Starting /dee2/code/volunteer_pipeline.sh ERR9452513 current disk space = 1547660836864 free memory = 1383174036 ERR9452513 SRAfilesize 399863296ccbc65beeeff5f0f6fe86b2 ERR9452513.sra ERR9452513.sra file validated ERR9452513 is paired end ERR9452513 is conventional basespace ERR9452513 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452513_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.62875 37.0 37.0 37.0 37.0 37.0 2 35.6655 37.0 37.0 37.0 37.0 37.0 3 35.9345 37.0 37.0 37.0 37.0 37.0 4 36.0625 37.0 37.0 37.0 37.0 37.0 5 35.9885 37.0 37.0 37.0 37.0 37.0 6 36.1585 37.0 37.0 37.0 37.0 37.0 7 36.08 37.0 37.0 37.0 37.0 37.0 8 36.2185 37.0 37.0 37.0 37.0 37.0 9 36.189 37.0 37.0 37.0 37.0 37.0 10-14 36.2136 37.0 37.0 37.0 37.0 37.0 15-19 36.1731 37.0 37.0 37.0 37.0 37.0 20-24 36.158 37.0 37.0 37.0 37.0 37.0 25-29 36.055099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0062 37.0 37.0 37.0 37.0 37.0 35-39 35.9757 37.0 37.0 37.0 37.0 37.0 40-44 35.819100000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.72279999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.90939999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.7962 37.0 37.0 37.0 37.0 37.0 60-64 35.938100000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.8341 37.0 37.0 37.0 37.0 37.0 70-74 35.8284 37.0 37.0 37.0 37.0 37.0 75-79 35.8128 37.0 37.0 37.0 37.0 37.0 80-84 35.7598 37.0 37.0 37.0 37.0 37.0 85-89 35.7973 37.0 37.0 37.0 37.0 37.0 90-94 35.745999999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8009 37.0 37.0 37.0 37.0 37.0 100-104 35.744600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.6773 37.0 37.0 37.0 37.0 37.0 110-114 35.637100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.562799999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.6074 37.0 37.0 37.0 37.0 37.0 125-129 35.62819999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.484300000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.409499999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.3135 37.0 37.0 37.0 34.6 37.0 145-149 35.406400000000005 37.0 37.0 37.0 34.6 37.0 150 35.33 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 1.0 23 0.0 24 6.0 25 6.0 26 6.0 27 22.0 28 32.0 29 48.0 30 69.0 31 76.0 32 105.0 33 138.0 34 174.0 35 409.0 36 2568.0 37 338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.171878909181885 12.984738553915436 14.961220915686765 42.882161621215914 2 28.675 20.974999999999998 29.575000000000003 20.775 3 25.624999999999996 25.924999999999997 18.625 29.825000000000003 4 31.674999999999997 28.249999999999996 16.275000000000002 23.799999999999997 5 29.275000000000002 30.275000000000002 17.675 22.775000000000002 6 22.35 32.675 20.200000000000003 24.775 7 21.65 13.825000000000001 36.675000000000004 27.85 8 24.175 18.25 25.5 32.074999999999996 9 23.225 18.725 26.3 31.75 10-14 25.814999999999998 23.965 22.17 28.050000000000004 15-19 26.25 22.345000000000002 23.03 28.375 20-24 26.805 22.935 22.35 27.91 25-29 26.625 23.135 22.595000000000002 27.644999999999996 30-34 26.490000000000002 23.49 22.040000000000003 27.98 35-39 26.995 22.23 22.27 28.505000000000003 40-44 27.375 22.575 22.405 27.644999999999996 45-49 26.88 22.465 22.805 27.85 50-54 27.24 22.655 22.405 27.700000000000003 55-59 