Starting /dee2/code/volunteer_pipeline.sh ERR9452511 current disk space = 1548330332160 free memory = 1373064296 ERR9452511 SRAfilesize 4bc85e712a9058dc1a4dca35fdda2046 ERR9452511.sra ERR9452511.sra file validated ERR9452511 is paired end ERR9452511 is conventional basespace ERR9452511 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.667 37.0 37.0 37.0 37.0 37.0 2 35.575 37.0 37.0 37.0 37.0 37.0 3 35.986 37.0 37.0 37.0 37.0 37.0 4 35.96 37.0 37.0 37.0 37.0 37.0 5 36.0995 37.0 37.0 37.0 37.0 37.0 6 36.162 37.0 37.0 37.0 37.0 37.0 7 36.0665 37.0 37.0 37.0 37.0 37.0 8 36.1765 37.0 37.0 37.0 37.0 37.0 9 36.279 37.0 37.0 37.0 37.0 37.0 10-14 36.2781 37.0 37.0 37.0 37.0 37.0 15-19 36.1452 37.0 37.0 37.0 37.0 37.0 20-24 36.1303 37.0 37.0 37.0 37.0 37.0 25-29 36.0689 37.0 37.0 37.0 37.0 37.0 30-34 36.01440000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.958600000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.7929 37.0 37.0 37.0 37.0 37.0 45-49 35.7793 37.0 37.0 37.0 37.0 37.0 50-54 35.814 37.0 37.0 37.0 37.0 37.0 55-59 35.779199999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.916399999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.867200000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.796800000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.7178 37.0 37.0 37.0 37.0 37.0 80-84 35.7587 37.0 37.0 37.0 37.0 37.0 85-89 35.806400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.6744 37.0 37.0 37.0 37.0 37.0 95-99 35.6759 37.0 37.0 37.0 37.0 37.0 100-104 35.6818 37.0 37.0 37.0 37.0 37.0 105-109 35.6759 37.0 37.0 37.0 37.0 37.0 110-114 35.535799999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.507000000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.4455 37.0 37.0 37.0 37.0 37.0 125-129 35.6019 37.0 37.0 37.0 37.0 37.0 130-134 35.4124 37.0 37.0 37.0 37.0 37.0 135-139 35.331 37.0 37.0 37.0 34.6 37.0 140-144 35.272000000000006 37.0 37.0 37.0 34.6 37.0 145-149 35.3049 37.0 37.0 37.0 34.6 37.0 150 35.291 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 0.0 21 0.0 22 3.0 23 5.0 24 3.0 25 7.0 26 7.0 27 23.0 28 31.0 29 53.0 30 57.0 31 78.0 32 112.0 33 143.0 34 205.0 35 386.0 36 2571.0 37 314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.32932932932933 12.737737737737737 15.74074074074074 42.19219219219219 2 26.013006503251624 22.486243121560783 29.914957478739368 21.585792896448226 3 26.775 25.95 19.55 27.725 4 29.95 28.849999999999998 16.275000000000002 24.925 5 28.249999999999996 28.875 20.275000000000002 22.6 6 22.025 30.075000000000003 21.25 26.650000000000002 7 20.325 12.85 37.45 29.375 8 22.125 18.825 25.2 33.85 9 24.4 18.525 27.700000000000003 29.375 10-14 25.495 24.175 21.855 28.475 15-19 26.455000000000002 22.54 22.8 28.205000000000002 20-24 26.634999999999998 22.900000000000002 22.56 27.905 25-29 26.72 22.79 22.435 28.055000000000003 30-34 26.55 22.775000000000002 22.485 28.189999999999998 35-39 26.5 22.875 22.470000000000002 28.155 40-44 26.314999999999998 23.255 22.425 28.005000000000003 45-49 26.700000000000003 23.09 22.255 27.955000000000002 50-54 