Starting /dee2/code/volunteer_pipeline.sh ERR6146003 current disk space = 1542343868416 free memory = 1602382056 ERR6146003 SRAfilesize ee67b5f5db0d8306b103378fd8622244 ERR6146003.sra ERR6146003.sra file validated ERR6146003 is paired end ERR6146003 is conventional basespace ERR6146003 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146003_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2805 35.0 35.0 35.0 35.0 35.0 2 34.62075 35.0 35.0 35.0 35.0 35.0 3 34.64925 35.0 35.0 35.0 35.0 35.0 4 34.6775 35.0 35.0 35.0 35.0 35.0 5 34.68225 35.0 35.0 35.0 35.0 35.0 6 39.47525 40.0 40.0 40.0 39.0 40.0 7 39.43575 40.0 40.0 40.0 39.0 40.0 8 39.428 40.0 40.0 40.0 39.0 40.0 9 39.435 40.0 40.0 40.0 39.0 40.0 10 39.4295 40.0 40.0 40.0 39.0 40.0 11 39.451 40.0 40.0 40.0 39.0 40.0 12 39.40675 40.0 40.0 40.0 39.0 40.0 13 39.45525 40.0 40.0 40.0 39.0 40.0 14 39.41025 40.0 40.0 40.0 39.0 40.0 15 39.4125 40.0 40.0 40.0 39.0 40.0 16 39.4115 40.0 40.0 40.0 39.0 40.0 17 39.411 40.0 40.0 40.0 39.0 40.0 18 39.417 40.0 40.0 40.0 39.0 40.0 19 39.4015 40.0 40.0 40.0 39.0 40.0 20 39.4265 40.0 40.0 40.0 39.0 40.0 21 39.443 40.0 40.0 40.0 39.0 40.0 22 39.43 40.0 40.0 40.0 39.0 40.0 23 39.3695 40.0 40.0 40.0 39.0 40.0 24 39.2925 40.0 40.0 40.0 39.0 40.0 25 39.4135 40.0 40.0 40.0 39.0 40.0 26 39.40325 40.0 40.0 40.0 39.0 40.0 27 39.39025 40.0 40.0 40.0 39.0 40.0 28 39.35775 40.0 40.0 40.0 39.0 40.0 29 39.42125 40.0 40.0 40.0 39.0 40.0 30 39.4065 40.0 40.0 40.0 39.0 40.0 31 39.35425 40.0 40.0 40.0 39.0 40.0 32 39.48025 40.0 40.0 40.0 39.0 40.0 33 39.425 40.0 40.0 40.0 39.0 40.0 34 39.3595 40.0 40.0 40.0 39.0 40.0 35 39.34875 40.0 40.0 40.0 39.0 40.0 36 39.341 40.0 40.0 40.0 39.0 40.0 37 39.359 40.0 40.0 40.0 39.0 40.0 38 39.31125 40.0 40.0 40.0 39.0 40.0 39 39.34975 40.0 40.0 40.0 39.0 40.0 40 39.40925 40.0 40.0 40.0 39.0 40.0 41 39.33375 40.0 40.0 40.0 39.0 40.0 42 39.35225 40.0 40.0 40.0 39.0 40.0 43 39.36975 40.0 40.0 40.0 39.0 40.0 44 39.34625 40.0 40.0 40.0 39.0 40.0 45 39.39775 40.0 40.0 40.0 39.0 40.0 46 39.388 40.0 40.0 40.0 39.0 40.0 47 39.32875 40.0 40.0 40.0 39.0 40.0 48 39.3495 40.0 40.0 40.0 39.0 40.0 49 39.37575 40.0 40.0 40.0 39.0 40.0 50 39.34575 40.0 40.0 40.0 39.0 40.0 51 39.34 40.0 40.0 40.0 39.0 40.0 52 39.33 40.0 40.0 40.0 39.0 40.0 53 39.38975 40.0 40.0 40.0 39.0 40.0 54 39.291 40.0 40.0 40.0 39.0 40.0 55 39.3125 40.0 40.0 40.0 39.0 40.0 56 39.37 40.0 40.0 40.0 39.0 40.0 57 39.31025 40.0 40.0 40.0 39.0 40.0 58 39.28625 40.0 40.0 40.0 39.0 40.0 59 39.2455 40.0 40.0 40.0 39.0 40.0 60 39.31775 40.0 40.0 40.0 39.0 40.0 61 39.318 40.0 40.0 40.0 39.0 40.0 62 39.34525 40.0 40.0 40.0 39.0 40.0 63 39.368 40.0 40.0 40.0 39.0 40.0 64 39.30525 40.0 40.0 40.0 39.0 40.0 65 39.3215 40.0 40.0 40.0 39.0 40.0 66 39.3335 40.0 40.0 40.0 39.0 40.0 67 39.29575 40.0 40.0 40.0 39.0 40.0 68 39.35975 40.0 40.0 40.0 39.0 40.0 69 39.247 40.0 40.0 40.0 39.0 40.0 70 39.28125 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 3.0 26 6.0 27 9.0 28 7.0 29 12.0 30 17.0 31 19.0 32 29.0 33 30.0 34 36.0 35 48.0 36 69.0 37 122.0 38 231.0 39 3362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.27192317412181 11.220621683093253 10.083396512509477 46.42405863027546 2 21.099999999999998 12.2 35.949999999999996 30.75 3 19.35 16.950000000000003 23.200000000000003 