27.150000000000002 22.965 22.295 27.589999999999996 60-64 26.950000000000003 22.32 22.195 28.535 65-69 26.840000000000003 22.259999999999998 22.63 28.27 70-74 27.79 22.05 22.13 28.03 75-79 27.689999999999998 22.564999999999998 21.675 28.07 80-84 27.750000000000004 21.915000000000003 22.845 27.49 85-89 27.965 21.825 22.145 28.065 90-94 27.63 21.97 22.175 28.225 95-99 28.22 22.14 22.445 27.195000000000004 100-104 28.134999999999998 22.03 21.709999999999997 28.125 105-109 28.084999999999997 22.29 21.255 28.37 110-114 28.595 22.42 21.295 27.689999999999998 115-119 28.144999999999996 22.305 21.745 27.805000000000003 120-124 28.065 22.875 21.325 27.735 125-129 28.139999999999997 21.985 21.895 27.98 130-134 28.53 22.175 21.8 27.495000000000005 135-139 28.084999999999997 22.11 21.805 28.000000000000004 140-144 27.644999999999996 22.905 21.925 27.525 145-149 28.255000000000003 22.445 21.88 27.42 150 27.875 23.150000000000002 22.475 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 0.5 28 0.5 29 1.5 30 3.5 31 5.0 32 10.0 33 14.5 34 16.0 35 19.5 36 32.0 37 40.0 38 44.5 39 63.0 40 78.0 41 95.5 42 113.5 43 120.5 44 127.0 45 128.5 46 141.5 47 142.0 48 132.0 49 124.0 50 112.0 51 121.0 52 125.5 53 105.5 54 95.5 55 95.5 56 87.5 57 90.0 58 104.5 59 100.5 60 90.5 61 93.0 62 90.0 63 98.5 64 105.5 65 101.0 66 90.5 67 86.0 68 87.5 69 88.5 70 81.0 71 66.5 72 71.5 73 68.5 74 57.5 75 53.0 76 46.5 77 34.0 78 24.0 79 19.0 80 13.5 81 14.0 82 8.5 83 3.5 84 4.0 85 3.0 86 4.0 87 3.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.52768119818134 87.425 2 5.990906659534636 11.200000000000001 3 0.4546670232682536 1.275 4 0.02674511901577962 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0125 92-93 0.175 0.0 0.0 0.0 0.025 94-95 0.175 0.0 0.0 0.0 0.025 96-97 0.175 0.0 0.0 0.0 0.025 98-99 0.1875 0.0 0.0 0.0 0.025 100-101 0.2 0.0 0.0 0.0 0.025 102-103 0.2 0.0 0.0 0.0 0.025 104-105 0.2375 0.0 0.0 0.0 0.025 106-107 0.30000000000000004 0.0 0.0 0.0 0.025 108-109 0.35 0.0 0.0 0.0 0.025 110-111 0.35 0.0 0.0 0.0 0.025 112-113 0.4 0.0 0.0 0.0 0.025 114-115 0.5 0.0 0.0 0.0 0.025 116-117 0.5375000000000001 0.0 0.0 0.0 0.025 118-119 0.6 0.0 0.0 0.0 0.025 120-121 0.625 0.0 0.0 0.0 0.025 122-123 0.7375 0.0 0.0 0.0 0.025 124-125 0.825 0.0 0.0 0.0 0.025 126-127 0.9 0.0 0.0 0.0 0.025 128-129 0.95 0.0 0.0 0.0 0.025 130-131 1.0125 0.0 0.0 0.0 0.025 132-133 1.1375000000000002 0.0 0.0 0.0 0.025 134-135 1.3125 0.0 0.0 0.0 0.025 136-137 1.4500000000000002 0.0 0.0 0.0 0.025 138 1.5 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCTGA 10 0.006973645 144.0 9 ATGCGAT 10 0.006973645 144.0 3 >>END_MODULE ERR9452513 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452513_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.765 37.0 37.0 37.0 37.0 37.0 2 35.5555 37.0 37.0 37.0 37.0 37.0 3 35.897 37.0 37.0 37.0 37.0 37.0 4 35.6825 37.0 37.0 37.0 37.0 37.0 5 35.806 37.0 37.0 37.0 37.0 37.0 6 35.804 37.0 37.0 37.0 37.0 37.0 7 35.7975 37.0 37.0 37.0 37.0 37.0 8 35.8465 37.0 37.0 37.0 37.0 37.0 9 35.854 37.0 37.0 37.0 37.0 37.0 10-14 35.9627 37.0 37.0 37.0 37.0 37.0 15-19 35.818 37.0 37.0 37.0 37.0 37.0 20-24 35.8973 37.0 37.0 37.0 37.0 37.0 25-29 35.876799999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.8072 37.0 37.0 37.0 37.0 37.0 35-39 35.8982 