27.029999999999998 22.96 22.15 27.860000000000003 55-59 25.95 22.25 23.115 28.685 60-64 26.58 22.355 22.335 28.73 65-69 27.255000000000003 22.11 22.3 28.335 70-74 27.05 22.525000000000002 22.255 28.17 75-79 27.095000000000002 22.6 21.69 28.615000000000002 80-84 28.084999999999997 22.2 22.105 27.61 85-89 27.83 21.75 21.845 28.575 90-94 27.365000000000002 22.795 21.959999999999997 27.88 95-99 27.98 22.1 22.18 27.74 100-104 27.384999999999998 22.24 22.88 27.495000000000005 105-109 27.534999999999997 22.485 22.09 27.889999999999997 110-114 27.76 22.12 22.325 27.794999999999998 115-119 28.125 22.395 21.560000000000002 27.92 120-124 28.084999999999997 22.17 21.94 27.805000000000003 125-129 28.32 22.165000000000003 21.89 27.625 130-134 27.57 22.465 22.02 27.944999999999997 135-139 27.36 22.15 22.470000000000002 28.02 140-144 28.025 22.55 21.94 27.485 145-149 27.815 22.745 21.595 27.845 150 28.749999999999996 21.7 22.375 27.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 2.0 27 2.5 28 4.0 29 4.5 30 4.0 31 7.5 32 10.0 33 12.5 34 17.0 35 28.0 36 42.0 37 42.5 38 46.5 39 69.0 40 75.0 41 91.0 42 117.0 43 130.0 44 127.0 45 130.5 46 138.5 47 125.5 48 121.5 49 112.5 50 107.5 51 110.5 52 106.0 53 118.0 54 120.5 55 97.5 56 89.0 57 90.5 58 97.5 59 97.0 60 86.0 61 79.0 62 86.0 63 91.0 64 88.0 65 92.5 66 101.5 67 106.5 68 100.5 69 88.5 70 78.5 71 70.0 72 69.5 73 61.5 74 57.5 75 63.0 76 52.0 77 35.5 78 26.0 79 20.5 80 15.5 81 11.0 82 7.5 83 4.5 84 1.0 85 1.5 86 2.0 87 2.5 88 2.0 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.33690125769334 87.2 2 6.288466684506289 11.75 3 0.3746320578003747 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.3375 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.075 0.0 0.0 0.0 0.0 134-135 1.2125 0.0 0.0 0.0 0.0 136-137 1.2625 0.0 0.0 0.0 0.0 138 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR9452511 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452511_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7145 37.0 37.0 37.0 37.0 37.0 2 35.766 37.0 37.0 37.0 37.0 37.0 3 36.073 37.0 37.0 37.0 37.0 37.0 4 35.9105 37.0 37.0 37.0 37.0 37.0 5 35.79 37.0 37.0 37.0 37.0 37.0 6 35.7965 37.0 37.0 37.0 37.0 37.0 7 35.9455 37.0 37.0 37.0 37.0 37.0 8 35.989 37.0 37.0 37.0 37.0 37.0 9 35.8815 37.0 37.0 37.0 37.0 37.0 10-14 35.9993 37.0 37.0 37.0 37.0 37.0 15-19 35.9013 37.0 37.0 37.0 37.0 37.0 20-24 35.9217 37.0 37.0 37.0 37.0 37.0 25-29 35.9406 37.0 37.0 37.0 37.0 37.0 30-34 35.7975 37.0 37.0 37.0 37.0 37.0 35-39 35.929700000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.872400000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.8109 37.0 37.0 37.0 37.0 37.0 50-54 35.789 37.0 37.0 37.0 37.0 37.0 55-59 35.7876 37.0 37.0 37.0 37.0 37.0 60-64 35.7342 37.0 37.0 37.0 37.0 37.0 65-69 35.8014 37.0 37.0 37.0 37.0 37.0 70-74 35.7327 37.0 37.0 37.0 37.0 37.0 75-79 35.6083 37.0 37.0 37.0 37.0 37.0 80-84 35.6409 37.0 37.0 37.0 37.0 37.0 85-89 35.4585 37.0 37.0 37.0 34.6 37.0 90-94 35.5536 37.0 37.0 37.0 37.0 37.0 95-99 35.4437 37.0 37.0 37.0 34.6 37.0 100-104 35.5159 37.0 37.0 37.0 37.0 37.0 