Starting /dee2/code/volunteer_pipeline.sh ERR9452518 current disk space = 1547483365376 free memory = 1373334000 ERR9452518 SRAfilesize 0a8f5b875c46c12c360064305760f140 ERR9452518.sra ERR9452518.sra file validated ERR9452518 is paired end ERR9452518 is conventional basespace ERR9452518 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452518_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.70275 37.0 37.0 37.0 37.0 37.0 2 35.7315 37.0 37.0 37.0 37.0 37.0 3 36.0865 37.0 37.0 37.0 37.0 37.0 4 36.108 37.0 37.0 37.0 37.0 37.0 5 36.165 37.0 37.0 37.0 37.0 37.0 6 36.1815 37.0 37.0 37.0 37.0 37.0 7 36.1245 37.0 37.0 37.0 37.0 37.0 8 36.2415 37.0 37.0 37.0 37.0 37.0 9 36.285 37.0 37.0 37.0 37.0 37.0 10-14 36.2856 37.0 37.0 37.0 37.0 37.0 15-19 36.1946 37.0 37.0 37.0 37.0 37.0 20-24 36.1434 37.0 37.0 37.0 37.0 37.0 25-29 36.0382 37.0 37.0 37.0 37.0 37.0 30-34 36.105399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0937 37.0 37.0 37.0 37.0 37.0 40-44 35.9559 37.0 37.0 37.0 37.0 37.0 45-49 35.874399999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.935199999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.947799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0002 37.0 37.0 37.0 37.0 37.0 65-69 35.9379 37.0 37.0 37.0 37.0 37.0 70-74 35.8984 37.0 37.0 37.0 37.0 37.0 75-79 35.8724 37.0 37.0 37.0 37.0 37.0 80-84 35.875299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.903200000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.863099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.80839999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.7311 37.0 37.0 37.0 37.0 37.0 105-109 35.748900000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.7453 37.0 37.0 37.0 37.0 37.0 115-119 35.7116 37.0 37.0 37.0 37.0 37.0 120-124 35.6532 37.0 37.0 37.0 37.0 37.0 125-129 35.662099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.5019 37.0 37.0 37.0 37.0 37.0 135-139 35.4585 37.0 37.0 37.0 37.0 37.0 140-144 35.4095 37.0 37.0 37.0 34.6 37.0 145-149 35.4387 37.0 37.0 37.0 37.0 37.0 150 35.6755 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 3.0 25 8.0 26 8.0 27 22.0 28 30.0 29 30.0 30 57.0 31 75.0 32 112.0 33 112.0 34 175.0 35 379.0 36 2625.0 37 359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.81101376720901 13.692115143929911 13.917396745932415 43.57947434292866 2 28.325 21.275 29.375 21.025 3 25.874999999999996 26.875 18.7 28.549999999999997 4 29.725 30.125 16.875 23.275000000000002 5 29.425 29.45 18.35 22.775000000000002 6 20.5 32.65 20.424999999999997 26.424999999999997 7 20.525 13.475000000000001 36.775000000000006 29.225 8 22.5 18.15 23.425 35.925000000000004 9 23.575 18.15 25.825 32.45 10-14 25.86 24.465 21.975 27.700000000000003 15-19 26.419999999999998 22.705000000000002 23.549999999999997 27.325 20-24 26.064999999999998 23.445 22.96 27.529999999999998 25-29 26.97 22.98 23.02 27.029999999999998 30-34 26.69 23.14 22.435 27.735 35-39 26.655 23.865 22.17 27.310000000000002 40-44 26.83 22.525000000000002 22.91 27.735 45-49 26.365 22.58 23.0 28.055000000000003 50-54 26.529999999999998 23.18 22.37 27.92 55-59 27.41 22.905 21.525 28.16 60-64 27.205000000000002 22.945 22.66 27.189999999999998 65-69 27.279999999999998 22.3 22.62 27.800000000000004 70-74 27.150000000000002 22.615 22.275 27.96 75-79 27.060000000000002 23.18 21.645 28.115000000000002 80-84 26.810000000000002 22.63 22.41 28.15 85-89 27.560000000000002 22.07 22.205 28.165000000000003 90-94 26.834999999999997 22.82 22.264999999999997 28.08 95-99 