37.0 37.0 37.0 37.0 37.0 40-44 35.793699999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.73219999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.6453 37.0 37.0 37.0 37.0 37.0 55-59 35.6337 37.0 37.0 37.0 37.0 37.0 60-64 35.605599999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.6563 37.0 37.0 37.0 37.0 37.0 70-74 35.584199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.5246 37.0 37.0 37.0 37.0 37.0 80-84 35.4485 37.0 37.0 37.0 37.0 37.0 85-89 35.3575 37.0 37.0 37.0 37.0 37.0 90-94 35.3712 37.0 37.0 37.0 37.0 37.0 95-99 35.3792 37.0 37.0 37.0 32.2 37.0 100-104 35.406600000000005 37.0 37.0 37.0 34.6 37.0 105-109 35.3711 37.0 37.0 37.0 37.0 37.0 110-114 35.3043 37.0 37.0 37.0 32.2 37.0 115-119 35.258500000000005 37.0 37.0 37.0 34.6 37.0 120-124 35.0967 37.0 37.0 37.0 25.0 37.0 125-129 35.03779999999999 37.0 37.0 37.0 27.4 37.0 130-134 35.0053 37.0 37.0 37.0 27.4 37.0 135-139 35.147499999999994 37.0 37.0 37.0 27.4 37.0 140-144 34.9401 37.0 37.0 37.0 25.0 37.0 145-149 34.6551 37.0 37.0 37.0 25.0 37.0 150 35.209 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 1.0 21 5.0 22 3.0 23 10.0 24 4.0 25 10.0 26 27.0 27 32.0 28 39.0 29 43.0 30 80.0 31 75.0 32 91.0 33 140.0 34 240.0 35 599.0 36 2425.0 37 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.625 13.375 15.625 43.375 2 27.525 21.3 28.375 22.8 3 26.125 26.400000000000002 18.575 28.9 4 31.6 28.599999999999998 15.625 24.175 5 30.55 29.15 17.925 22.375 6 21.7 31.075000000000003 19.775000000000002 27.450000000000003 7 21.099999999999998 14.025000000000002 37.2 27.675 8 23.575 18.925 23.825 33.675 9 25.224999999999998 18.65 26.724999999999998 29.4 10-14 26.384999999999998 23.815 22.12 27.68 15-19 26.44 22.03 22.775000000000002 28.754999999999995 20-24 25.7 23.075000000000003 23.035 28.189999999999998 25-29 26.525 22.470000000000002 22.665 28.34 30-34 26.669999999999998 22.7 22.509999999999998 28.12 35-39 26.495 23.080000000000002 22.17 28.255000000000003 40-44 26.51 22.75 22.225 28.515 45-49 26.87 22.34 22.689999999999998 28.1 50-54 26.884999999999998 22.634999999999998 22.42 28.060000000000002 55-59 26.474999999999998 22.585 22.875 28.065 60-64 26.93 22.134999999999998 22.41 28.525 65-69 27.295 22.125 22.125 28.455000000000002 70-74 27.315 22.39 22.065 28.23 75-79 26.82 21.93 22.93 28.32 80-84 27.589999999999996 21.725 22.285 28.4 85-89 27.229999999999997 22.355 22.384999999999998 28.03 90-94 27.800000000000004 22.465 21.575 28.16 95-99 27.61 21.91 22.02 28.46 100-104 27.634999999999998 21.8 22.555 28.01 105-109 27.900000000000002 21.875 22.115000000000002 28.110000000000003 110-114 28.025 22.205 21.740000000000002 28.03 115-119 27.189999999999998 22.27 22.085 28.455000000000002 120-124 28.185 22.27 21.099999999999998 28.444999999999997 125-129 28.035 22.425 21.7 27.839999999999996 130-134 28.51 21.855 21.81 27.825 135-139 28.265 22.125 22.085 27.525 140-144 28.675 22.575 21.645 27.105 145-149 28.305000000000003 23.305 21.415 26.974999999999998 150 28.799999999999997 22.45 22.1 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.0 26 2.0 27 2.0 28 0.5 29 1.5 30 4.0 31 9.0 32 12.5 33 12.5 34 17.0 35 23.5 36 27.0 37 39.5 38 48.5 39 56.0 40 79.0 41 94.0 42 105.0 43 120.5 44 122.5 45 121.0 46 129.0 47 136.5 48 126.0 49 130.0 50 131.5 51 107.5 52 104.5 53 109.5 54 120.0 55 110.0 56 91.0 57 92.5 58 88.5 59 90.5 60 100.5 61 105.0 62 100.5 63 93.0 64 96.5 65 91.5 66 89.5 67 96.0 68 85.0 69 74.5 70 81.0 71 78.5 72 68.5 73 66.0 74 64.5 75 54.0 76 40.0 77 35.0 78 26.0 79 17.0 80 15.5 81 16.5 82 13.0 83 7.5 84 3.5 85 2.5 86 2.5 87 2.