Starting /dee2/code/volunteer_pipeline.sh ERR9452516 current disk space = 1547492929536 free memory = 1424037572 ERR9452516 SRAfilesize 76fb543b1976b4394d354bd113ac8fe3 ERR9452516.sra ERR9452516.sra file validated ERR9452516 is paired end ERR9452516 is conventional basespace ERR9452516 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452516_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6625 37.0 37.0 37.0 37.0 37.0 2 35.7195 37.0 37.0 37.0 37.0 37.0 3 36.059 37.0 37.0 37.0 37.0 37.0 4 36.076 37.0 37.0 37.0 37.0 37.0 5 36.0925 37.0 37.0 37.0 37.0 37.0 6 36.067 37.0 37.0 37.0 37.0 37.0 7 36.063 37.0 37.0 37.0 37.0 37.0 8 36.328 37.0 37.0 37.0 37.0 37.0 9 36.1655 37.0 37.0 37.0 37.0 37.0 10-14 36.2159 37.0 37.0 37.0 37.0 37.0 15-19 36.1486 37.0 37.0 37.0 37.0 37.0 20-24 36.1858 37.0 37.0 37.0 37.0 37.0 25-29 36.0397 37.0 37.0 37.0 37.0 37.0 30-34 36.047 37.0 37.0 37.0 37.0 37.0 35-39 36.0366 37.0 37.0 37.0 37.0 37.0 40-44 35.8156 37.0 37.0 37.0 37.0 37.0 45-49 35.8302 37.0 37.0 37.0 37.0 37.0 50-54 35.8715 37.0 37.0 37.0 37.0 37.0 55-59 35.9068 37.0 37.0 37.0 37.0 37.0 60-64 35.8971 37.0 37.0 37.0 37.0 37.0 65-69 35.83200000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.8799 37.0 37.0 37.0 37.0 37.0 75-79 35.8051 37.0 37.0 37.0 37.0 37.0 80-84 35.8544 37.0 37.0 37.0 37.0 37.0 85-89 35.7614 37.0 37.0 37.0 37.0 37.0 90-94 35.7535 37.0 37.0 37.0 37.0 37.0 95-99 35.7553 37.0 37.0 37.0 37.0 37.0 100-104 35.699 37.0 37.0 37.0 37.0 37.0 105-109 35.6387 37.0 37.0 37.0 37.0 37.0 110-114 35.6322 37.0 37.0 37.0 37.0 37.0 115-119 35.601600000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5627 37.0 37.0 37.0 37.0 37.0 125-129 35.625099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.497699999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4238 37.0 37.0 37.0 34.6 37.0 140-144 35.3327 37.0 37.0 37.0 34.6 37.0 145-149 35.49720000000001 37.0 37.0 37.0 34.6 37.0 150 35.4185 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 0.0 23 2.0 24 2.0 25 4.0 26 10.0 27 20.0 28 30.0 29 56.0 30 65.0 31 80.0 32 109.0 33 137.0 34 172.0 35 350.0 36 2614.0 37 345.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.97797797797798 14.089089089089088 14.78978978978979 43.14314314314314 2 28.36418209104552 21.510755377688845 29.61480740370185 20.51025512756378 3 24.925 25.525 20.05 29.5 4 29.5 28.625 17.0 24.875 5 29.525000000000002 30.049999999999997 19.3 21.125 6 21.05 32.05 21.05 25.85 7 22.025 14.249999999999998 36.125 27.6 8 23.075000000000003 18.3 24.5 34.125 9 24.7 18.55 26.200000000000003 30.55 10-14 25.8 23.79 21.935 28.475 15-19 26.625 22.615 22.305 28.455000000000002 20-24 26.755000000000003 22.89 22.825 27.529999999999998 25-29 26.82 22.695 22.665 27.82 30-34 26.775 23.06 22.16 28.005000000000003 35-39 26.834999999999997 23.175 22.425 27.565 40-44 27.115000000000002 22.585 22.54 27.76 45-49 26.63 22.425 23.05 27.894999999999996 50-54 26.765 22.53 22.86 27.845 55-59 27.034999999999997 22.18 22.31 28.475 60-64 27.79 22.175 21.865000000000002 28.17 65-69 27.445000000000004 22.33 22.45 27.775 70-74 27.735 21.93 22.31 28.025 75-79 27.905 21.5 22.605 27.99 80-84 27.27 22.215 22.575 27.939999999999998 85-89 27.889999999999997 22.335 21.815 27.96 90-94 27.785 22.325 22.1 27.79 95-99 27.92 22.42 22.515 27.145000000000003 100-104 27.345000000000002 22.625 22.040000000000003 27.99 105-109 27.465 22.66 21.845 28.03 110-114 27.505000000000003 22.615 22.2 27.68 115-119 27.915 22.16 22.235 27.689999999999998 120-124 28.139999999999997 22.16 22.095000000000002 27.605 125-129 27.98 22.335 22.225 27.46 130-134 27.82 22.67 21.895 27.615000000000002 135-139 27.02 22.88 21.995 28.105000000000004 140-144 27.87 22.84 22.115000000000002 27.175 145-149 27.584999999999997 22.725 21.97 27.72 150 27.1 23.3 21.925 27.