40.5 4 25.224999999999998 23.275000000000002 22.400000000000002 29.099999999999998 5 25.25 28.95 24.8 21.0 6 22.275 29.2 26.275 22.25 7 18.95 24.75 37.125 19.175 8 18.525 24.05 32.625 24.8 9 20.125 22.2 33.324999999999996 24.349999999999998 10 21.55 32.925 23.525 22.0 11 23.825 25.900000000000002 23.925 26.35 12 23.474999999999998 23.05 26.55 26.924999999999997 13 23.9 24.65 24.9 26.55 14 22.675 24.675 27.025 25.624999999999996 15 22.775000000000002 24.65 26.950000000000003 25.624999999999996 16 21.875 25.025 25.7 27.400000000000002 17 23.175 24.349999999999998 26.924999999999997 25.55 18 23.65 24.825 25.5 26.025 19 22.75 26.375 25.05 25.825 20 23.724999999999998 25.75 26.3 24.224999999999998 21 22.7 24.65 26.35 26.3 22 23.075000000000003 26.724999999999998 24.349999999999998 25.85 23 23.1 25.775 25.35 25.775 24 21.8 24.7 27.1 26.400000000000002 25 23.674999999999997 23.775 26.0 26.55 26 23.400000000000002 25.275 25.825 25.5 27 22.025 25.8 25.124999999999996 27.05 28 22.775000000000002 25.0 26.1 26.125 29 23.25 24.55 26.275 25.924999999999997 30 23.849999999999998 25.124999999999996 25.124999999999996 25.900000000000002 31 22.825 25.825 25.45 25.900000000000002 32 24.7 25.974999999999998 24.525 24.8 33 21.7 24.325 26.424999999999997 27.55 34 22.6 26.1 24.6 26.700000000000003 35 22.900000000000002 24.625 26.6 25.874999999999996 36 22.875 24.9 25.724999999999998 26.5 37 22.975 25.775 25.074999999999996 26.174999999999997 38 23.425 26.224999999999998 24.224999999999998 26.125 39 22.125 26.55 25.650000000000002 25.674999999999997 40 23.830957739434858 25.18129532383096 23.705926481620406 27.28182045511378 41 23.455863965991497 25.806451612903224 25.481370342585645 25.256314078519633 42 23.755938984746187 24.781195298824706 24.756189047261813 26.70667666916729 43 23.605901475368842 25.95648912228057 24.056014003500874 26.38159539884971 44 24.356089022255563 24.18104526131533 26.25656414103526 25.206301575393848 45 23.10577644411103 24.431107776944234 25.63140785196299 26.831707926981746 46 23.43085771442861 25.206301575393848 24.90622655663916 26.456614153538382 47 23.15578894723681 25.831457864466117 25.381345336334082 25.63140785196299 48 22.85571392848212 25.731432858214554 24.056014003500874 27.35683920980245 49 23.305826456614152 25.95648912228057 26.03150787696924 24.706176544136035 50 23.40585146286572 25.806451612903224 26.356589147286826 24.431107776944234 51 22.73068267066767 24.33108277069267 25.95648912228057 26.981745436359088 52 23.95598899724931 24.781195298824706 25.156289072268066 26.106526631657918 53 23.10577644411103 25.456364091022753 25.6064016004001 25.831457864466117 54 23.055763940985248 24.431107776944234 25.35633908477119 27.156789197299325 55 24.356089022255563 24.781195298824706 24.88122030507627 25.98149537384346 56 23.58089522380595 25.28132033008252 25.03125781445361 26.106526631657918 57 22.80570142535634 25.156289072268066 25.531382845711427 26.506626656664167 58 23.755938984746187 26.556639159789945 22.755688922230558 26.93173293323331 59 23.1807951987997 25.531382845711427 25.481370342585645 25.806451612903224 60 24.281070267566893 24.8062015503876 23.905976494123532 27.00675168792198 61 24.23105776444111 25.656414103525883 24.18104526131533 25.93148287071768 62 23.95598899724931 