Starting /dee2/code/volunteer_pipeline.sh ERR6146004 current disk space = 1542347481088 free memory = 1601607364 ERR6146004 SRAfilesize 63feb62ec5bf20aca5c42246292f7df9 ERR6146004.sra ERR6146004.sra file validated ERR6146004 is paired end ERR6146004 is conventional basespace ERR6146004 read1 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146004_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3525 35.0 35.0 35.0 35.0 35.0 2 34.59875 35.0 35.0 35.0 35.0 35.0 3 34.6745 35.0 35.0 35.0 35.0 35.0 4 34.6765 35.0 35.0 35.0 35.0 35.0 5 34.6635 35.0 35.0 35.0 35.0 35.0 6 39.39875 40.0 40.0 40.0 39.0 40.0 7 39.4475 40.0 40.0 40.0 39.0 40.0 8 39.35225 40.0 40.0 40.0 39.0 40.0 9 39.45325 40.0 40.0 40.0 39.0 40.0 10 39.5005 40.0 40.0 40.0 39.0 40.0 11 39.41 40.0 40.0 40.0 39.0 40.0 12 39.4935 40.0 40.0 40.0 39.0 40.0 13 39.4145 40.0 40.0 40.0 39.0 40.0 14 39.3975 40.0 40.0 40.0 39.0 40.0 15 39.43175 40.0 40.0 40.0 39.0 40.0 16 39.47575 40.0 40.0 40.0 39.0 40.0 17 39.37525 40.0 40.0 40.0 39.0 40.0 18 39.3635 40.0 40.0 40.0 39.0 40.0 19 39.40725 40.0 40.0 40.0 39.0 40.0 20 39.386 40.0 40.0 40.0 39.0 40.0 21 39.414 40.0 40.0 40.0 39.0 40.0 22 39.37525 40.0 40.0 40.0 39.0 40.0 23 39.37975 40.0 40.0 40.0 39.0 40.0 24 39.393 40.0 40.0 40.0 39.0 40.0 25 39.3685 40.0 40.0 40.0 39.0 40.0 26 39.384 40.0 40.0 40.0 39.0 40.0 27 39.3485 40.0 40.0 40.0 39.0 40.0 28 39.356 40.0 40.0 40.0 39.0 40.0 29 39.35325 40.0 40.0 40.0 39.0 40.0 30 39.377 40.0 40.0 40.0 39.0 40.0 31 39.34425 40.0 40.0 40.0 39.0 40.0 32 39.2885 40.0 40.0 40.0 39.0 40.0 33 39.35875 40.0 40.0 40.0 39.0 40.0 34 39.33225 40.0 40.0 40.0 39.0 40.0 35 39.37275 40.0 40.0 40.0 39.0 40.0 36 39.39025 40.0 40.0 40.0 39.0 40.0 37 39.3965 40.0 40.0 40.0 39.0 40.0 38 39.35225 40.0 40.0 40.0 39.0 40.0 39 39.33525 40.0 40.0 40.0 39.0 40.0 40 39.3085 40.0 40.0 40.0 39.0 40.0 41 39.3145 40.0 40.0 40.0 39.0 40.0 42 39.27525 40.0 40.0 40.0 39.0 40.0 43 39.2995 40.0 40.0 40.0 39.0 40.0 44 39.314 40.0 40.0 40.0 39.0 40.0 45 39.2965 40.0 40.0 40.0 39.0 40.0 46 39.22975 40.0 40.0 40.0 39.0 40.0 47 39.23725 40.0 40.0 40.0 39.0 40.0 48 39.28675 40.0 40.0 40.0 39.0 40.0 49 39.33775 40.0 40.0 40.0 39.0 40.0 50 39.31375 40.0 40.0 40.0 39.0 40.0 51 39.3095 40.0 40.0 40.0 39.0 40.0 52 39.3195 40.0 40.0 40.0 39.0 40.0 53 39.3465 40.0 40.0 40.0 39.0 40.0 54 39.3515 40.0 40.0 40.0 39.0 40.0 55 39.31625 40.0 40.0 40.0 39.0 40.0 56 39.334 40.0 40.0 40.0 39.0 40.0 57 39.1925 40.0 40.0 40.0 39.0 40.0 58 39.156 40.0 40.0 40.0 39.0 40.0 59 39.28625 40.0 40.0 40.0 39.0 40.0 60 39.304 40.0 40.0 40.0 39.0 40.0 61 39.3205 40.0 40.0 40.0 39.0 40.0 62 39.298 40.0 40.0 40.0 39.0 40.0 63 39.29725 40.0 40.0 40.0 39.0 40.0 64 39.26575 40.0 40.0 40.0 39.0 40.0 65 39.2995 40.0 40.0 40.0 39.0 40.0 66 39.29125 40.0 40.0 40.0 39.0 40.0 67 39.27375 40.0 40.0 40.0 39.0 40.0 68 39.32875 40.0 40.0 40.0 39.0 40.0 69 39.32525 40.0 40.0 40.0 39.0 40.0 70 39.24925 40.0 40.0 40.0 39.