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 1.5 29 4.5 30 5.0 31 4.0 32 11.0 33 16.5 34 15.5 35 19.5 36 30.0 37 38.5 38 50.5 39 68.0 40 87.5 41 104.5 42 110.5 43 123.5 44 135.5 45 140.5 46 128.5 47 117.5 48 128.5 49 122.0 50 110.0 51 111.0 52 113.5 53 108.0 54 108.0 55 102.0 56 96.0 57 94.0 58 90.5 59 95.5 60 96.0 61 95.5 62 94.5 63 94.5 64 90.0 65 85.5 66 90.0 67 82.0 68 84.0 69 83.0 70 74.5 71 81.0 72 73.5 73 69.5 74 62.0 75 52.5 76 45.5 77 32.5 78 28.0 79 24.0 80 17.5 81 14.0 82 12.5 83 9.5 84 5.0 85 1.5 86 0.0 87 0.5 88 2.0 89 2.0 90 1.0 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.3047670058918 87.1 2 6.266738082485271 11.700000000000001 3 0.42849491162292447 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.025 96-97 0.275 0.0 0.0 0.0 0.025 98-99 0.275 0.0 0.0 0.0 0.025 100-101 0.2875 0.0 0.0 0.0 0.025 102-103 0.3 0.0 0.0 0.0 0.025 104-105 0.325 0.0 0.0 0.0 0.025 106-107 0.325 0.0 0.0 0.0 0.025 108-109 0.325 0.0 0.0 0.0 0.025 110-111 0.375 0.0 0.0 0.0 0.025 112-113 0.4 0.0 0.0 0.0 0.025 114-115 0.4375 0.0 0.0 0.0 0.025 116-117 0.525 0.0 0.0 0.0 0.025 118-119 0.5625 0.0 0.0 0.0 0.025 120-121 0.5874999999999999 0.0 0.0 0.0 0.025 122-123 0.6125 0.0 0.0 0.0 0.025 124-125 0.75 0.0 0.0 0.0 0.025 126-127 0.8 0.0 0.0 0.0 0.025 128-129 0.8625 0.0 0.0 0.0 0.025 130-131 0.925 0.0 0.0 0.0 0.025 132-133 0.9875 0.0 0.0 0.0 0.025 134-135 1.0625 0.0 0.0 0.0 0.025 136-137 1.1625 0.0 0.0 0.0 0.025 138 1.275 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCAT 10 0.0069772652 143.975 8 GTGCTCT 10 0.0069772652 143.975 9 >>END_MODULE ERR9452516 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452516_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.728 37.0 37.0 37.0 37.0 37.0 2 35.6315 37.0 37.0 37.0 37.0 37.0 3 35.8255 37.0 37.0 37.0 37.0 37.0 4 35.837 37.0 37.0 37.0 37.0 37.0 5 35.8215 37.0 37.0 37.0 37.0 37.0 6 35.909 37.0 37.0 37.0 37.0 37.0 7 35.9215 37.0 37.0 37.0 37.0 37.0 8 35.776 37.0 37.0 37.0 37.0 37.0 9 35.8265 37.0 37.0 37.0 37.0 37.0 10-14 35.9684 37.0 37.0 37.0 37.0 37.0 15-19 35.859300000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.7851 37.0 37.0 37.0 37.0 37.0 25-29 35.8351 37.0 37.0 37.0 37.0 37.0 30-34 35.752100000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.784800000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.747400000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.7128 37.0 37.0 37.0 37.0 37.0 50-54 35.7362 37.0 37.0 37.0 37.0 37.0 55-59 35.6902 37.0 37.0 37.0 37.0 37.0 60-64 35.6513 37.0 37.0 37.0 37.0 37.0 65-69 35.6355 37.0 37.0 37.0 37.0 37.0 70-74 35.6293 37.0 37.0 37.0 37.0 37.0 75-79 35.5846 37.0 37.0 37.0 37.0 37.0 80-84 35.506600000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.4066 37.0 37.0 37.0 34.6 37.0 90-94 35.428 37.0 37.0 37.0 34.6 37.0 95-99 35.2647 37.0 37.0 37.0 32.2 37.0 100-104 35.270399999999995 37.0 37.0 37.0 32.2 37.0 105-109 35.3707 37.0 37.0 37.0 37.0 37.0 