25.98149537384346 24.731182795698924 25.331332833208304 63 22.705676419104776 26.331582895723933 25.456364091022753 25.506376594148538 64 23.030757689422355 26.831707926981746 24.781195298824706 25.35633908477119 65 24.112056028014006 25.337668834417208 25.63781890945473 24.912456228114056 66 23.371743486973948 24.874749498997996 25.60120240480962 26.152304609218437 67 23.91851106639839 25.15090543259557 24.220321931589535 26.7102615694165 68 22.876151484135107 24.15557830092119 27.047082906857728 25.92118730808598 69 22.90349188891944 20.291448996425625 27.165246081935663 29.639813032719275 70 26.587887740029544 0.0 35.30280649926144 38.10930576070901 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 4.5 27 7.0 28 6.5 29 8.0 30 10.0 31 13.5 32 24.0 33 31.0 34 44.5 35 73.0 36 97.5 37 107.0 38 127.5 39 172.5 40 197.0 41 206.5 42 237.5 43 259.0 44 263.5 45 273.0 46 264.5 47 251.0 48 265.0 49 253.0 50 227.0 51 210.0 52 203.0 53 213.0 54 182.5 55 148.0 56 134.5 57 125.0 58 109.5 59 97.0 60 100.0 61 86.5 62 79.0 63 85.0 64 83.0 65 76.0 66 67.0 67 63.0 68 58.0 69 39.5 70 26.0 71 24.5 72 20.0 73 17.0 74 15.0 75 10.5 76 7.0 77 6.0 78 5.0 79 3.0 80 2.0 81 2.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.025 42 0.025 43 0.025 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.2 67 0.6 68 2.3 69 9.075 70 32.300000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6146003 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146003_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2575 35.0 35.0 35.0 33.0 35.0 2 34.068 35.0 35.0 35.0 32.0 35.0 3 34.22725 35.0 35.0 35.0 33.0 35.0 4 34.259 35.0 35.0 35.0 33.0 35.0 5 34.15275 35.0 35.0 35.0 33.0 35.0 6 38.89375 40.0 40.0 40.0 38.0 40.0 7 38.87425 40.0 40.0 40.0 38.0 40.0 8 38.8205 40.0 40.0 40.0 38.0 40.0 9 38.91025 40.0 40.0 40.0 38.0 40.0 10 38.878 40.0 40.0 40.0 38.0 40.0 11 38.879 40.0 40.0 40.0 38.0 40.0 12 38.9135 40.0 40.0 40.0 38.0 40.0 13 38.9605 40.0 40.0 40.0 38.0 40.0 14 38.91025 40.0 40.0 40.0 38.0 40.0 15 38.9175 40.0 40.0 40.0 38.0 40.0 16 38.89825 40.0 40.0 40.0 38.0 40.0 17 38.88025 40.0 40.0 40.0 39.0 40.0 18 38.91675 40.0 40.0 40.0 38.0 40.0 19 38.981 40.0 40.0 40.0 38.0 40.0 20 38.86 40.0 40.0 40.0 38.0 40.0 21 38.895 40.0 40.0 40.0 38.0 40.0 22 38.80375 40.0 40.0 40.0 38.0 40.0 23 38.89 40.0 40.0 40.0 38.0 40.0 24 38.918 40.0 40.0 40.0 38.0 40.0 25 38.92875 40.0 40.0 40.0 39.0 40.0 26 38.96225 40.0 40.0 40.0 39.0 40.0 27 38.9355 40.0 40.0 40.0 39.0 40.0 28 38.86175 40.0 40.0 40.0 39.0 40.0 29 38.8745 40.0 40.0 40.0 38.0 40.0 30 38.883 40.0 40.0 40.0 38.0 40.0 31 38.83425 40.0 40.0 40.0 38.0 40.0 32 38.908 40.0 40.0 40.0 38.0 40.0 33 38.88475 40.0 40.0 40.0 38.0 40.0 34 38.933 40.0 40.0 40.0 38.0 40.0 35 38.879 40.0 40.0 40.0 38.0 40.0 36 38.80325 40.0 40.0 40.0 38.0 40.0 37 38.869 40.0 40.0 40.0 38.0 40.0 38 38.864 40.0 40.0 40.0 38.0 40.0 39 38.78425 40.0 40.0 40.0 38.0 40.0 40 38.8205 40.0 40.0 40.0 38.0 40.0 41 38.8045 40.0 40.0 40.0 38.0 40.0 42 38.82325 40.0 40.0 40.0 38.0 40.0 43 38.81525 40.0 40.0 40.0 38.0 40.0 44 38.88 40.0 40.0 40.0 38.0 40.0 45 38.795 40.0 40.0 40.0 38.0 40.0 46 38.7595 40.0 40.0 40.0 38.0 40.0 47 38.77025 40.0 40.0 40.0 38.0 40.0 48 38.7755 40.0 40.0 40.0 38.0 40.0 49 38.76475 40.0 40.0 40.0 38.0 40.0 50 38.77925 