0 40.0 39.0 40.0 37 39.42025 40.0 40.0 40.0 39.0 40.0 38 39.3415 40.0 40.0 40.0 39.0 40.0 39 39.42575 40.0 40.0 40.0 39.0 40.0 40 39.45325 40.0 40.0 40.0 39.0 40.0 41 39.289 40.0 40.0 40.0 39.0 40.0 42 39.378 40.0 40.0 40.0 39.0 40.0 43 39.41525 40.0 40.0 40.0 39.0 40.0 44 39.429 40.0 40.0 40.0 39.0 40.0 45 39.32675 40.0 40.0 40.0 39.0 40.0 46 39.366 40.0 40.0 40.0 39.0 40.0 47 39.41525 40.0 40.0 40.0 39.0 40.0 48 39.36225 40.0 40.0 40.0 39.0 40.0 49 39.31975 40.0 40.0 40.0 39.0 40.0 50 39.379 40.0 40.0 40.0 39.0 40.0 51 39.3635 40.0 40.0 40.0 39.0 40.0 52 39.379 40.0 40.0 40.0 39.0 40.0 53 39.36125 40.0 40.0 40.0 39.0 40.0 54 39.32825 40.0 40.0 40.0 39.0 40.0 55 39.38225 40.0 40.0 40.0 39.0 40.0 56 39.34675 40.0 40.0 40.0 39.0 40.0 57 39.338 40.0 40.0 40.0 39.0 40.0 58 39.27125 40.0 40.0 40.0 39.0 40.0 59 39.31975 40.0 40.0 40.0 39.0 40.0 60 39.34225 40.0 40.0 40.0 39.0 40.0 61 39.285 40.0 40.0 40.0 39.0 40.0 62 39.346 40.0 40.0 40.0 39.0 40.0 63 39.32525 40.0 40.0 40.0 39.0 40.0 64 39.29475 40.0 40.0 40.0 39.0 40.0 65 39.322 40.0 40.0 40.0 39.0 40.0 66 39.34425 40.0 40.0 40.0 39.0 40.0 67 39.3415 40.0 40.0 40.0 39.0 40.0 68 39.3295 40.0 40.0 40.0 39.0 40.0 69 39.32075 40.0 40.0 40.0 39.0 40.0 70 39.32325 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 0.0 26 8.0 27 5.0 28 10.0 29 13.0 30 15.0 31 23.0 32 23.0 33 32.0 34 44.0 35 49.0 36 59.0 37 103.0 38 230.0 39 3385.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.702770780856426 10.8816120906801 10.831234256926953 44.584382871536526 2 23.400000000000002 12.825000000000001 32.300000000000004 31.474999999999998 3 22.575 16.025 22.95 38.45 4 27.325 22.575 20.875 29.225 5 25.25 29.2 23.75 21.8 6 22.325 29.799999999999997 26.174999999999997 21.7 7 20.925 22.375 36.525 20.175 8 20.1 22.075 31.574999999999996 26.25 9 20.325 23.45 32.1 24.125 10 21.5 32.525 23.95 22.025 11 26.0 24.325 21.575 28.1 12 23.925 22.15 25.974999999999998 27.950000000000003 13 23.425 24.15 25.7 26.724999999999998 14 22.400000000000002 25.124999999999996 27.35 25.124999999999996 15 23.75 23.45 24.75 28.050000000000004 16 24.65 25.4 23.724999999999998 26.224999999999998 17 22.650000000000002 24.675 25.3 27.375 18 23.849999999999998 24.25 24.975 26.924999999999997 19 25.15 24.375 25.4 25.074999999999996 20 23.75 25.5 25.424999999999997 25.324999999999996 21 24.125 24.425 24.725 26.724999999999998 22 25.324999999999996 26.05 24.05 24.575 23 24.25 26.674999999999997 24.15 24.925 24 23.974999999999998 23.825 25.224999999999998 26.974999999999998 25 24.65 24.75 24.65 25.95 26 23.9 25.924999999999997 24.9 25.275 27 23.325000000000003 25.3 25.474999999999998 25.900000000000002 28 23.45 25.974999999999998 24.6 25.974999999999998 29 23.225 26.075 25.724999999999998 24.975 30 23.025000000000002 25.025 24.7 27.250000000000004 31 24.125 25.174999999999997 24.675 26.025 32 23.075000000000003 26.25 24.65 26.025 33 23.674999999999997 25.7 25.174999999999997 25.45 34 25.424999999999997 23.674999999999997 25.1 25.8 35 24.175 24.325 25.55 25.95 36 23.775 23.7 25.575 26.950000000000003 37 23.549999999999997 25.35 23.825 27.275 38 24.349999999999998 24.3 25.1 26.25 39 23.724999999999998 24.925 25.3 26.05 40 23.75 24.575 24.0 27.675 41 23.3 25.674999999999997 24.474999999999998 26.55 42 23.849999999999998 24.95 25.1 26.1 43 23.474999999999998 24.3 25.15 27.075 44 22.975 25.124999999999996 25.85 26.05 45 23.7 24.875 24.55 26.875 46 24.081020255063766 25.256314078519633 25.35633908477119 