110-114 35.2869 37.0 37.0 37.0 32.2 37.0 115-119 35.3193 37.0 37.0 37.0 34.6 37.0 120-124 35.2083 37.0 37.0 37.0 27.4 37.0 125-129 35.106399999999994 37.0 37.0 37.0 27.4 37.0 130-134 35.1224 37.0 37.0 37.0 29.8 37.0 135-139 35.074200000000005 37.0 37.0 37.0 27.4 37.0 140-144 34.996399999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.7151 37.0 37.0 37.0 25.0 37.0 150 34.962 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 2.0 23 6.0 24 11.0 25 15.0 26 19.0 27 23.0 28 38.0 29 52.0 30 67.0 31 83.0 32 97.0 33 140.0 34 247.0 35 569.0 36 2472.0 37 151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.55 12.725 17.150000000000002 43.575 2 26.85 22.575 28.575 22.0 3 26.325 26.8 18.2 28.675 4 31.424999999999997 28.725 15.425 24.425 5 28.849999999999998 29.725 19.400000000000002 22.025 6 20.775 31.75 20.474999999999998 27.0 7 21.2 13.775 36.125 28.9 8 23.150000000000002 16.950000000000003 25.374999999999996 34.525 9 23.875 18.425 26.6 31.1 10-14 25.629999999999995 23.47 22.64 28.26 15-19 25.595000000000002 22.575 23.375 28.455000000000002 20-24 26.43 23.635 22.645 27.29 25-29 26.235000000000003 23.195 22.545 28.025 30-34 26.765 22.63 23.07 27.534999999999997 35-39 26.44 23.325000000000003 22.365 27.87 40-44 26.424999999999997 22.42 22.735 28.42 45-49 26.685 22.795 22.55 27.97 50-54 26.325 22.38 22.18 29.115000000000002 55-59 26.724999999999998 22.220000000000002 22.725 28.33 60-64 27.22 22.31 22.16 28.310000000000002 65-69 26.685 22.439999999999998 22.425 28.449999999999996 70-74 27.200000000000003 22.3 21.555 28.945 75-79 27.529999999999998 22.395 21.905 28.17 80-84 27.034999999999997 22.29 22.285 28.389999999999997 85-89 27.73 22.57 21.945 27.755000000000003 90-94 27.55 22.375 22.225 27.85 95-99 27.88 22.545 21.4 28.175 100-104 27.63 22.46 22.055 27.855 105-109 27.92 22.335 22.18 27.565 110-114 27.834999999999997 22.455 22.264999999999997 27.445000000000004 115-119 28.18 22.32 21.77 27.73 120-124 27.715 22.235 22.095000000000002 27.955000000000002 125-129 27.98 22.03 22.93 27.060000000000002 130-134 28.060000000000002 22.43 22.15 27.36 135-139 28.49 22.025 22.29 27.195000000000004 140-144 27.965 22.5 22.355 27.18 145-149 28.9 22.439999999999998 22.035 26.625 150 28.9 23.075000000000003 21.825 26.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 1.0 4 1.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.0 28 0.5 29 4.0 30 8.0 31 8.0 32 9.5 33 12.5 34 15.0 35 24.5 36 35.5 37 42.0 38 50.0 39 58.5 40 74.0 41 86.5 42 101.0 43 130.5 44 146.5 45 137.5 46 131.5 47 130.0 48 136.5 49 146.0 50 125.0 51 110.5 52 108.0 53 94.0 54 96.0 55 92.5 56 99.0 57 101.0 58 82.0 59 94.0 60 92.5 61 83.0 62 94.0 63 89.0 64 96.0 65 100.0 66 82.5 67 81.0 68 81.5 69 88.0 70 90.0 71 78.0 72 73.0 73 69.0 74 54.5 75 43.5 76 39.0 77 35.5 78 35.0 79 25.5 80 17.5 81 14.0 82 9.5 83 9.0 84 6.0 85 3.5 86 2.5 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.0013458950202 86.375 2 6.4064602960969035 11.899999999999999 3 0.5383580080753702 1.5 4 0.026917900403768503 0.1 5 0.026917900403768503 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.05 0.0 0.0 0.0 0.025 60-61 0.05 0.0 0.0 0.0 0.025 62-63 0.05 0.0 0.0 0.0 0.025 64-65 0.05 0.0 0.0 0.0 0.025 66-67 0.05 0.0 0.0 0.0 0.025 68-69 0.05 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.0625 0.0 0.0 0.0 0.025 84-85 0.0875 0.0 0.0 0.0 0.025 86-87 0.15 0.0 