Starting /dee2/code/volunteer_pipeline.sh ERR6146002 current disk space = 1542414356480 free memory = 1600538564 ERR6146002 SRAfilesize 543ad0ed38ef2fd62535854534f36df4 ERR6146002.sra ERR6146002.sra file validated ERR6146002 is paired end ERR6146002 is conventional basespace ERR6146002 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146002_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.4635 35.0 35.0 35.0 35.0 35.0 2 34.63225 35.0 35.0 35.0 35.0 35.0 3 34.68775 35.0 35.0 35.0 35.0 35.0 4 34.7075 35.0 35.0 35.0 35.0 35.0 5 34.6635 35.0 35.0 35.0 35.0 35.0 6 39.48325 40.0 40.0 40.0 39.0 40.0 7 39.42725 40.0 40.0 40.0 39.0 40.0 8 39.40125 40.0 40.0 40.0 39.0 40.0 9 39.44525 40.0 40.0 40.0 39.0 40.0 10 39.454 40.0 40.0 40.0 39.0 40.0 11 39.44225 40.0 40.0 40.0 39.0 40.0 12 39.4815 40.0 40.0 40.0 39.0 40.0 13 39.4275 40.0 40.0 40.0 39.0 40.0 14 39.392 40.0 40.0 40.0 39.0 40.0 15 39.4225 40.0 40.0 40.0 39.0 40.0 16 39.4615 40.0 40.0 40.0 39.0 40.0 17 39.41875 40.0 40.0 40.0 39.0 40.0 18 39.399 40.0 40.0 40.0 39.0 40.0 19 39.411 40.0 40.0 40.0 39.0 40.0 20 39.4215 40.0 40.0 40.0 39.0 40.0 21 39.3635 40.0 40.0 40.0 39.0 40.0 22 39.3555 40.0 40.0 40.0 39.0 40.0 23 39.395 40.0 40.0 40.0 39.0 40.0 24 39.39725 40.0 40.0 40.0 39.0 40.0 25 39.35125 40.0 40.0 40.0 39.0 40.0 26 39.35675 40.0 40.0 40.0 39.0 40.0 27 39.36175 40.0 40.0 40.0 39.0 40.0 28 39.35725 40.0 40.0 40.0 39.0 40.0 29 39.302 40.0 40.0 40.0 39.0 40.0 30 39.31875 40.0 40.0 40.0 39.0 40.0 31 39.3325 40.0 40.0 40.0 39.0 40.0 32 39.364 40.0 40.0 40.0 39.0 40.0 33 39.33025 40.0 40.0 40.0 39.0 40.0 34 39.3935 40.0 40.0 40.0 39.0 40.0 35 39.3415 40.0 40.0 40.0 39.0 40.0 36 39.32475 40.0 40.0 40.0 39.0 40.0 37 39.32075 40.0 40.0 40.0 39.0 40.0 38 39.314 40.0 40.0 40.0 39.0 40.0 39 39.34 40.0 40.0 40.0 39.0 40.0 40 39.2915 40.0 40.0 40.0 39.0 40.0 41 39.31175 40.0 40.0 40.0 39.0 40.0 42 39.363 40.0 40.0 40.0 39.0 40.0 43 39.3825 40.0 40.0 40.0 39.0 40.0 44 39.324 40.0 40.0 40.0 39.0 40.0 45 39.2965 40.0 40.0 40.0 39.0 40.0 46 39.30675 40.0 40.0 40.0 39.0 40.0 47 39.26025 40.0 40.0 40.0 39.0 40.0 48 39.362 40.0 40.0 40.0 39.0 40.0 49 39.3695 40.0 40.0 40.0 39.0 40.0 50 39.334 40.0 40.0 40.0 39.0 40.0 51 39.344 40.0 40.0 40.0 39.0 40.0 52 39.3725 40.0 40.0 40.0 39.0 40.0 53 39.36475 40.0 40.0 40.0 39.0 40.0 54 39.35625 40.0 40.0 40.0 39.0 40.0 55 39.31925 40.0 40.0 40.0 39.0 40.0 56 39.33825 40.0 40.0 40.0 39.0 40.0 57 39.20875 40.0 40.0 40.0 39.0 40.0 58 39.3355 40.0 40.0 40.0 39.0 40.0 59 39.3425 40.0 40.0 40.0 39.0 40.0 60 39.35075 40.0 40.0 40.0 39.0 40.0 61 39.33825 40.0 40.0 40.0 39.0 40.0 62 39.33975 40.0 40.0 40.0 39.0 40.0 63 39.317 40.0 40.0 40.0 39.0 40.0 64 39.3125 40.0 40.0 40.0 39.0 40.0 65 39.336 40.0 40.0 40.0 39.0 40.0 66 39.3365 40.0 40.0 40.0 39.0 40.0 67 39.2695 40.0 40.0 40.0 39.0 40.0 68 39.27675 40.0 40.0 40.0 39.0 40.0 69 39.31 40.0 40.0 40.0 39.0 40.0 70 39.3365 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 2.0 25 6.0 26 3.0 27 4.0 28 10.0 29 16.0 30 8.0 31 24.0 32 18.0 33 33.0 34 38.0 35 64.0 36 79.0 37 98.0 38 243.0 39 3353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.68411779511704 