27.644999999999996 21.959999999999997 22.43 27.965 100-104 27.48 21.875 22.759999999999998 27.884999999999998 105-109 27.345000000000002 22.564999999999998 22.759999999999998 27.33 110-114 26.87 22.35 22.3 28.48 115-119 27.96 22.255 22.17 27.615000000000002 120-124 27.584999999999997 22.295 22.515 27.605 125-129 27.725 22.645 21.965 27.665 130-134 27.500000000000004 22.400000000000002 22.975 27.125 135-139 28.08 22.445 22.495 26.979999999999997 140-144 27.625 22.884999999999998 22.485 27.005000000000003 145-149 28.125 22.57 22.475 26.83 150 26.674999999999997 22.325 23.875 27.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 0.5 27 0.5 28 2.5 29 3.0 30 5.0 31 7.5 32 11.0 33 17.0 34 16.5 35 23.0 36 38.0 37 48.5 38 60.0 39 76.0 40 89.5 41 94.5 42 94.0 43 114.0 44 128.5 45 137.5 46 140.5 47 142.5 48 145.0 49 124.0 50 113.0 51 111.0 52 109.0 53 112.0 54 109.5 55 101.0 56 97.5 57 88.5 58 89.5 59 98.5 60 97.0 61 98.5 62 91.0 63 86.5 64 80.0 65 77.5 66 84.5 67 82.5 68 91.5 69 84.0 70 74.5 71 71.0 72 64.5 73 71.5 74 66.5 75 52.0 76 39.5 77 30.0 78 25.0 79 19.0 80 17.0 81 15.5 82 10.5 83 4.5 84 4.0 85 4.0 86 3.0 87 2.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.90217391304348 84.55 2 7.527173913043478 13.850000000000001 3 0.5434782608695652 1.5 4 0.02717391304347826 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.55 0.0 0.0 0.0 0.0 130-131 0.6625 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.85 0.0 0.0 0.0 0.0 136-137 0.9375 0.0 0.0 0.0 0.0 138 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR9452518 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452518_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8935 37.0 37.0 37.0 37.0 37.0 2 35.683 37.0 37.0 37.0 37.0 37.0 3 35.9795 37.0 37.0 37.0 37.0 37.0 4 35.8705 37.0 37.0 37.0 37.0 37.0 5 35.85 37.0 37.0 37.0 37.0 37.0 6 35.7935 37.0 37.0 37.0 37.0 37.0 7 36.013 37.0 37.0 37.0 37.0 37.0 8 35.9845 37.0 37.0 37.0 37.0 37.0 9 35.893 37.0 37.0 37.0 37.0 37.0 10-14 35.974000000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.94069999999999 37.0 37.0 37.0 37.0 37.0 20-24 35.9183 37.0 37.0 37.0 37.0 37.0 25-29 35.99829999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.9172 37.0 37.0 37.0 37.0 37.0 35-39 35.924099999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9097 37.0 37.0 37.0 37.0 37.0 45-49 35.88470000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.799400000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.805899999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.7725 37.0 37.0 37.0 37.0 37.0 65-69 35.7477 37.0 37.0 37.0 37.0 37.0 70-74 35.6798 37.0 37.0 37.0 37.0 37.0 75-79 35.6611 37.0 37.0 37.0 37.0 37.0 80-84 35.6322 37.0 37.0 37.0 37.0 37.0 85-89 35.492399999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.4983 37.0 37.0 37.0 37.0 37.0 95-99 35.4684 37.0 37.0 37.0 34.6 37.0 100-104 35.4688 37.0 37.0 37.0 37.0 37.0 105-109 35.4788 37.0 37.0 37.0 37.0 37.0 110-114 35.3602 37.0 37.0 37.0 34.6 37.0 115-119 35.44109999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.2783 37.0 37.0 37.0 34.6 37.0 125-129 35.20830000000001 37.0 37.0 37.0 32.2 37.0 130-134 35.1694 37.0 37.0 37.0 32.2 37.0 135-139 35.2764 37.0 37.0 37.0 32.2 37.0 140-144 35.1948 37.0 37.0 37.0 32.2 37.0 145-149 34.8918 37.0 37.0 37.0 25.0 37.0 150 35.3475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 3.0 22 7.0 23 7.0 24 6.0 25 10.0 26 20.0 27 25.0 28 26.0 29 52.0 30 49.0 31 63.0 32 101.0 33 135.0 34 216.0 35 540.0 36 2528.0 37 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.075 