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 8.0 27 6.0 28 4.0 29 17.0 30 15.0 31 26.0 32 20.0 33 32.0 34 49.0 35 58.0 36 78.0 37 94.0 38 213.0 39 3375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.71216318307731 10.098212037270208 9.770838579702845 47.418786199949636 2 21.175 13.225000000000001 36.25 29.349999999999998 3 20.625 16.175 22.5 40.699999999999996 4 25.4 23.35 23.025000000000002 28.225 5 26.3 28.549999999999997 24.0 21.15 6 21.9 30.049999999999997 25.650000000000002 22.400000000000002 7 19.375 23.925 35.55 21.15 8 19.075 22.900000000000002 33.25 24.775 9 18.875 23.325000000000003 33.2 24.6 10 20.349999999999998 33.25 24.65 21.75 11 24.85 24.349999999999998 23.974999999999998 26.825 12 23.474999999999998 22.1 26.450000000000003 27.975 13 21.45 23.35 27.675 27.525 14 22.775000000000002 23.825 27.650000000000002 25.75 15 23.474999999999998 24.7 26.35 25.474999999999998 16 23.45 24.7 25.0 26.85 17 23.075000000000003 26.224999999999998 26.424999999999997 24.275 18 23.875 24.349999999999998 24.725 27.05 19 22.2 25.1 25.75 26.950000000000003 20 22.8 25.324999999999996 25.900000000000002 25.974999999999998 21 23.05 24.9 25.4 26.650000000000002 22 22.725 26.05 24.55 26.674999999999997 23 22.8 25.4 26.0 25.8 24 22.625 24.7 26.974999999999998 25.7 25 22.575 25.3 25.525 26.6 26 21.675 25.424999999999997 26.400000000000002 26.5 27 23.225 25.974999999999998 26.025 24.775 28 22.925 25.275 24.6 27.200000000000003 29 22.675 25.900000000000002 25.05 26.375 30 22.3 25.825 25.674999999999997 26.200000000000003 31 22.7 26.224999999999998 25.2 25.874999999999996 32 22.625 26.150000000000002 26.450000000000003 24.775 33 22.1 24.8 26.3 26.8 34 23.25 25.324999999999996 24.675 26.75 35 22.7 25.75 25.674999999999997 25.874999999999996 36 22.575 24.75 25.624999999999996 27.05 37 22.825 24.575 25.624999999999996 26.974999999999998 38 21.975 25.650000000000002 26.424999999999997 25.95 39 23.474999999999998 23.849999999999998 25.324999999999996 27.35 40 23.974999999999998 25.674999999999997 24.45 25.900000000000002 41 24.3 25.025 25.7 24.975 42 23.025000000000002 25.5 25.324999999999996 26.150000000000002 43 23.575 25.35 24.099999999999998 26.974999999999998 44 22.175 26.075 26.525 25.224999999999998 45 22.55 25.224999999999998 26.1 26.125 46 23.45 24.975 24.349999999999998 27.224999999999998 47 23.5 25.4 26.825 24.275 48 21.9 25.775 26.5 25.825 49 23.775 25.724999999999998 24.175 26.325 50 24.224999999999998 24.65 25.650000000000002 25.474999999999998 51 24.099999999999998 25.35 24.325 26.224999999999998 52 23.330832708177045 26.081520380095025 24.306076519129782 26.281570392598148 53 22.73068267066767 24.031007751937985 26.63165791447862 26.60665166291573 54 22.48062015503876 26.281570392598148 25.93148287071768 25.30632658164541 55 23.80595148787197 24.006001500375092 26.106526631657918 26.081520380095025 56 22.9057264316079 25.23130782695674 24.63115778944736 27.231807951987996 57 22.455613903475868 25.056264066016503 26.081520380095025 26.406601650412604 58 22.85571392848212 25.28132033008252 26.431607901975497 25.431357839459867 59 22.030507626906726 25.78144536134033 25.331332833208304 26.85671417854464 60 23.58089522380595 24.50612653163291 25.156289072268066 26.756689172293076 61 23.78094523630908 24.756189047261813 25.406351587896975 26.056514128532132 62 22.680670167541887 26.231557889472366 26.331582895723933 