10.697206141454819 10.218978102189782 44.39969796123836 2 22.75 12.85 32.550000000000004 31.85 3 21.075 15.825 23.974999999999998 39.125 4 27.224999999999998 22.55 21.95 28.275 5 27.800000000000004 28.000000000000004 23.025000000000002 21.175 6 22.45 29.625 26.025 21.9 7 20.599999999999998 22.45 36.975 19.975 8 20.45 23.35 30.8 25.4 9 19.650000000000002 22.275 33.2 24.875 10 22.1 32.175 23.225 22.5 11 25.35 24.349999999999998 23.549999999999997 26.75 12 23.575 22.400000000000002 26.0 28.025 13 23.674999999999997 25.025 25.95 25.35 14 23.225 24.9 26.025 25.85 15 22.925 23.45 26.5 27.125 16 25.025 24.425 24.7 25.85 17 24.075 25.6 25.6 24.725 18 23.150000000000002 23.974999999999998 24.85 28.025 19 24.8 24.975 24.5 25.724999999999998 20 24.05 26.35 23.95 25.650000000000002 21 22.275 24.625 25.95 27.150000000000002 22 23.325000000000003 26.35 24.9 25.424999999999997 23 23.425 24.575 25.8 26.200000000000003 24 22.775000000000002 25.25 25.324999999999996 26.650000000000002 25 23.400000000000002 26.200000000000003 23.724999999999998 26.674999999999997 26 23.95 24.275 25.85 25.924999999999997 27 22.6 25.05 25.35 27.0 28 24.9 25.575 24.325 25.2 29 23.724999999999998 24.625 26.35 25.3 30 23.25 25.474999999999998 24.9 26.375 31 23.025000000000002 25.75 25.95 25.275 32 22.8 25.1 26.5 25.6 33 22.15 25.124999999999996 24.95 27.775 34 23.325000000000003 25.324999999999996 25.224999999999998 26.125 35 24.45 25.5 25.1 24.95 36 24.275 23.925 26.075 25.724999999999998 37 24.025 25.124999999999996 25.25 25.6 38 24.55 25.474999999999998 24.224999999999998 25.75 39 23.3 25.025 25.525 26.150000000000002 40 23.95 25.6 24.55 25.900000000000002 41 24.6 25.424999999999997 24.625 25.35 42 22.95 24.85 25.3 26.900000000000002 43 25.1 24.75 23.275000000000002 26.875 44 24.15 24.7 24.65 26.5 45 23.799999999999997 23.65 25.05 27.500000000000004 46 23.375 24.975 24.725 26.924999999999997 47 23.549999999999997 24.25 25.5 26.700000000000003 48 24.125 24.3 26.05 25.525 49 25.6 24.65 24.425 25.324999999999996 50 23.575 25.05 25.0 26.375 51 22.55 24.85 25.95 26.650000000000002 52 24.025 24.4 25.575 26.0 53 23.5 24.6 26.400000000000002 25.5 54 23.825 23.724999999999998 24.8 27.650000000000002 55 25.55 24.775 24.725 24.95 56 23.925 24.85 25.424999999999997 25.8 57 22.925 24.55 25.575 26.950000000000003 58 23.75 25.650000000000002 24.075 26.525 59 23.43085771442861 25.23130782695674 24.781195298824706 26.556639159789945 60 22.9057264316079 24.50612653163291 26.006501625406354 26.581645411352838 61 24.656164041010253 24.23105776444111 24.58114528632158 26.531632908227053 62 25.081270317579396 23.95598899724931 25.431357839459867 25.531382845711427 63 23.330832708177045 24.63115778944736 26.30657664416104 25.731432858214554 64 25.11255627813907 24.61230615307654 23.411705852926463 26.863431715857928 65 24.34934934934935 25.575575575575577 23.998998998999 26.076076076076077 66 22.531328320802004 24.81203007518797 25.438596491228072 27.21804511278195 67 24.044265593561367 25.402414486921533 23.591549295774648 26.961770623742453 68 25.65351101998975 23.321373654536135 25.243464889800105 