13.425 16.375 44.125 2 28.875 21.275 28.15 21.7 3 26.674999999999997 27.525 19.175 26.625 4 28.9 30.025000000000002 16.425 24.65 5 28.050000000000004 31.275 18.2 22.475 6 21.925 33.2 18.075 26.8 7 21.25 13.5 37.425000000000004 27.825 8 21.825 17.65 24.375 36.15 9 23.025000000000002 18.725 28.075 30.175 10-14 25.445 24.075 22.715 27.765 15-19 26.419999999999998 22.720000000000002 22.8 28.060000000000002 20-24 26.484999999999996 23.880000000000003 22.03 27.605 25-29 26.46 22.985 23.02 27.534999999999997 30-34 26.179999999999996 23.28 22.84 27.700000000000003 35-39 26.39 22.585 23.135 27.889999999999997 40-44 26.540000000000003 23.485 22.439999999999998 27.534999999999997 45-49 27.165 22.900000000000002 22.205 27.73 50-54 26.76 22.255 22.869999999999997 28.115000000000002 55-59 27.05 23.04 22.335 27.575 60-64 26.77 23.35 21.95 27.93 65-69 26.76 23.215 22.314999999999998 27.71 70-74 26.939999999999998 22.68 22.17 28.21 75-79 27.235 22.945 22.225 27.595 80-84 27.115000000000002 23.275000000000002 21.95 27.66 85-89 27.060000000000002 22.825 22.61 27.505000000000003 90-94 27.27 22.605 22.85 27.275 95-99 27.339999999999996 23.544999999999998 21.775 27.339999999999996 100-104 27.765 22.45 22.314999999999998 27.47 105-109 27.21 22.625 22.205 27.96 110-114 27.43 22.45 22.6 27.52 115-119 27.43 23.31 21.275 27.985 120-124 27.655 23.04 22.125 27.18 125-129 28.08 22.46 21.625 27.834999999999997 130-134 28.105000000000004 22.585 22.45 26.86 135-139 27.48 22.675 22.605 27.24 140-144 27.689999999999998 22.259999999999998 22.75 27.3 145-149 27.57 22.785 22.33 27.315 150 28.625 21.925 21.7 27.750000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.5 29 3.0 30 4.5 31 6.0 32 10.0 33 17.5 34 24.5 35 28.5 36 38.5 37 48.0 38 60.5 39 81.0 40 85.0 41 99.0 42 115.5 43 133.0 44 144.5 45 135.5 46 134.0 47 137.5 48 134.5 49 123.0 50 106.0 51 103.0 52 110.5 53 101.0 54 88.5 55 91.5 56 103.0 57 95.5 58 86.0 59 84.0 60 97.0 61 108.0 62 96.0 63 89.0 64 90.5 65 91.5 66 80.5 67 79.0 68 80.0 69 79.5 70 87.0 71 70.5 72 62.5 73 70.0 74 56.0 75 49.0 76 38.5 77 26.5 78 28.5 79 20.5 80 13.0 81 10.5 82 11.0 83 10.0 84 5.0 85 2.0 86 1.5 87 1.5 88 1.0 89 1.5 90 1.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53167969803181 85.8 2 7.117821515233216 13.200000000000001 3 0.3235373416015098 0.8999999999999999 4 0.026961445133459154 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.225 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.4625 0.0 0.0 0.0 0.0 126-127 0.475 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.6375 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.85 0.0 0.0 0.0 0.0 136-137 0.9375 0.0 0.0 0.0 0.0 138 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450452 spots for ERR9452518.sra Written 1450452 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra Read 1450438 spots for ERR9452518.sra Written 1450438 spots for ERR9452518.sra SRR ids: ['ERR9452518.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xsxewhe6 ERR9452518.sra spots: 29008774 blocks: [[1, 1450438], [1450439, 2900876], [2900877, 4351314], [4351315, 5801752], [5801753, 7252190], [7252191, 8702628], [8702629, 10153066], [10153067, 11603504], [11603505, 13053942], [13053943, 14504380], [14504381, 15954818], [15954819, 17405256], [17405257, 18855694], [18855695, 20306132], [20306133, 21756570], [21756571, 23207008], [23207009, 24657446], [24657447, 26107884], [26107885, 27558322], [27558323, 29008774]] ERR9452518 file size 9751763 ERR9452518 