25.30632658164541 47 25.131282820705174 25.28132033008252 23.755938984746187 25.831457864466117 48 24.306076519129782 24.656164041010253 26.006501625406354 25.03125781445361 49 25.206301575393848 25.881470367591895 24.031007751937985 24.88122030507627 50 24.48112028007002 24.756189047261813 25.881470367591895 24.88122030507627 51 24.10602650662666 24.60615153788447 24.85621405351338 26.431607901975497 52 24.5311327831958 25.156289072268066 24.15603900975244 26.156539134783696 53 24.831207801950487 24.55613903475869 25.481370342585645 25.131282820705174 54 24.93123280820205 24.93123280820205 24.256064016004 25.881470367591895 55 24.456114028507127 24.10602650662666 24.23105776444111 27.206801700425103 56 24.33108277069267 25.10627656914228 25.056264066016503 25.506376594148538 57 23.85596399099775 24.18104526131533 25.63140785196299 26.331582895723933 58 24.256064016004 25.756439109777446 23.63090772693173 26.356589147286826 59 22.85571392848212 26.70667666916729 24.081020255063766 26.356589147286826 60 24.131032758189548 23.830957739434858 24.381095273818453 27.656914228557138 61 24.48112028007002 25.056264066016503 23.980995248812203 26.481620405101275 62 23.71185592796398 26.088044022011005 24.68734367183592 25.512756378189096 63 24.412206103051524 23.961980990495245 25.362681340670335 26.263131565782892 64 23.867900925694272 25.41906429822367 24.64348261195897 26.069552164123095 65 24.243182386790092 24.96872654490868 25.168876657493122 25.619214410808105 66 24.02304609218437 23.72244488977956 24.123246492985974 28.1312625250501 67 23.973810123394614 25.182573659027952 23.973810123394614 26.869806094182824 68 23.015873015873016 23.63031233998976 25.934459805427544 27.419354838709676 69 23.40367223896958 19.046314058646203 27.43217319813648 30.117840504247738 70 25.338208409506397 0.0 34.29616087751371 40.365630712979886 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 2.5 27 3.0 28 3.5 29 8.0 30 12.0 31 15.5 32 18.5 33 18.0 34 35.0 35 57.0 36 86.5 37 111.0 38 128.5 39 160.5 40 175.0 41 193.0 42 224.0 43 237.0 44 235.0 45 250.0 46 267.5 47 268.0 48 255.0 49 231.5 50 221.0 51 221.5 52 212.0 53 202.0 54 186.0 55 155.0 56 126.0 57 112.0 58 119.0 59 114.5 60 103.0 61 98.0 62 88.5 63 84.0 64 83.0 65 78.0 66 74.0 67 74.0 68 61.5 69 51.5 70 54.0 71 49.5 72 40.0 73 35.0 74 30.0 75 17.0 76 8.5 77 8.0 78 7.0 79 4.5 80 3.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.05 63 0.05 64 0.075 65 0.075 66 0.2 67 0.7250000000000001 68 2.35 69 8.774999999999999 70 31.624999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6146001 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146001_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3915 35.0 35.0 35.0 33.0 35.0 2 34.18575 35.0 35.0 35.0 33.0 35.0 3 34.245 35.0 35.0 35.0 33.0 35.0 4 34.32975 35.0 35.0 35.0 34.0 35.0 5 34.227 35.0 35.0 35.0 33.0 35.0 6 38.93575 40.0 40.0 40.0 39.0 40.0 7 38.89625 40.0 40.0 40.0 38.0 40.0 8 38.9535 40.0 40.0 40.0 39.0 40.0 9 38.94275 40.0 40.0 40.0 39.0 40.0 10 39.01175 40.0 40.0 40.0 39.0 40.0 11 39.03725 40.0 40.0 40.0 39.0 40.0 12 39.01575 40.0 40.0 40.0 39.0 40.0 13 39.03225 40.0 40.0 40.0 39.0 40.0 14 38.99125 40.0 40.0 40.0 39.0 40.0 15 39.00925 40.0 40.0 40.0 39.0 40.0 16 39.11025 40.0 40.0 40.0 39.0 40.0 17 39.05525 40.0 40.0 40.0 39.0 40.0 18 39.0345 40.0 40.0 40.0 39.0 40.0 19 39.03475 40.0 40.0 40.0 39.0 40.0 20 39.00375 40.0 40.0 40.0 39.0 40.0 21 39.078 40.0 40.0 40.0 39.0 40.0 22 39.0225 