25.781650435674013 69 23.92502756339581 19.40463065049614 26.626240352811465 30.044101433296582 70 24.23146473779385 0.0 35.189873417721515 40.57866184448463 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.0 24 1.0 25 2.5 26 4.0 27 3.0 28 5.0 29 7.0 30 7.0 31 11.5 32 20.5 33 25.0 34 38.0 35 69.5 36 88.0 37 88.0 38 115.0 39 152.5 40 163.0 41 183.0 42 234.0 43 265.0 44 255.5 45 263.0 46 263.5 47 247.0 48 243.5 49 239.0 50 238.0 51 230.5 52 193.0 53 163.0 54 165.5 55 162.0 56 137.5 57 119.0 58 116.0 59 111.0 60 109.0 61 109.5 62 100.0 63 90.0 64 90.0 65 81.5 66 65.0 67 57.0 68 57.5 69 54.0 70 50.0 71 39.5 72 23.0 73 17.0 74 17.5 75 17.5 76 15.0 77 13.0 78 8.5 79 4.5 80 5.0 81 2.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.05 65 0.1 66 0.25 67 0.6 68 2.45 69 9.3 70 30.875000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.025 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 39 0.0 0.025 0.0 0.0 0.0 40 0.0 0.025 0.0 0.0 0.0 41 0.0 0.025 0.0 0.0 0.0 42 0.0 0.025 0.0 0.0 0.0 43 0.0 0.025 0.0 0.0 0.0 44 0.0 0.025 0.0 0.0 0.0 45 0.0 0.025 0.0 0.0 0.0 46 0.0 0.025 0.0 0.0 0.0 47 0.0 0.025 0.0 0.0 0.0 48 0.0 0.025 0.0 0.0 0.0 49 0.0 0.025 0.0 0.0 0.0 50 0.0 0.025 0.0 0.0 0.0 51 0.0 0.025 0.0 0.0 0.0 52 0.0 0.025 0.0 0.0 0.0 53 0.0 0.025 0.0 0.0 0.0 54 0.0 0.025 0.0 0.0 0.0 55 0.0 0.025 0.0 0.0 0.0 56 0.0 0.025 0.0 0.0 0.0 57 0.0 0.025 0.0 0.0 0.0 58 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6146002 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146002_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2935 35.0 35.0 35.0 33.0 35.0 2 34.21275 35.0 35.0 35.0 33.0 35.0 3 34.25325 35.0 35.0 35.0 33.0 35.0 4 34.194 35.0 35.0 35.0 33.0 35.0 5 34.17 35.0 35.0 35.0 33.0 35.0 6 38.83775 40.0 40.0 40.0 39.0 40.0 7 38.893 40.0 40.0 40.0 38.0 40.0 8 38.7485 40.0 40.0 40.0 38.0 40.0 9 38.8625 40.0 40.0 40.0 38.0 40.0 10 38.865 40.0 40.0 40.0 38.0 40.0 11 38.885 40.0 40.0 40.0 39.0 40.0 12 38.89375 40.0 40.0 40.0 39.0 40.0 13 38.92025 40.0 40.0 40.0 39.0 40.0 14 38.84275 40.0 40.0 40.0 39.0 40.0 15 38.845 40.0 40.0 40.0 39.0 40.0 16 38.91425 40.0 40.0 40.0 39.0 40.0 17 38.85425 40.0 40.0 40.0 38.0 40.0 18 38.774 40.0 40.0 40.0 38.0 40.0 19 38.8785 40.0 40.0 40.0 38.0 40.0 20 38.92475 40.0 40.0 40.0 39.0 40.0 21 38.85 40.0 40.0 40.0 39.0 40.0 22 38.904 40.0 40.0 40.0 39.0 40.0 23 38.92275 40.0 40.0 40.0 39.0 40.0 24 38.8685 40.0 40.0 40.0 38.0 40.0 25 38.8485 40.0 40.0 40.0 39.0 40.0 26 38.8375 40.0 40.0 40.0 38.0 40.0 27 38.857 40.0 40.0 40.0 38.0 40.0 28 38.878 40.0 40.0 40.0 38.0 40.0 29 38.89625 40.0 40.0 40.0 39.0 40.0 30 38.87575 40.0 40.0 40.0 39.0 40.0 31 38.997 40.0 40.0 40.0 39.0 40.0 32 38.95425 40.0 40.0 40.0 39.0 40.0 33 38.93275 40.0 40.0 40.0 39.0 40.0 34 38.924 40.0 40.0 40.0 39.0 40.0 35 38.921 40.0 40.0 40.0 38.0 40.0 36 38.961 40.0 40.0 40.0 39.0 40.0 37 38.79775 40.0 40.0 40.0 38.0 40.0 38 38.92 40.0 40.0 40.0 39.0 40.0 39 38.871 40.0 40.0 40.0 38.0 40.0 40 38.905 40.0 40.0 40.0 39.0 40.0 41 38.85175 40.0 40.0 40.0 38.0 40.0 42 38.815 40.0 40.0 40.0 38.0 40.0 43 38.769 40.0 40.0 40.0 38.0 40.0 44 38.7915 40.0 40.0 40.0 