105-109 35.48350000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.384699999999995 37.0 37.0 37.0 34.6 37.0 115-119 35.410900000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.29260000000001 37.0 37.0 37.0 34.6 37.0 125-129 35.2625 37.0 37.0 37.0 34.6 37.0 130-134 35.1831 37.0 37.0 37.0 29.8 37.0 135-139 35.207100000000004 37.0 37.0 37.0 29.8 37.0 140-144 35.209700000000005 37.0 37.0 37.0 32.2 37.0 145-149 34.89 37.0 37.0 37.0 25.0 37.0 150 35.2455 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 3.0 22 4.0 23 4.0 24 12.0 25 14.0 26 15.0 27 18.0 28 42.0 29 40.0 30 48.0 31 88.0 32 88.0 33 150.0 34 210.0 35 515.0 36 2557.0 37 187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.875 12.45 17.125 42.55 2 26.6 21.05 27.150000000000002 25.2 3 26.25 24.95 18.5 30.3 4 30.725 29.349999999999998 14.924999999999999 25.0 5 28.95 28.349999999999998 19.25 23.45 6 21.675 30.975 20.549999999999997 26.8 7 21.475 13.3 37.15 28.075 8 23.150000000000002 16.925 25.874999999999996 34.050000000000004 9 24.6 17.974999999999998 26.525 30.9 10-14 25.95 23.630000000000003 21.715 28.705000000000002 15-19 26.179999999999996 22.825 22.81 28.185 20-24 26.205000000000002 23.195 22.27 28.33 25-29 26.3 23.044999999999998 22.105 28.549999999999997 30-34 26.865 22.745 21.965 28.425 35-39 26.650000000000002 22.795 22.555 28.000000000000004 40-44 26.41 22.705000000000002 22.5 28.384999999999998 45-49 26.740000000000002 22.73 22.38 28.15 50-54 26.740000000000002 22.46 22.71 28.09 55-59 26.96 22.85 22.009999999999998 28.18 60-64 27.72 22.23 22.065 27.985 65-69 27.42 22.18 21.94 28.46 70-74 27.79 22.5 21.775 27.935 75-79 27.105 22.24 22.07 28.585 80-84 28.09 21.72 22.125 28.065 85-89 27.76 22.15 22.02 28.07 90-94 27.425 21.990000000000002 22.165000000000003 28.42 95-99 27.88 22.445 21.584999999999997 28.09 100-104 28.294999999999998 22.07 21.865000000000002 27.77 105-109 27.685 22.884999999999998 22.035 27.395000000000003 110-114 28.310000000000002 21.72 21.98 27.99 115-119 27.66 21.87 21.68 28.79 120-124 28.084999999999997 22.465 21.935 27.515 125-129 27.834999999999997 22.295 22.435 27.435 130-134 27.49 22.48 22.03 28.000000000000004 135-139 28.465 21.865000000000002 22.365 27.305 140-144 28.255000000000003 22.485 21.725 27.534999999999997 145-149 28.134999999999998 22.38 21.665 27.82 150 28.7 22.825 22.25 26.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 2.0 2 1.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 1.5 26 0.5 27 1.5 28 2.5 29 5.0 30 8.5 31 10.5 32 15.0 33 17.5 34 14.0 35 22.5 36 34.0 37 37.0 38 43.5 39 54.0 40 73.0 41 98.5 42 101.5 43 101.0 44 123.5 45 134.5 46 135.5 47 138.5 48 132.0 49 131.0 50 132.0 51 119.0 52 104.5 53 96.0 54 90.5 55 91.0 56 99.5 57 93.0 58 72.5 59 72.5 60 84.5 61 89.0 62 96.0 63 97.5 64 106.0 65 115.5 66 102.5 67 88.5 68 82.5 69 87.5 70 83.5 71 76.0 72 71.5 73 70.0 74 60.5 75 49.5 76 55.0 77 42.5 78 28.0 79 21.5 80 17.0 81 17.0 82 19.0 83 14.0 84 4.5 85 2.