40.0 40.0 40.0 38.0 40.0 51 38.73575 40.0 40.0 40.0 38.0 40.0 52 38.60125 40.0 40.0 40.0 37.0 40.0 53 38.7455 40.0 40.0 40.0 37.0 40.0 54 38.70325 40.0 40.0 40.0 37.0 40.0 55 38.77475 40.0 40.0 40.0 38.0 40.0 56 38.73725 40.0 40.0 40.0 38.0 40.0 57 38.70325 40.0 40.0 40.0 38.0 40.0 58 38.75525 40.0 40.0 40.0 38.0 40.0 59 38.85025 40.0 40.0 40.0 38.0 40.0 60 38.783 40.0 40.0 40.0 38.0 40.0 61 38.839 40.0 40.0 40.0 38.0 40.0 62 38.817 40.0 40.0 40.0 38.0 40.0 63 38.723 40.0 40.0 40.0 38.0 40.0 64 38.79025 40.0 40.0 40.0 38.0 40.0 65 38.75325 40.0 40.0 40.0 37.0 40.0 66 38.73225 40.0 40.0 40.0 37.0 40.0 67 38.679 40.0 40.0 40.0 37.0 40.0 68 38.64775 40.0 40.0 40.0 37.0 40.0 69 38.731 40.0 40.0 40.0 38.0 40.0 70 38.63425 40.0 40.0 40.0 37.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 6.0 20 10.0 21 10.0 22 20.0 23 16.0 24 20.0 25 11.0 26 13.0 27 17.0 28 23.0 29 20.0 30 17.0 31 25.0 32 34.0 33 27.0 34 30.0 35 59.0 36 69.0 37 95.0 38 278.0 39 3198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.349999999999998 18.7 12.8 38.15 2 27.175 24.575 28.475 19.775000000000002 3 20.424999999999997 26.025 27.800000000000004 25.75 4 26.625 28.449999999999996 20.25 24.675 5 27.725 31.775 20.325 20.175 6 22.225 32.85 22.900000000000002 22.025 7 23.474999999999998 18.925 32.65 24.95 8 23.400000000000002 21.825 26.025 28.749999999999996 9 22.275 22.8 28.799999999999997 26.125 10 24.975 29.599999999999998 22.650000000000002 22.775000000000002 11 28.549999999999997 23.0 21.25 27.200000000000003 12 26.575 21.2 24.85 27.375 13 26.35 23.75 24.125 25.775 14 24.975 26.174999999999997 24.025 24.825 15 24.45 25.35 24.775 25.424999999999997 16 27.35 23.400000000000002 23.974999999999998 25.275 17 27.0 24.575 23.974999999999998 24.45 18 24.65 26.575 24.4 24.375 19 26.525 23.599999999999998 23.549999999999997 26.325 20 26.6 25.7 23.35 24.349999999999998 21 24.425 25.724999999999998 24.0 25.85 22 25.85 25.525 23.1 25.525 23 25.174999999999997 26.35 24.15 24.325 24 23.575 25.974999999999998 25.275 25.174999999999997 25 27.075 24.224999999999998 24.05 24.65 26 25.8 25.424999999999997 24.3 24.474999999999998 27 24.875 25.275 24.25 25.6 28 26.650000000000002 24.15 24.85 24.349999999999998 29 26.575 25.525 23.025000000000002 24.875 30 24.575 25.2 25.474999999999998 24.75 31 25.624999999999996 24.9 23.95 25.525 32 26.25 26.325 23.474999999999998 23.95 33 25.25 24.85 25.15 24.75 34 26.174999999999997 24.075 24.725 25.025 35 25.2 26.650000000000002 24.5 23.65 36 25.674999999999997 24.325 25.324999999999996 24.675 37 25.924999999999997 23.674999999999997 24.3 26.1 38 25.275 25.85 24.0 24.875 39 24.8 26.424999999999997 24.375 24.4 40 27.25681420355089 23.88097024256064 24.15603900975244 24.706176544136035 41 26.506626656664167 25.656414103525883 24.33108277069267 23.50587646911728 42 26.60665166291573 24.781195298824706 24.60615153788447 24.006001500375092 43 26.206551637909474 25.23130782695674 23.53088272068017 25.03125781445361 44 25.431357839459867 26.531632908227053 23.58089522380595 24.456114028507127 45 24.831207801950487 25.23130782695674 25.831457864466117 24.10602650662666 46 27.53188297074269 25.131282820705174 24.15603900975244 23.1807951987997 47 26.006501625406354 24.681170292573142 24.006001500375092 25.30632658164541 48 24.656164041010253 