38.0 40.0 45 38.83 40.0 40.0 40.0 38.0 40.0 46 38.88675 40.0 40.0 40.0 39.0 40.0 47 38.80375 40.0 40.0 40.0 38.0 40.0 48 38.80925 40.0 40.0 40.0 38.0 40.0 49 38.81225 40.0 40.0 40.0 38.0 40.0 50 38.79525 40.0 40.0 40.0 38.0 40.0 51 38.817 40.0 40.0 40.0 38.0 40.0 52 38.79275 40.0 40.0 40.0 38.0 40.0 53 38.7765 40.0 40.0 40.0 38.0 40.0 54 38.778 40.0 40.0 40.0 38.0 40.0 55 38.83125 40.0 40.0 40.0 38.0 40.0 56 38.72725 40.0 40.0 40.0 38.0 40.0 57 38.75575 40.0 40.0 40.0 38.0 40.0 58 38.72875 40.0 40.0 40.0 38.0 40.0 59 38.76 40.0 40.0 40.0 38.0 40.0 60 38.8075 40.0 40.0 40.0 38.0 40.0 61 38.77825 40.0 40.0 40.0 38.0 40.0 62 38.76625 40.0 40.0 40.0 38.0 40.0 63 38.7445 40.0 40.0 40.0 38.0 40.0 64 38.75825 40.0 40.0 40.0 38.0 40.0 65 38.67975 40.0 40.0 40.0 38.0 40.0 66 38.78975 40.0 40.0 40.0 38.0 40.0 67 38.76875 40.0 40.0 40.0 38.0 40.0 68 38.79825 40.0 40.0 40.0 38.0 40.0 69 38.7175 40.0 40.0 40.0 38.0 40.0 70 38.77475 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 4.0 18 10.0 19 13.0 20 10.0 21 16.0 22 9.0 23 15.0 24 16.0 25 13.0 26 11.0 27 18.0 28 11.0 29 19.0 30 19.0 31 22.0 32 21.0 33 23.0 34 35.0 35 48.0 36 66.0 37 116.0 38 230.0 39 3254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.025000000000002 18.75 13.8 36.425000000000004 2 27.85 26.174999999999997 26.200000000000003 19.775000000000002 3 22.475 26.650000000000002 25.825 25.05 4 26.700000000000003 28.050000000000004 20.4 24.85 5 27.750000000000004 31.900000000000002 19.75 20.599999999999998 6 21.0 32.800000000000004 23.1 23.1 7 25.374999999999996 18.7 32.85 23.075000000000003 8 24.0 21.65 25.174999999999997 29.175 9 23.325000000000003 23.200000000000003 27.325 26.150000000000002 10 25.5 29.549999999999997 21.375 23.575 11 27.900000000000002 23.549999999999997 20.625 27.925 12 26.35 21.525 23.974999999999998 28.15 13 25.7 23.375 24.075 26.85 14 26.424999999999997 24.125 24.349999999999998 25.1 15 25.575 25.525 23.75 25.15 16 26.05 23.474999999999998 25.2 25.275 17 27.6 25.55 22.400000000000002 24.45 18 24.9 25.55 22.95 26.6 19 26.55 24.025 23.849999999999998 25.575 20 27.525 24.15 23.875 24.45 21 24.725 23.599999999999998 24.775 26.900000000000002 22 26.650000000000002 23.599999999999998 24.25 25.5 23 26.325 24.325 24.775 24.575 24 25.424999999999997 24.474999999999998 24.2 25.900000000000002 25 26.174999999999997 23.775 24.4 25.650000000000002 26 27.200000000000003 25.2 23.599999999999998 24.0 27 25.074999999999996 25.474999999999998 24.55 24.9 28 26.075 23.7 24.224999999999998 26.0 29 26.05 23.724999999999998 23.674999999999997 26.55 30 25.124999999999996 25.1 24.4 25.374999999999996 31 27.275 23.45 23.825 25.45 32 26.575 25.7 24.4 23.325000000000003 33 25.525 25.4 24.725 24.349999999999998 34 25.900000000000002 24.325 24.7 25.074999999999996 35 26.150000000000002 25.55 23.375 24.925 36 25.074999999999996 26.575 24.4 23.95 37 27.025 23.65 23.549999999999997 25.775 38 27.150000000000002 24.099999999999998 23.849999999999998 24.9 39 25.174999999999997 25.374999999999996 24.45 25.0 40 27.1 23.575 23.625 25.7 41 26.724999999999998 24.825 23.225 25.224999999999998 42 25.324999999999996 26.35 