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.59487590072058 87.675 2 6.111555911395784 11.450000000000001 3 0.26688017080330934 0.75 4 0.0 0.0 5 0.02668801708033093 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.775 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.2375 0.0 0.0 0.0 0.0 136-137 1.2999999999999998 0.0 0.0 0.0 0.0 138 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381278 spots for ERR9452511.sra Written 1381278 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra Read 1381271 spots for ERR9452511.sra Written 1381271 spots for ERR9452511.sra SRR ids: ['ERR9452511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0pm8x00n ERR9452511.sra spots: 27625427 blocks: [[1, 1381271], [1381272, 2762542], [2762543, 4143813], [4143814, 5525084], [5525085, 6906355], [6906356, 8287626], [8287627, 9668897], [9668898, 11050168], [11050169, 12431439], [12431440, 13812710], [13812711, 15193981], [15193982, 16575252], [16575253, 17956523], [17956524, 19337794], [19337795, 20719065], [20719066, 22100336], [22100337, 23481607], [23481608, 24862878], [24862879, 26244149], [26244150, 27625427]] ERR9452511 file size 9285694 ERR9452511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR9452511 ERR9452511_1.fastq ERR9452511_2.fastq Input file: ERR9452511_1.fastq Paired file: ERR9452511_2.fastq trimmed: ERR9452511-trimmed-pair1.fastq, ERR9452511-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:58:22 2024 >> started Fri Dec 6 22:58:54 2024 >> done (31.289s) 27625427 read pairs processed; of these: 277 ( 0.00%) short read pairs filtered out after trimming by size control 1992 ( 0.01%) empty read pairs filtered out after trimming by size control 27623158 (99.99%) read pairs available; of these: 735872 ( 2.66%) trimmed read pairs available after processing 26887286 (97.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 41 0.00% 20 5961 0.02% 21 40 0.00% 22 16 0.00% 23 10 0.00% 24 15 0.00% 25 23 0.00% 26 16 0.00% 27 21 0.00% 28 36 0.00% 29 63 0.00% 30 193 0.00% 31 74 0.00% 32 19 0.00% 33 24 0.00% 34 24 0.00% 35 17 0.00% 36 23 0.00% 37 14 0.00% 38 23 0.00% 39 27 0.00% 40 28 0.00% 41 42 0.00% 42 25 0.00% 43 45 0.00% 44 56 0.00% 45 46 0.00% 46 65 0.00% 47 79 0.00% 48 74 0.00% 49 82 0.00% 50 109 0.00% 51 128 0.00% 52 139 0.00% 53 162 0.00% 54 158 0.00% 55 188 0.00% 56 261 0.00% 57 263 0.00% 58 318 0.00% 59 303 0.00% 60 396 0.00% 61 460 0.00% 62 476 0.00% 63 507 0.00% 64 507 0.00% 65 550 0.00% 66 598 0.00% 67 622 0.00% 68 713 0.00% 69 831 0.00% 70 806 0.00% 71 961 0.00% 72 880 0.00% 73 1057 0.00% 74 993 0.00% 75 1125 0.00% 76 1158 0.00% 77 1254 0.00% 78 1256 0.00% 79 1384 0.01% 80 1521 0.01% 81 1657 0.01% 82 1639 0.01% 83 1780 0.01% 84 1682 0.01% 85 1788 0.01% 86 1975 0.01% 87 2152 0.01% 88 2127 0.01% 89 2239 0.01% 90 2374 0.01% 91 2427 0.01% 92 2635 0.01% 93 2554 0.01% 94 2976 0.01% 95 3000 0.01% 96 3256 0.01% 97 3338 0.01% 98 3440 0.01% 99 3636 0.01% 100 3815 0.01% 101 3756 0.01% 102 3946 0.01% 103 4413 0.02% 104 4460 0.02% 105 4547 0.02% 106 4967 0.02% 107 5189 0.02% 108 5503 0.02% 109 5786 0.02% 110 6085 0.02% 111 6060 0.02% 112 6129 0.02% 113 6547 0.02% 114 7161 0.03% 115 7490 0.03% 116 7535 0.03% 117 7981 0.03% 118 8227 0.03% 119 8414 