24.58114528632158 25.55638909727432 25.206301575393848 49 25.98149537384346 24.58114528632158 25.081270317579396 24.356089022255563 50 26.556639159789945 25.381345336334082 23.85596399099775 24.20605151287822 51 26.106526631657918 25.331332833208304 24.63115778944736 23.93098274568642 52 27.656914228557138 24.781195298824706 23.20580145036259 24.356089022255563 53 26.406601650412604 25.681420355088775 24.406101525381345 23.50587646911728 54 26.18154538634659 25.78144536134033 24.306076519129782 23.730932733183295 55 25.456364091022753 25.70642660665166 24.18104526131533 24.656164041010253 56 26.156539134783696 26.881720430107524 24.081020255063766 22.88072018004501 57 25.156289072268066 26.431607901975497 24.356089022255563 24.056014003500874 58 27.106776694173547 23.755938984746187 24.681170292573142 24.456114028507127 59 26.60665166291573 25.70642660665166 24.20605151287822 23.48087021755439 60 25.456364091022753 24.281070267566893 25.806451612903224 24.456114028507127 61 26.456614153538382 24.031007751937985 24.756189047261813 24.756189047261813 62 26.60665166291573 25.756439109777446 24.33108277069267 23.305826456614152 63 25.23130782695674 25.28132033008252 25.381345336334082 24.10602650662666 64 27.106776694173547 24.031007751937985 24.60615153788447 24.256064016004 65 26.70667666916729 25.331332833208304 24.256064016004 23.705926481620406 66 25.38808212318478 25.338007010515774 25.363044566850274 23.910866299449175 67 26.25599596061601 23.983842464024235 25.422873011865693 24.337288563494067 68 27.48267898383372 23.094688221709006 24.967924044136517 24.45470875032076 69 25.77578976796198 19.87699189264747 28.37573385518591 25.971484484204645 70 27.306547619047617 0.0 35.342261904761905 37.351190476190474 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 2.0 26 2.0 27 2.0 28 6.5 29 8.5 30 6.0 31 11.5 32 23.5 33 30.0 34 30.0 35 55.0 36 84.0 37 88.0 38 116.5 39 159.0 40 173.0 41 188.5 42 209.0 43 214.0 44 232.0 45 258.5 46 262.0 47 257.0 48 240.5 49 240.5 50 257.0 51 235.5 52 206.5 53 199.0 54 194.0 55 167.0 56 139.5 57 134.0 58 128.5 59 119.0 60 115.0 61 105.0 62 89.5 63 84.0 64 90.0 65 83.0 66 66.0 67 62.0 68 64.0 69 59.0 70 52.0 71 44.0 72 28.5 73 21.0 74 18.0 75 12.5 76 7.5 77 5.0 78 5.5 79 4.5 80 3.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.025 41 0.025 42 0.025 43 0.025 44 0.025 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.025 66 0.15 67 0.975 68 2.5749999999999997 69 10.575 70 32.800000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266760 spots for ERR6146003.sra Written 266760 spots for ERR6146003.sra Read 266770 spots for ERR6146003.sra Written 266770 spots for ERR6146003.sra SRR ids: ['ERR6146003.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nun508wo ERR6146003.sra spots: 5335210 blocks: [[1, 266760], [266761, 533520], [533521, 800280], [800281, 1067040], [1067041, 1333800], [1333801, 1600560], [1600561, 1867320], [1867321, 2134080], [2134081, 2400840], [2400841, 2667600], [2667601, 2934360], [2934361, 3201120], [3201121, 3467880], [3467881, 3734640], [3734641, 4001400], [4001401, 4268160], [4268161, 4534920], [4534921, 4801680], [4801681, 5068440], [5068441, 5335210]] ERR6146003 file size 946081 ERR6146003 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6146003 