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.8449240607514 88.05 2 5.7287503330668805 10.75 3 0.4263256061817213 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1375 0.0 0.0 0.0 0.0 134-135 1.2875 0.0 0.0 0.0 0.0 136-137 1.4249999999999998 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGATCC 10 0.006973645 144.0 3 CGATCCA 10 0.006973645 144.0 4 >>END_MODULE Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429723 spots for ERR9452513.sra Written 1429723 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra Read 1429719 spots for ERR9452513.sra Written 1429719 spots for ERR9452513.sra SRR ids: ['ERR9452513.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6aluxg_0 ERR9452513.sra spots: 28594384 blocks: [[1, 1429719], [1429720, 2859438], [2859439, 4289157], [4289158, 5718876], [5718877, 7148595], [7148596, 8578314], [8578315, 10008033], [10008034, 11437752], [11437753, 12867471], [12867472, 14297190], [14297191, 15726909], [15726910, 17156628], [17156629, 18586347], [18586348, 20016066], [20016067, 21445785], [21445786, 22875504], [22875505, 24305223], [24305224, 25734942], [25734943, 27164661], [27164662, 28594384]] ERR9452513 file size 9612149 ERR9452513 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR9452513 ERR9452513_1.fastq ERR9452513_2.fastq Input file: ERR9452513_1.fastq Paired file: ERR9452513_2.fastq trimmed: ERR9452513-trimmed-pair1.fastq, ERR9452513-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:05:27 2024 >> started Fri Dec 6 23:07:55 2024 >> done (148.741s) 28594384 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 586 ( 0.00%) empty read pairs filtered out after trimming by size control 28593688 (100.00%) read pairs available; of these: 639065 ( 2.23%) trimmed read pairs available after processing 27954623 (97.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 1792 0.01% 21 18 0.00% 22 12 0.00% 23 5 0.00% 24 2 0.00% 25 13 0.00% 26 9 0.00% 27 16 0.00% 28 14 0.00% 29 39 0.00% 30 126 0.00% 31 32 0.00% 32 24 0.00% 33 23 0.00% 34 20 0.00% 35 15 0.00% 36 20 0.00% 37 22 0.00% 38 32 0.00% 39 18 0.00% 40 25 0.00% 41 21 0.00% 42 35 0.00% 43 38 0.00% 44 42 0.00% 45 48 0.00% 46 51 0.00% 47 54 0.00% 48 69 0.00% 49 77 0.00% 50 81 0.00% 51 109 0.00% 52 95 0.00% 53 117 0.00% 54 173 0.00% 55 144 0.00% 56 170 0.00% 57 204 0.00% 58 237 0.00% 59 280 0.00% 60 311 0.00% 61 335 0.00% 62 393 0.00% 63 354 0.00% 64 377 0.00% 65 442 0.00% 66 503 0.00% 67 474 0.00% 68 532 0.00% 69 614 0.00% 70 624 0.00% 71 670 0.00% 72 758 0.00% 73 779 0.00% 74 898 0.00% 75 873 0.00% 76 991 0.00% 77 1022 0.00% 78 1057 0.00% 79 1171 0.00% 80 1245 0.00% 81 1280 0.00% 82 1496 0.01% 83 1468 0.01% 84 1448 0.01% 85 1700 0.01% 86 1554 0.01% 87 1640 0.01% 88 1887 0.01% 89 1959 0.01% 90 1960 0.01% 91 2217 0.01% 92 2235 0.01% 93 2274 0.01% 94 2441 0.01% 95 2595 0.01% 96 2624 0.01% 97 2914 0.01% 98 3060 0.01% 99 3040 0.01% 100 3355 0.01% 101 3538 0.01% 102 3460 0.01% 103 3753 0.01% 104 3950 0.01% 105 