0.03% 120 9122 0.03% 121 9503 0.03% 122 9664 0.03% 123 10551 0.04% 124 10982 0.04% 125 11492 0.04% 126 11858 0.04% 127 12219 0.04% 128 12643 0.05% 129 12955 0.05% 130 14018 0.05% 131 14123 0.05% 132 15465 0.06% 133 15783 0.06% 134 16306 0.06% 135 17440 0.06% 136 18366 0.07% 137 18860 0.07% 138 19779 0.07% 139 20175 0.07% 140 21510 0.08% 141 22076 0.08% 142 23580 0.09% 143 24259 0.09% 144 25419 0.09% 145 26833 0.10% 146 28507 0.10% 147 28153 0.10% 148 30539 0.11% 149 31680 0.11% 150 26887286 97.34% 27623158 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=28 fanout-score=171.99 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=18.7 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=19 prefix-density=0.31 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=150.93 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=20.2 sequence=CGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAAATGTACGTATGTGATCGATGATGCCAAGTACTTGATCG ERR9452511 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:01:19 Started mapping on | Dec 06 23:01:19 Finished on | Dec 06 23:03:33 Mapping speed, Million of reads per hour | 742.11 Number of input reads | 27623158 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 26166487 Uniquely mapped reads % | 94.73% Average mapped length | 297.88 Number of splices: Total | 25544421 Number of splices: Annotated (sjdb) | 24124575 Number of splices: GT/AG | 25187548 Number of splices: GC/AG | 320392 Number of splices: AT/AC | 11566 Number of splices: Non-canonical | 24915 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261330 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 81433 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.31% % of reads unmapped: other | 2.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1195341 1195341 1195341 N_multimapping 261330 261330 261330 N_noFeature 808656 13232639 13287667 N_ambiguous 623777 86692 87144 UnstrandedReadsAssigned:24734054 PositiveStrandReadsAssigned:12847156 NegativeStrandReadsAssigned:12791676 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 ERR9452511 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR9452511-trimmed-pair1.fastq ERR9452511-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,623,158 reads, 25,699,549 reads pseudoaligned [quant] estimated average fragment length: 238.2 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 ERR9452511.ke.tsv 35125 ERR9452511.se.tsv 88098 total ==> ERR9452511.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.192 0 0 PNS24247 1044 806.8 44.0993 2.72442 PNS24249 1928 1690.8 397.324 11.7128 PNS24246 1044 806.8 44.0993 2.72442 PNS24248 1044 806.8 44.0993 2.72442 PNS24244 1471 1233.8 33.378 1.34841 PNS24243 293 68.809 56 40.5649 KQK14069 1603 1365.8 20208.4 737.485 KQK14071 474 239.431 2412.27 502.174 ==> ERR9452511.se.tsv <== BRADI_1g14170v3 24251 BRADI_1g53295v3 107 BRADI_1g59795v3 547 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 894 BRADI_1g74790v3 434 BRADI_1g09890v3 16 BRADI_1g77505v3 388 BRADI_1g48960v3 0 ERR9452511 completed mapping pipeline successfully