24.45 23.875 43 26.200000000000003 23.05 24.575 26.174999999999997 44 25.650000000000002 25.575 23.724999999999998 25.05 45 25.650000000000002 25.575 24.3 24.474999999999998 46 26.424999999999997 23.525 25.124999999999996 24.925 47 26.75 24.525 24.975 23.75 48 25.025 25.874999999999996 25.05 24.05 49 26.650000000000002 23.400000000000002 24.0 25.95 50 26.674999999999997 24.25 24.025 25.05 51 25.650000000000002 24.5 23.925 25.924999999999997 52 26.325 24.099999999999998 23.9 25.674999999999997 53 28.275 24.625 22.8 24.3 54 25.825 24.425 24.2 25.55 55 27.425 23.75 22.650000000000002 26.174999999999997 56 26.875 25.15 24.625 23.35 57 26.325 24.75 24.175 24.75 58 27.3 24.75 24.3 23.65 59 27.500000000000004 24.425 22.425 25.650000000000002 60 26.05 25.275 23.925 24.75 61 26.875 23.375 24.4 25.35 62 27.375 25.124999999999996 23.575 23.925 63 25.25 26.174999999999997 23.775 24.8 64 26.96348174087044 23.66183091545773 24.23711855927964 25.137568784392194 65 25.38808212318478 25.38808212318478 23.760640961442164 25.463194792188283 66 24.49849548645938 24.2728184553661 25.02507522567703 26.203610832497493 67 26.958931720836482 23.683547493071302 24.640967498110356 24.71655328798186 68 25.989717223650388 24.061696658097688 24.370179948586117 25.578406169665808 69 27.068295391449194 18.545252637423655 28.0399777901166 26.34647418101055 70 29.01669758812616 0.0 33.988868274582565 36.99443413729128 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 4.0 27 5.0 28 4.5 29 7.0 30 10.0 31 8.5 32 12.5 33 18.0 34 31.0 35 51.5 36 71.5 37 84.0 38 100.5 39 133.0 40 149.0 41 182.0 42 216.5 43 218.0 44 214.0 45 232.5 46 272.0 47 289.0 48 267.5 49 243.0 50 240.0 51 221.0 52 194.5 53 187.0 54 174.5 55 145.0 56 135.5 57 143.0 58 151.0 59 131.0 60 103.0 61 102.5 62 99.0 63 96.0 64 96.5 65 94.0 66 81.0 67 71.0 68 73.0 69 68.0 70 61.0 71 50.0 72 35.5 73 32.0 74 31.0 75 27.5 76 18.0 77 11.0 78 7.0 79 2.0 80 1.0 81 1.5 82 1.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.05 65 0.15 66 0.3 67 0.775 68 2.75 69 9.950000000000001 70 32.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219791 spots for ERR6146002.sra Written 219791 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra Read 219780 spots for ERR6146002.sra Written 219780 spots for ERR6146002.sra SRR ids: ['ERR6146002.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qj6eo7f4 ERR6146002.sra spots: 4395611 blocks: [[1, 219780], [219781, 439560], [439561, 659340], [659341, 879120], [879121, 1098900], [1098901, 1318680], [1318681, 1538460], [1538461, 1758240], [1758241, 1978020], [1978021, 2197800], [2197801, 2417580], [2417581, 2637360], [2637361, 2857140], [2857141, 3076920], [3076921, 3296700], [3296701, 3516480], [3516481, 3736260], [3736261, 3956040], [3956041, 4175820], [4175821, 4395611]] ERR6146002 file size 779082 ERR6146002 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6146002 ERR6146002_1.fastq ERR6146002_2.fastq Input file: ERR6146002_1.fastq Paired file: ERR6146002_2.fastq trimmed: ERR6146002-trimmed-pair1.fastq, ERR6146002-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:32:27 2024 >> started