4157 0.01% 106 4427 0.02% 107 4474 0.02% 108 4684 0.02% 109 4954 0.02% 110 5154 0.02% 111 5250 0.02% 112 5524 0.02% 113 5708 0.02% 114 6074 0.02% 115 6213 0.02% 116 6688 0.02% 117 7038 0.02% 118 7037 0.02% 119 7512 0.03% 120 7806 0.03% 121 7935 0.03% 122 8269 0.03% 123 8964 0.03% 124 9701 0.03% 125 9986 0.03% 126 10347 0.04% 127 10757 0.04% 128 11071 0.04% 129 11724 0.04% 130 11933 0.04% 131 12652 0.04% 132 13155 0.05% 133 13829 0.05% 134 14691 0.05% 135 15382 0.05% 136 15846 0.06% 137 16326 0.06% 138 16757 0.06% 139 18031 0.06% 140 19000 0.07% 141 19183 0.07% 142 20707 0.07% 143 21216 0.07% 144 22346 0.08% 145 23970 0.08% 146 25004 0.09% 147 25616 0.09% 148 27160 0.09% 149 28190 0.10% 150 27954623 97.77% 28593688 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=17 prefix-density=0.30 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=158.33 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=19.1 sequence=GCCGCCGCCGCC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=20 prefix-density=0.28 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=151.20 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=18.4 sequence=GCCGCCGCCGCC ERR9452513 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:09:20 Started mapping on | Dec 06 23:09:20 Finished on | Dec 06 23:17:55 Mapping speed, Million of reads per hour | 199.88 Number of input reads | 28593688 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 27003077 Uniquely mapped reads % | 94.44% Average mapped length | 298.04 Number of splices: Total | 26424300 Number of splices: Annotated (sjdb) | 24965807 Number of splices: GT/AG | 26056339 Number of splices: GC/AG | 331652 Number of splices: AT/AC | 11625 Number of splices: Non-canonical | 24684 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314682 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 88968 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 2.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1275929 1275929 1275929 N_multimapping 314682 314682 314682 N_noFeature 880100 13654329 13745057 N_ambiguous 648877 85337 85186 UnstrandedReadsAssigned:25474100 PositiveStrandReadsAssigned:13263411 NegativeStrandReadsAssigned:13172834 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 ERR9452513 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR9452513-trimmed-pair1.fastq ERR9452513-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,593,688 reads, 26,523,518 reads pseudoaligned [quant] estimated average fragment length: 240.384 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 ERR9452513.ke.tsv 35125 ERR9452513.se.tsv 88098 total ==> ERR9452513.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.98 0 0 PNS24247 1044 804.616 37.3317 2.22668 PNS24249 1928 1688.62 431.335 12.259 PNS24246 1044 804.616 37.3317 2.22668 PNS24248 1044 804.616 37.3317 2.22668 PNS24244 1471 1231.62 60.6699 2.36411 PNS24243 293 66.8625 49 35.1709 KQK14069 1603 1363.62 15472.1 544.536 KQK14071 474 237.05 1299.81 263.154 ==> ERR9452513.se.tsv <== BRADI_1g14170v3 17950 BRADI_1g53295v3 169 BRADI_1g59795v3 655 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 862 BRADI_1g74790v3 485 BRADI_1g09890v3 4 BRADI_1g77505v3 482 BRADI_1g48960v3 0 ERR9452513 completed mapping pipeline successfully