0.0 0.0 0.025 88-89 0.2 0.0 0.0 0.0 0.025 90-91 0.225 0.0 0.0 0.0 0.025 92-93 0.225 0.0 0.0 0.0 0.025 94-95 0.225 0.0 0.0 0.0 0.025 96-97 0.25 0.0 0.0 0.0 0.025 98-99 0.25 0.0 0.0 0.0 0.025 100-101 0.2625 0.0 0.0 0.0 0.025 102-103 0.275 0.0 0.0 0.0 0.025 104-105 0.275 0.0 0.0 0.0 0.025 106-107 0.275 0.0 0.0 0.0 0.025 108-109 0.275 0.0 0.0 0.0 0.025 110-111 0.325 0.0 0.0 0.0 0.025 112-113 0.35 0.0 0.0 0.0 0.025 114-115 0.3875 0.0 0.0 0.0 0.025 116-117 0.45 0.0 0.0 0.0 0.025 118-119 0.4875 0.0 0.0 0.0 0.025 120-121 0.5125 0.0 0.0 0.0 0.025 122-123 0.525 0.0 0.0 0.0 0.025 124-125 0.6375 0.0 0.0 0.0 0.025 126-127 0.675 0.0 0.0 0.0 0.025 128-129 0.7375 0.0 0.0 0.0 0.025 130-131 0.8 0.0 0.0 0.0 0.025 132-133 0.8625 0.0 0.0 0.0 0.025 134-135 0.925 0.0 0.0 0.0 0.025 136-137 1.0125 0.0 0.0 0.0 0.025 138 1.1 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469189 spots for ERR9452516.sra Written 1469189 spots for ERR9452516.sra Read 1469204 spots for ERR9452516.sra Written 1469204 spots for ERR9452516.sra SRR ids: ['ERR9452516.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pl4ot2k_ ERR9452516.sra spots: 29383795 blocks: [[1, 1469189], [1469190, 2938378], [2938379, 4407567], [4407568, 5876756], [5876757, 7345945], [7345946, 8815134], [8815135, 10284323], [10284324, 11753512], [11753513, 13222701], [13222702, 14691890], [14691891, 16161079], [16161080, 17630268], [17630269, 19099457], [19099458, 20568646], [20568647, 22037835], [22037836, 23507024], [23507025, 24976213], [24976214, 26445402], [26445403, 27914591], [27914592, 29383795]] ERR9452516 file size 9878113 ERR9452516 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR9452516 ERR9452516_1.fastq ERR9452516_2.fastq Input file: ERR9452516_1.fastq Paired file: ERR9452516_2.fastq trimmed: ERR9452516-trimmed-pair1.fastq, ERR9452516-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:12:22 2024 >> started Fri Dec 6 23:13:36 2024 >> done (74.162s) 29383795 read pairs processed; of these: 211 ( 0.00%) short read pairs filtered out after trimming by size control 679 ( 0.00%) empty read pairs filtered out after trimming by size control 29382905 (100.00%) read pairs available; of these: 669102 ( 2.28%) trimmed read pairs available after processing 28713803 (97.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 47 0.00% 20 4835 0.02% 21 50 0.00% 22 10 0.00% 23 13 0.00% 24 9 0.00% 25 13 0.00% 26 26 0.00% 27 16 0.00% 28 26 0.00% 29 35 0.00% 30 88 0.00% 31 31 0.00% 32 22 0.00% 33 21 0.00% 34 22 0.00% 35 20 0.00% 36 17 0.00% 37 36 0.00% 38 28 0.00% 39 18 0.00% 40 33 0.00% 41 41 0.00% 42 41 0.00% 43 55 0.00% 44 44 0.00% 45 34 0.00% 46 43 0.00% 47 59 0.00% 48 60 0.00% 49 72 0.00% 50 105 0.00% 51 92 0.00% 52 150 0.00% 53 148 0.00% 54 169 0.00% 55 155 0.00% 56 188 0.00% 57 208 0.00% 58 243 0.00% 59 261 0.00% 60 332 0.00% 61 339 0.00% 62 319 0.00% 63 440 0.00% 64 488 0.00% 65 529 0.00% 66 532 0.00% 67 596 0.00% 68 595 0.00% 69 660 0.00% 70 746 0.00% 71 751 0.00% 72 771 0.00% 73 884 0.00% 74 967 0.00% 75 1089 0.00% 76 1074 0.00% 77 1112 0.00% 78 1189 0.00% 79 1239 0.00% 80 1333 0.00% 81 1458 0.00% 82 1394 0.00% 83 1495 0.01% 84 1672 0.01% 85 1721 0.01% 86 1950 0.01% 87 1978 0.01% 88 2071 0.01% 89 2149 0.01% 90 2215 0.01% 91 2324 0.01% 92 2401 0.01% 93 2577 0.01% 94 2701 0.01% 95 2963 0.01% 96 3002 0.01% 97 3052 0.01% 98 3123 0.01% 99 3186 0.01% 