Sat Dec 7 15:32:33 2024 >> done (6.248s) 4395611 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 41 ( 0.00%) empty read pairs filtered out after trimming by size control 4395570 (100.00%) read pairs available; of these: 27 ( 0.00%) trimmed read pairs available after processing 4395543 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 1 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 3 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 19 0.00% 70 4395543 100.00% 4395570 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=8.80 fanout-score-rank=25 prefix-density=0.12 prefix-fanout=5.3 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=562.68 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=34.9 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=119.82 fanout-score-rank=15 prefix-density=0.85 prefix-fanout=18.5 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=723.53 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=17.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGA ERR6146002 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:32:57 Started mapping on | Dec 07 15:32:57 Finished on | Dec 07 15:33:19 Mapping speed, Million of reads per hour | 719.28 Number of input reads | 4395570 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 4149977 Uniquely mapped reads % | 94.41% Average mapped length | 138.75 Number of splices: Total | 2027987 Number of splices: Annotated (sjdb) | 1934851 Number of splices: GT/AG | 2000348 Number of splices: GC/AG | 24436 Number of splices: AT/AC | 1527 Number of splices: Non-canonical | 1676 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 61407 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 7649 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.54% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 184186 184186 184186 N_multimapping 61407 61407 61407 N_noFeature 96435 4058775 123248 N_ambiguous 72237 391 8010 UnstrandedReadsAssigned:3981305 PositiveStrandReadsAssigned:90811 NegativeStrandReadsAssigned:4018719 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6146002 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6146002-trimmed-pair1.fastq ERR6146002-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,395,570 reads, 4,091,018 reads pseudoaligned [quant] estimated average fragment length: 185.521 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,226 rounds 52973 ERR6146002.ke.tsv 35125 ERR6146002.se.tsv 88098 total ==> ERR6146002.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.745 7.87782 3.85039 PNS24247 1044 859.479 12.0337 5.14438 PNS24249 1928 1743.48 38.796 8.17596 PNS24246 1044 859.479 12.0337 5.14438 PNS24248 1044 859.479 12.0337 5.14438 PNS24244 1471 1286.48 20.2251 5.7764 PNS24243 293 124.938 2 5.88171 KQK14069 1603 1418.48 607.839 157.447 KQK14071 474 292.564 19.3264 24.2716 ==> ERR6146002.se.tsv <== BRADI_1g14170v3 698 BRADI_1g53295v3 9 BRADI_1g59795v3 51 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 324 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 35 BRADI_1g48960v3 0 ERR6146002 completed mapping pipeline successfully