ERR6146003_1.fastq ERR6146003_2.fastq Input file: ERR6146003_1.fastq Paired file: ERR6146003_2.fastq trimmed: ERR6146003-trimmed-pair1.fastq, ERR6146003-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:35:22 2024 >> started Sat Dec 7 15:35:28 2024 >> done (5.341s) 5335210 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 12 ( 0.00%) empty read pairs filtered out after trimming by size control 5335198 (100.00%) read pairs available; of these: 17 ( 0.00%) trimmed read pairs available after processing 5335181 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 52 1 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 1 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 15 0.00% 70 5335181 100.00% 5335198 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=7.24 fanout-score-rank=29 prefix-density=0.11 prefix-fanout=4.8 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=8 fanout-score=517.36 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=34.2 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=103.79 fanout-score-rank=14 prefix-density=0.84 prefix-fanout=16.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=670.74 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=15.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR6146003 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:37:05 Started mapping on | Dec 07 15:37:05 Finished on | Dec 07 15:37:26 Mapping speed, Million of reads per hour | 914.61 Number of input reads | 5335198 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 5031349 Uniquely mapped reads % | 94.30% Average mapped length | 138.75 Number of splices: Total | 2518924 Number of splices: Annotated (sjdb) | 2397467 Number of splices: GT/AG | 2485033 Number of splices: GC/AG | 29809 Number of splices: AT/AC | 1919 Number of splices: Non-canonical | 2163 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 76460 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 8751 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 227389 227389 227389 N_multimapping 76460 76460 76460 N_noFeature 131003 4919987 161126 N_ambiguous 91098 500 10078 UnstrandedReadsAssigned:4809248 PositiveStrandReadsAssigned:110862 NegativeStrandReadsAssigned:4860145 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6146003 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6146003-trimmed-pair1.fastq ERR6146003-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,335,198 reads, 4,944,746 reads pseudoaligned [quant] estimated average fragment length: 188.969 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52973 ERR6146003.ke.tsv 35125 ERR6146003.se.tsv 88098 total ==> ERR6146003.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.24 0 0 PNS24247 1044 856.031 26.7425 9.34569 PNS24249 1928 1740.03 9.55935 1.6435 PNS24246 1044 856.031 26.7425 9.34569 PNS24248 1044 856.031 26.7425 9.34569 PNS24244 1471 1283.03 43.2131 10.0758 PNS24243 293 123.33 0 0 KQK14069 1603 1415.03 689.876 145.849 KQK14071 474 289.751 13.7264 14.172 ==> ERR6146003.se.tsv <== BRADI_1g14170v3 786 BRADI_1g53295v3 25 BRADI_1g59795v3 74 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 450 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 63 BRADI_1g48960v3 0 ERR6146003 completed mapping pipeline successfully