24.756189047261813 63 24.20605151287822 25.381345336334082 25.30632658164541 25.10627656914228 64 23.655913978494624 25.63140785196299 24.90622655663916 25.806451612903224 65 21.76088044022011 26.513256628314156 26.76338169084542 24.96248124062031 66 23.082706766917294 24.561403508771928 25.46365914786967 26.8922305764411 67 23.547169811320753 25.962264150943398 24.37735849056604 26.113207547169807 68 22.719141323792485 25.32583695374393 26.399182213135703 25.555839509327882 69 24.401650618982117 18.927097661623108 29.573590096286107 27.097661623108664 70 25.52954292084727 0.0 35.19137866963954 39.27907840951319 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.0 26 4.0 27 5.0 28 7.0 29 10.5 30 12.0 31 21.5 32 33.0 33 35.0 34 48.0 35 67.5 36 90.0 37 106.0 38 127.0 39 171.5 40 195.0 41 203.5 42 233.0 43 254.0 44 267.0 45 265.0 46 263.5 47 277.0 48 268.5 49 250.0 50 240.0 51 227.5 52 206.5 53 198.0 54 180.0 55 147.5 56 122.5 57 112.0 58 106.5 59 105.5 60 110.0 61 98.0 62 91.0 63 96.0 64 80.0 65 62.0 66 58.5 67 57.0 68 47.0 69 34.5 70 32.0 71 31.5 72 24.5 73 18.0 74 16.5 75 10.5 76 7.0 77 8.0 78 5.0 79 1.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.25 67 0.625 68 2.175 69 9.125 70 32.725 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR6146004 read2 length is 70 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR6146004_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.27375 35.0 35.0 35.0 33.0 35.0 2 34.15225 35.0 35.0 35.0 32.0 35.0 3 34.2335 35.0 35.0 35.0 33.0 35.0 4 34.18075 35.0 35.0 35.0 33.0 35.0 5 34.1805 35.0 35.0 35.0 33.0 35.0 6 38.90225 40.0 40.0 40.0 38.0 40.0 7 38.915 40.0 40.0 40.0 38.0 40.0 8 38.7315 40.0 40.0 40.0 38.0 40.0 9 38.8585 40.0 40.0 40.0 38.0 40.0 10 38.86475 40.0 40.0 40.0 38.0 40.0 11 38.889 40.0 40.0 40.0 38.0 40.0 12 38.8705 40.0 40.0 40.0 38.0 40.0 13 38.9025 40.0 40.0 40.0 38.0 40.0 14 38.85975 40.0 40.0 40.0 38.0 40.0 15 38.90625 40.0 40.0 40.0 38.0 40.0 16 38.88975 40.0 40.0 40.0 38.0 40.0 17 38.8745 40.0 40.0 40.0 38.0 40.0 18 38.818 40.0 40.0 40.0 38.0 40.0 19 38.89675 40.0 40.0 40.0 38.0 40.0 20 38.94225 40.0 40.0 40.0 38.0 40.0 21 38.88375 40.0 40.0 40.0 38.0 40.0 22 38.9275 40.0 40.0 40.0 38.0 40.0 23 38.9685 40.0 40.0 40.0 38.0 40.0 24 38.89475 40.0 40.0 40.0 38.0 40.0 25 38.84925 40.0 40.0 40.0 38.0 40.0 26 38.81325 40.0 40.0 40.0 38.0 40.0 27 38.81 40.0 40.0 40.0 38.0 40.0 28 38.882 40.0 40.0 40.0 38.0 40.0 29 38.928 40.0 40.0 40.0 38.0 40.0 30 38.9015 40.0 40.0 40.0 38.0 40.0 31 38.928 40.0 40.0 40.0 38.0 40.0 32 38.90325 40.0 40.0 40.0 38.0 40.0 33 38.90675 40.0 40.0 40.0 38.0 40.0 34 38.91025 40.0 40.0 40.0 38.0 40.0 35 38.8905 40.0 40.0 40.0 38.0 40.0 36 38.902 40.0 40.0 40.0 38.0 40.0 37 38.80175 40.0 40.0 40.0 38.0 40.0 38 38.91275 40.0 40.0 40.0 38.0 40.0 39 38.89075 40.0 40.0 40.0 38.0 40.0 40 38.968 40.0 40.0 40.0 38.0 40.0 41 38.81775 40.0 40.0 40.0 38.0 40.0 42 38.843 40.0 40.0 40.0 38.0 40.0 43 38.8015 40.0 40.0 40.0 38.0 40.0 44 38.713 40.0 40.0 40.0 37.0 40.0 45 38.8095 40.0 40.0 40.0 38.0 40.0 46 38.7945 40.0 40.0 40.0 38.0 40.0 47 38.737 40.0 40.0 40.0 38.0 40.0 48 38.7605 40.0 40.0 40.0 38.0 40.0 49 38.847 40.0 