40.0 40.0 40.0 39.0 40.0 23 38.94725 40.0 40.0 40.0 39.0 40.0 24 39.058 40.0 40.0 40.0 39.0 40.0 25 38.98225 40.0 40.0 40.0 39.0 40.0 26 39.05325 40.0 40.0 40.0 39.0 40.0 27 39.024 40.0 40.0 40.0 39.0 40.0 28 39.054 40.0 40.0 40.0 39.0 40.0 29 39.05675 40.0 40.0 40.0 39.0 40.0 30 38.98625 40.0 40.0 40.0 39.0 40.0 31 38.9585 40.0 40.0 40.0 39.0 40.0 32 39.00025 40.0 40.0 40.0 39.0 40.0 33 39.04775 40.0 40.0 40.0 39.0 40.0 34 39.00225 40.0 40.0 40.0 39.0 40.0 35 38.89675 40.0 40.0 40.0 38.0 40.0 36 38.91275 40.0 40.0 40.0 38.0 40.0 37 38.92425 40.0 40.0 40.0 39.0 40.0 38 38.8945 40.0 40.0 40.0 38.0 40.0 39 38.91975 40.0 40.0 40.0 38.0 40.0 40 38.986 40.0 40.0 40.0 39.0 40.0 41 38.97275 40.0 40.0 40.0 39.0 40.0 42 39.00375 40.0 40.0 40.0 39.0 40.0 43 38.96425 40.0 40.0 40.0 39.0 40.0 44 38.97425 40.0 40.0 40.0 38.0 40.0 45 38.93375 40.0 40.0 40.0 39.0 40.0 46 38.937 40.0 40.0 40.0 39.0 40.0 47 38.9285 40.0 40.0 40.0 38.0 40.0 48 38.893 40.0 40.0 40.0 39.0 40.0 49 38.86175 40.0 40.0 40.0 38.0 40.0 50 38.91 40.0 40.0 40.0 38.0 40.0 51 38.94575 40.0 40.0 40.0 38.0 40.0 52 38.7675 40.0 40.0 40.0 37.0 40.0 53 38.827 40.0 40.0 40.0 38.0 40.0 54 38.8005 40.0 40.0 40.0 38.0 40.0 55 38.89325 40.0 40.0 40.0 38.0 40.0 56 38.88575 40.0 40.0 40.0 38.0 40.0 57 38.908 40.0 40.0 40.0 38.0 40.0 58 38.93075 40.0 40.0 40.0 38.0 40.0 59 38.84175 40.0 40.0 40.0 38.0 40.0 60 38.8885 40.0 40.0 40.0 38.0 40.0 61 38.83175 40.0 40.0 40.0 38.0 40.0 62 38.897 40.0 40.0 40.0 38.0 40.0 63 38.82975 40.0 40.0 40.0 38.0 40.0 64 38.8515 40.0 40.0 40.0 38.0 40.0 65 38.89025 40.0 40.0 40.0 38.0 40.0 66 38.7775 40.0 40.0 40.0 38.0 40.0 67 38.789 40.0 40.0 40.0 38.0 40.0 68 38.76275 40.0 40.0 40.0 38.0 40.0 69 38.76825 40.0 40.0 40.0 38.0 40.0 70 38.7185 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 5.0 19 5.0 20 14.0 21 8.0 22 12.0 23 10.0 24 12.0 25 12.0 26 11.0 27 18.0 28 14.0 29 17.0 30 19.0 31 24.0 32 28.0 33 30.0 34 35.0 35 49.0 36 72.0 37 99.0 38 227.0 39 3277.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.725 19.225 14.85 35.199999999999996 2 29.049999999999997 24.9 25.0 21.05 3 21.075 26.35 25.724999999999998 26.85 4 26.1 27.800000000000004 21.275 24.825 5 28.249999999999996 31.374999999999996 19.175 21.2 6 22.975 32.275 21.6 23.150000000000002 7 23.625 19.125 33.35 23.9 8 23.599999999999998 21.8 25.825 28.775000000000002 9 23.799999999999997 23.45 26.775 25.974999999999998 10 26.05 29.65 21.925 22.375 11 28.299999999999997 22.0 20.974999999999998 28.725 12 27.200000000000003 22.475 23.799999999999997 26.525 13 25.650000000000002 23.05 24.85 26.450000000000003 14 24.05 24.474999999999998 25.45 26.025 15 25.75 24.224999999999998 24.975 25.05 16 26.974999999999998 25.025 23.95 24.05 17 28.199999999999996 23.674999999999997 23.0 25.124999999999996 18 25.95 26.025 23.1 24.925 19 27.625 23.75 23.625 25.0 20 27.224999999999998 25.2 23.1 24.474999999999998 21 26.1 24.6 23.3 26.0 22 24.575 25.775 23.799999999999997 25.85 23 27.625 23.775 24.0 24.6 24 26.200000000000003 25.4 23.775 24.625 25 25.8 24.349999999999998 24.325 25.525 26 27.55 24.575 23.799999999999997 24.075 27 26.700000000000003 23.925 23.9 25.474999999999998 28 26.474999999999998 23.674999999999997 24.7 25.15 29 27.375 24.8 23.25 24.575 30 24.05 25.55 24.8 25.6 31 25.825 25.174999999999997 24.6 24.4 32 25.724999999999998 25.2 23.65 25.424999999999997 33 25.174999999999997 24.95 24.099999999999998 25.775 34 26.224999999999998 24.325 23.375 26.075 35 