100 3599 0.01% 101 3741 0.01% 102 3774 0.01% 103 4167 0.01% 104 4410 0.02% 105 4445 0.02% 106 4604 0.02% 107 4652 0.02% 108 4989 0.02% 109 5209 0.02% 110 5318 0.02% 111 5660 0.02% 112 6062 0.02% 113 6336 0.02% 114 6600 0.02% 115 6597 0.02% 116 7054 0.02% 117 7359 0.03% 118 7675 0.03% 119 7904 0.03% 120 8364 0.03% 121 8539 0.03% 122 8930 0.03% 123 9189 0.03% 124 10158 0.03% 125 10612 0.04% 126 10980 0.04% 127 11244 0.04% 128 11693 0.04% 129 11766 0.04% 130 12477 0.04% 131 13050 0.04% 132 13532 0.05% 133 14500 0.05% 134 14877 0.05% 135 16023 0.05% 136 16397 0.06% 137 17498 0.06% 138 17558 0.06% 139 18352 0.06% 140 19340 0.07% 141 19549 0.07% 142 20944 0.07% 143 21953 0.07% 144 22726 0.08% 145 23972 0.08% 146 25665 0.09% 147 25863 0.09% 148 27453 0.09% 149 28725 0.10% 150 28713803 97.72% 29382905 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=24 prefix-density=0.32 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=166.42 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=19.9 sequence=GCCGCCGCCGCC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=20 prefix-density=0.31 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=173.87 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=20.3 sequence=GCCGCCGCCGCCA ERR9452516 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:14:57 Started mapping on | Dec 06 23:14:58 Finished on | Dec 06 23:18:22 Mapping speed, Million of reads per hour | 518.52 Number of input reads | 29382905 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 27564614 Uniquely mapped reads % | 93.81% Average mapped length | 297.48 Number of splices: Total | 26744129 Number of splices: Annotated (sjdb) | 25259029 Number of splices: GT/AG | 26332532 Number of splices: GC/AG | 342406 Number of splices: AT/AC | 11032 Number of splices: Non-canonical | 58159 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419952 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 72648 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 2.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1398339 1398339 1398339 N_multimapping 419952 419952 419952 N_noFeature 898054 13947207 14032227 N_ambiguous 645869 83855 84072 UnstrandedReadsAssigned:26020691 PositiveStrandReadsAssigned:13533552 NegativeStrandReadsAssigned:13448315 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 ERR9452516 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR9452516-trimmed-pair1.fastq ERR9452516-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,382,905 reads, 27,019,260 reads pseudoaligned [quant] estimated average fragment length: 239.773 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 ERR9452516.ke.tsv 35125 ERR9452516.se.tsv 88098 total ==> ERR9452516.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.466 0 0 PNS24247 1044 805.227 62.4649 3.67356 PNS24249 1928 1689.23 405.813 11.3765 PNS24246 1044 805.227 62.4649 3.67356 PNS24248 1044 805.227 62.4649 3.67356 PNS24244 1471 1232.23 5.79237 0.222605 PNS24243 293 66.5911 28 19.9119 KQK14069 1603 1364.23 22116 767.696 KQK14071 474 237.114 1925.48 384.549 ==> ERR9452516.se.tsv <== BRADI_1g14170v3 25828 BRADI_1g53295v3 697 BRADI_1g59795v3 123 BRADI_1g07683v3 0 BRADI_1g00485v3 85 BRADI_1g20270v3 989 BRADI_1g74790v3 411 BRADI_1g09890v3 7 BRADI_1g77505v3 573 BRADI_1g48960v3 0 ERR9452516 completed mapping pipeline successfully