40.0 40.0 38.0 40.0 50 38.86875 40.0 40.0 40.0 38.0 40.0 51 38.862 40.0 40.0 40.0 38.0 40.0 52 38.84475 40.0 40.0 40.0 38.0 40.0 53 38.7625 40.0 40.0 40.0 38.0 40.0 54 38.7575 40.0 40.0 40.0 38.0 40.0 55 38.8375 40.0 40.0 40.0 38.0 40.0 56 38.8005 40.0 40.0 40.0 38.0 40.0 57 38.88425 40.0 40.0 40.0 38.0 40.0 58 38.80225 40.0 40.0 40.0 38.0 40.0 59 38.8265 40.0 40.0 40.0 38.0 40.0 60 38.75675 40.0 40.0 40.0 38.0 40.0 61 38.7975 40.0 40.0 40.0 38.0 40.0 62 38.80425 40.0 40.0 40.0 38.0 40.0 63 38.78875 40.0 40.0 40.0 38.0 40.0 64 38.7585 40.0 40.0 40.0 38.0 40.0 65 38.758 40.0 40.0 40.0 38.0 40.0 66 38.77475 40.0 40.0 40.0 38.0 40.0 67 38.737 40.0 40.0 40.0 38.0 40.0 68 38.72775 40.0 40.0 40.0 37.0 40.0 69 38.6985 40.0 40.0 40.0 38.0 40.0 70 38.73175 40.0 40.0 40.0 38.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 7.0 20 14.0 21 17.0 22 14.0 23 9.0 24 14.0 25 17.0 26 12.0 27 16.0 28 19.0 29 20.0 30 17.0 31 20.0 32 38.0 33 32.0 34 26.0 35 45.0 36 81.0 37 115.0 38 256.0 39 3209.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.049999999999997 19.075 12.7 39.175 2 26.575 25.15 30.325000000000003 17.95 3 20.825 24.975 28.525 25.674999999999997 4 26.0 28.625 21.825 23.549999999999997 5 28.925 32.324999999999996 20.325 18.425 6 22.325 32.275 22.775000000000002 22.625 7 23.799999999999997 19.5 33.475 23.225 8 23.525 21.425 27.700000000000003 27.35 9 23.775 23.3 28.249999999999996 24.675 10 25.25 30.775000000000002 21.975 22.0 11 27.05 24.075 20.625 28.249999999999996 12 26.974999999999998 21.65 25.174999999999997 26.200000000000003 13 25.474999999999998 24.175 24.349999999999998 26.0 14 25.3 26.625 23.525 24.55 15 25.3 24.95 24.175 25.575 16 26.0 25.15 23.7 25.15 17 26.974999999999998 24.5 23.775 24.75 18 25.8 25.5 24.25 24.45 19 25.7 25.374999999999996 23.775 25.15 20 26.424999999999997 25.35 23.325000000000003 24.9 21 25.900000000000002 26.0 24.224999999999998 23.875 22 25.775 25.174999999999997 23.849999999999998 25.2 23 25.900000000000002 25.0 24.65 24.45 24 25.224999999999998 25.0 25.05 24.725 25 26.05 24.8 24.125 25.025 26 26.5 24.224999999999998 25.8 23.474999999999998 27 25.525 25.424999999999997 25.05 24.0 28 26.8 25.174999999999997 23.674999999999997 24.349999999999998 29 27.125 25.4 23.325000000000003 24.15 30 25.0 25.174999999999997 25.525 24.3 31 26.674999999999997 24.4 24.275 24.65 32 27.200000000000003 25.624999999999996 24.099999999999998 23.075000000000003 33 24.6 25.3 24.725 25.374999999999996 34 25.5 24.3 25.5 24.7 35 26.200000000000003 25.025 25.8 22.975 36 24.2 26.075 24.55 25.174999999999997 37 26.200000000000003 24.6 22.875 26.325 38 26.974999999999998 26.125 23.65 23.25 39 24.175 26.325 24.474999999999998 25.025 40 26.55 25.874999999999996 23.525 24.05 41 26.400000000000002 25.674999999999997 23.674999999999997 24.25 42 24.925 25.974999999999998 25.074999999999996 24.025 43 27.35 23.7 24.7 24.25 44 25.900000000000002 25.474999999999998 24.675 23.95 45 24.575 26.025 24.45 24.95 46 27.125 24.05 24.9 23.925 47 27.375 25.55 23.225 23.849999999999998 48 25.2 25.3 26.0 23.5 49 25.25 25.0 26.200000000000003 23.549999999999997 50 25.45 26.1 23.95 24.5 51 24.525 25.525 26.05 23.9 52 