25.900000000000002 25.1 24.125 24.875 36 24.9 25.374999999999996 24.5 25.224999999999998 37 26.724999999999998 23.325000000000003 24.45 25.5 38 27.400000000000002 24.5 23.150000000000002 24.95 39 25.624999999999996 24.575 24.775 25.025 40 26.275 24.65 24.3 24.775 41 26.400000000000002 25.4 23.400000000000002 24.8 42 26.0 25.624999999999996 24.45 23.925 43 26.474999999999998 23.75 24.85 24.925 44 27.325 23.849999999999998 23.7 25.124999999999996 45 26.125 24.525 24.925 24.425 46 27.306826706676667 23.23080770192548 24.006001500375092 25.456364091022753 47 26.756689172293076 24.406101525381345 24.93123280820205 23.905976494123532 48 26.881720430107524 24.8062015503876 24.63115778944736 23.680920230057513 49 25.581395348837212 24.431107776944234 25.006251562890725 24.981245311327832 50 26.431607901975497 24.18104526131533 24.681170292573142 24.706176544136035 51 25.681420355088775 25.23130782695674 25.406351587896975 23.680920230057513 52 26.731682920730183 25.056264066016503 23.40585146286572 24.8062015503876 53 26.881720430107524 24.681170292573142 23.93098274568642 24.50612653163291 54 24.93123280820205 24.85621405351338 25.35633908477119 24.85621405351338 55 25.78144536134033 24.256064016004 25.406351587896975 24.55613903475869 56 27.081770442610654 24.63115778944736 24.50612653163291 23.78094523630908 57 26.281570392598148 24.706176544136035 23.58089522380595 25.431357839459867 58 26.531632908227053 25.531382845711427 23.15578894723681 24.781195298824706 59 27.85696424106027 24.90622655663916 23.40585146286572 23.830957739434858 60 25.481370342585645 25.081270317579396 24.5311327831958 24.90622655663916 61 27.7569392348087 23.95598899724931 23.80595148787197 24.48112028007002 62 26.663331665832917 25.162581290645324 23.861930965482742 24.312156078039017 63 25.26263131565783 25.86293146573287 24.73736868434217 24.137068534267133 64 26.263131565782892 25.312656328164078 23.986993496748372 24.437218609304654 65 25.69427070302727 24.618463847885916 25.11883912934701 24.568426319739807 66 25.520180496365004 25.745800952619703 25.04387064427175 23.690147906743544 67 27.63920382968002 23.960695389266817 24.514991181657848 23.885109599395314 68 28.421052631578945 23.774069319640564 23.876765083440308 23.92811296534018 69 24.66254218222722 19.038245219347584 28.065241844769407 28.23397075365579 70 29.140067592940294 0.0 34.02177994742771 36.83815245963199 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 4.0 28 7.0 29 7.0 30 4.0 31 7.0 32 13.5 33 17.0 34 27.0 35 49.0 36 75.0 37 89.0 38 107.0 39 137.5 40 150.0 41 173.0 42 219.5 43 243.0 44 253.5 45 259.5 46 247.5 47 240.0 48 249.5 49 232.5 50 206.0 51 219.0 52 211.5 53 191.0 54 182.0 55 162.0 56 143.0 57 135.0 58 127.5 59 115.5 60 111.0 61 107.0 62 102.5 63 102.0 64 91.5 65 78.0 66 82.0 67 89.0 68 83.0 69 65.0 70 53.0 71 45.0 72 30.5 73 24.0 74 23.5 75 22.0 76 18.5 77 16.0 78 10.5 79 5.5 80 6.0 81 4.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.05 63 0.05 64 0.05 65 0.075 66 0.27499999999999997 67 0.775 68 2.625 69 11.1 70 33.425 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra Read 213821 spots for ERR6146001.sra Written 213821 spots for ERR6146001.sra SRR ids: ['ERR6146001.