26.506626656664167 23.93098274568642 25.18129532383096 24.381095273818453 53 26.6816704176044 26.481620405101275 24.431107776944234 22.405601400350086 54 26.156539134783696 25.406351587896975 25.431357839459867 23.005751437859466 55 26.506626656664167 25.206301575393848 24.756189047261813 23.53088272068017 56 26.63165791447862 25.63140785196299 24.406101525381345 23.330832708177045 57 25.481370342585645 25.656414103525883 24.8062015503876 24.056014003500874 58 25.456364091022753 25.481370342585645 23.830957739434858 25.23130782695674 59 25.006251562890725 26.406601650412604 24.281070267566893 24.306076519129782 60 24.981245311327832 25.156289072268066 25.581395348837212 24.281070267566893 61 25.481370342585645 25.206301575393848 25.081270317579396 24.23105776444111 62 26.431607901975497 24.656164041010253 25.431357839459867 23.48087021755439 63 26.081520380095025 25.481370342585645 24.256064016004 24.18104526131533 64 26.531632908227053 24.20605151287822 25.756439109777446 23.50587646911728 65 25.962981490745374 25.71285642821411 25.062531265632813 23.261630815407706 66 25.651302605210418 25.450901803607213 24.498997995991985 24.39879759519038 67 26.198889449772842 25.164058556284708 24.58354366481575 24.053508329126704 68 27.08762886597938 23.09278350515464 24.355670103092784 25.463917525773194 69 25.96234897443102 19.2469794886204 27.198651306546783 27.592020230401797 70 27.547169811320753 0.0 37.056603773584904 35.39622641509434 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.0 27 1.0 28 2.0 29 9.5 30 16.0 31 19.5 32 26.5 33 30.0 34 37.0 35 66.0 36 101.5 37 115.0 38 124.0 39 155.5 40 178.0 41 185.5 42 220.5 43 248.0 44 251.5 45 249.5 46 254.0 47 264.0 48 260.0 49 243.0 50 230.0 51 211.5 52 182.0 53 171.0 54 174.5 55 167.0 56 150.5 57 145.0 58 136.0 59 120.0 60 113.0 61 106.5 62 98.5 63 97.0 64 78.0 65 64.0 66 70.0 67 71.0 68 62.0 69 48.5 70 44.0 71 41.0 72 28.5 73 19.0 74 17.0 75 14.5 76 8.5 77 3.0 78 4.0 79 3.5 80 2.0 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 53 0.025 54 0.025 55 0.025 56 0.025 57 0.025 58 0.025 59 0.025 60 0.025 61 0.025 62 0.025 63 0.025 64 0.025 65 0.05 66 0.2 67 0.95 68 3.0 69 11.025 70 33.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 70 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274296 spots for ERR6146004.sra Written 274296 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra Read 274290 spots for ERR6146004.sra Written 274290 spots for ERR6146004.sra SRR ids: ['ERR6146004.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b0ws61lh ERR6146004.sra spots: 5485806 blocks: [[1, 274290], [274291, 548580], [548581, 822870], [822871, 1097160], [1097161, 1371450], [1371451, 1645740], [1645741, 1920030], [1920031, 2194320], [2194321, 2468610], [2468611, 2742900], [2742901, 3017190], [3017191, 3291480], [3291481, 3565770], [3565771, 3840060], [3840061, 4114350], [4114351, 4388640], [4388641, 4662930], [4662931, 4937220], [4937221, 5211510], [5211511, 5485806]] ERR6146004 file size 972847 ERR6146004 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR6146004 ERR6146004_1.fastq ERR6146004_2.fastq Input file: ERR6146004_1.fastq Paired file: ERR6146004_2.fastq trimmed: ERR6146004-trimmed-pair1.fastq, ERR6146004-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:35:33 2024 >> started Sat Dec 7 15:35:38 2024 >> done (5.156s) 5485806 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 10 ( 0.00%) empty read pairs filtered out after trimming by size control 5485796 (100.00%) read pairs available; of these: 24 ( 0.00%) trimmed read pairs available after processing 5485772 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 23 0.00% 70 5485772 100.00% 5485796 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=8.41 fanout-score-rank=24 prefix-density=0.12 prefix-fanout=5.2 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=12 fanout-score=561.69 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=34.7 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=102.91 fanout-score-rank=14 prefix-density=0.83 prefix-fanout=17.0 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=660.25 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=15.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGC ERR6146004 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:37:09 Started mapping on | Dec 07 15:37:09 Finished on | Dec 07 15:37:29 Mapping speed, Million of reads per hour | 987.44 Number of input reads | 5485796 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 5169829 Uniquely mapped reads % | 94.24% Average mapped length | 138.74 Number of splices: Total | 2587228 Number of splices: Annotated (sjdb) | 2463078 Number of splices: GT/AG | 2552691 Number of splices: GC/AG | 30263 Number of splices: AT/AC | 2087 Number of splices: Non-canonical | 2187 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 78368 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 8813 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 237599 237599 237599 N_multimapping 78368 78368 78368 N_noFeature 135947 5055459 167015 N_ambiguous 93590 475 10520 UnstrandedReadsAssigned:4940292 PositiveStrandReadsAssigned:113895 NegativeStrandReadsAssigned:4992294 Dataset is classified negative stranded MeadianReadLen=70 20thPercentileLength=70 echo kmer=65 ERR6146004 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR6146004-trimmed-pair1.fastq ERR6146004-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,485,796 reads, 5,080,821 reads pseudoaligned [quant] estimated average fragment length: 190.773 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52973 ERR6146004.ke.tsv 35125 ERR6146004.se.tsv 88098 total ==> ERR6146004.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.614 0.000111934 4.36678e-05 PNS24247 1044 854.227 22.2455 7.58518 PNS24249 1928 1738.23 35.7338 5.98782 PNS24246 1044 854.227 22.2455 7.58518 PNS24248 1044 854.227 22.2455 7.58518 PNS24244 1471 1281.23 36.5295 8.3045 PNS24243 293 122.97 0 0 KQK14069 1603 1413.23 697.457 143.748 KQK14071 474 288.748 15.0099 15.141 ==> ERR6146004.se.tsv <== BRADI_1g14170v3 749 BRADI_1g53295v3 13 BRADI_1g59795v3 103 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 491 BRADI_1g74790v3 46 BRADI_1g09890v3 0 BRADI_1g77505v3 59 BRADI_1g48960v3 0 ERR6146004 completed mapping pipeline successfully