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ec_jg4cz ERR6146001.sra spots: 4276420 blocks: [[1, 213821], [213822, 427642], [427643, 641463], [641464, 855284], [855285, 1069105], [1069106, 1282926], [1282927, 1496747], [1496748, 1710568], [1710569, 1924389], [1924390, 2138210], [2138211, 2352031], [2352032, 2565852], [2565853, 2779673], [2779674, 2993494], [2993495, 3207315], [3207316, 3421136], [3421137, 3634957], [3634958, 3848778], [3848779, 4062599], [4062600, 4276420]] ERR6146001 file size 757897 ERR6146001 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6146001 ERR6146001_1.fastq ERR6146001_2.fastq Input file: ERR6146001_1.fastq Paired file: ERR6146001_2.fastq trimmed: ERR6146001-trimmed-pair1.fastq, ERR6146001-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:31:54 2024 >> started Sat Dec 7 15:31:58 2024 >> done (4.073s) 4276420 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 47 ( 0.00%) empty read pairs filtered out after trimming by size control 4276372 (100.00%) read pairs available; of these: 13 ( 0.00%) trimmed read pairs available after processing 4276359 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 10 0.00% 70 4276359 100.00% 4276372 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=39 prefix-density=0.09 prefix-fanout=2.4 sequence=ATGCCCTCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=567.51 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=34.9 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=123.72 fanout-score-rank=12 prefix-density=0.87 prefix-fanout=18.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=742.84 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=16.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGC ERR6146001 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:32:25 Started mapping on | Dec 07 15:32:25 Finished on | Dec 07 15:32:44 Mapping speed, Million of reads per hour | 810.26 Number of input reads | 4276372 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4039789 Uniquely mapped reads % | 94.47% Average mapped length | 138.75 Number of splices: Total | 1974598 Number of splices: Annotated (sjdb) | 1882834 Number of splices: GT/AG | 1947381 Number of splices: GC/AG | 24123 Number of splices: AT/AC | 1450 Number of splices: Non-canonical | 1644 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 59491 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 7393 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 177092 177092 177092 N_multimapping 59491 59491 59491 N_noFeature 93765 3951323 119893 N_ambiguous 69929 414 7726 UnstrandedReadsAssigned:3876095 PositiveStrandReadsAssigned:88052 NegativeStrandReadsAssigned:3912170 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6146001 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6146001-trimmed-pair1.fastq ERR6146001-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,276,372 reads, 3,980,452 reads pseudoaligned [quant] estimated average fragment length: 185.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 ERR6146001.ke.tsv 35125 ERR6146001.se.tsv 88098 total ==> ERR6146001.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.23 12.9566 6.49452 PNS24247 1044 859.822 10.713 4.69798 PNS24249 1928 1743.82 26.1104 5.64571 PNS24246 1044 859.822 10.713 4.69798 PNS24248 1044 859.822 10.713 4.69798 PNS24244 1471 1286.82 26.794 7.85104 PNS24243 293 125.338 0 0 KQK14069 1603 1418.82 685.646 182.213 KQK14071 474 292.991 13.3916 17.234 ==> ERR6146001.se.tsv <== BRADI_1g14170v3 737 BRADI_1g53295v3 7 BRADI_1g59795v3 52 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 303 BRADI_1g74790v3 41 BRADI_1g09890v3 0 BRADI_1g77505v3 39 BRADI_1g48960v3 0 ERR6146001 completed mapping pipeline successfully