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR9452518 ERR9452518_1.fastq ERR9452518_2.fastq Input file: ERR9452518_1.fastq Paired file: ERR9452518_2.fastq trimmed: ERR9452518-trimmed-pair1.fastq, ERR9452518-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:32:04 2024 >> started Fri Dec 6 23:32:36 2024 >> done (32.680s) 29008774 read pairs processed; of these: 158 ( 0.00%) short read pairs filtered out after trimming by size control 918 ( 0.00%) empty read pairs filtered out after trimming by size control 29007698 (100.00%) read pairs available; of these: 601397 ( 2.07%) trimmed read pairs available after processing 28406301 (97.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 46 0.00% 20 4844 0.02% 21 46 0.00% 22 13 0.00% 23 12 0.00% 24 13 0.00% 25 17 0.00% 26 17 0.00% 27 36 0.00% 28 34 0.00% 29 38 0.00% 30 116 0.00% 31 33 0.00% 32 35 0.00% 33 30 0.00% 34 28 0.00% 35 32 0.00% 36 23 0.00% 37 40 0.00% 38 40 0.00% 39 37 0.00% 40 47 0.00% 41 43 0.00% 42 46 0.00% 43 39 0.00% 44 59 0.00% 45 51 0.00% 46 65 0.00% 47 67 0.00% 48 70 0.00% 49 80 0.00% 50 97 0.00% 51 100 0.00% 52 127 0.00% 53 116 0.00% 54 133 0.00% 55 146 0.00% 56 147 0.00% 57 181 0.00% 58 200 0.00% 59 206 0.00% 60 229 0.00% 61 287 0.00% 62 278 0.00% 63 319 0.00% 64 323 0.00% 65 310 0.00% 66 450 0.00% 67 465 0.00% 68 454 0.00% 69 461 0.00% 70 511 0.00% 71 576 0.00% 72 589 0.00% 73 711 0.00% 74 630 0.00% 75 746 0.00% 76 716 0.00% 77 785 0.00% 78 881 0.00% 79 849 0.00% 80 921 0.00% 81 1066 0.00% 82 1165 0.00% 83 1135 0.00% 84 1139 0.00% 85 1371 0.00% 86 1318 0.00% 87 1442 0.00% 88 1411 0.00% 89 1573 0.01% 90 1575 0.01% 91 1625 0.01% 92 1933 0.01% 93 1915 0.01% 94 1892 0.01% 95 2292 0.01% 96 2232 0.01% 97 2571 0.01% 98 2428 0.01% 99 2605 0.01% 100 2785 0.01% 101 2714 0.01% 102 3110 0.01% 103 3470 0.01% 104 3387 0.01% 105 3624 0.01% 106 3744 0.01% 107 3884 0.01% 108 4000 0.01% 109 4215 0.01% 110 4483 0.02% 111 4709 0.02% 112 5080 0.02% 113 5243 0.02% 114 5570 0.02% 115 5810 0.02% 116 5949 0.02% 117 5974 0.02% 118 6637 0.02% 119 7025 0.02% 120 7117 0.02% 121 7621 0.03% 122 8061 0.03% 123 8421 0.03% 124 8659 0.03% 125 9164 0.03% 126 9561 0.03% 127 9795 0.03% 128 10490 0.04% 129 10975 0.04% 130 11265 0.04% 131 11861 0.04% 132 12655 0.04% 133 13157 0.05% 134 14273 0.05% 135 14637 0.05% 136 15376 0.05% 137 16119 0.06% 138 16216 0.06% 139 17581 0.06% 140 17760 0.06% 141 18868 0.07% 142 19599 0.07% 143 20916 0.07% 144 21543 0.07% 145 23099 0.08% 146 24154 0.08% 147 25383 0.09% 148 26889 0.09% 149 27022 0.09% 150 28406301 97.93% 29007698 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=17 prefix-density=0.32 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=139.20 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=16.3 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=1.9 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAATCCGGCAAGGCATAAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATAAAGTGTCAGCTCAGTTTTGTCAACTCTGACATTGCTTTGAGTTTTCTATTTTTCATCCCCAAGATTGTTGTTGTGTGTAGCAACCTGGCTCTCGATCGAGGAGCTAGCTTGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=124.47 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=16.5 sequence=GCCGCCGCCGCCA ERR9452518 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:33:57 Started mapping on | Dec 06 23:33:58 Finished on | Dec 06 23:37:24 Mapping speed, Million of reads per hour | 506.93 Number of input reads | 29007698 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 27223203 Uniquely mapped reads % | 93.85% Average mapped length | 297.53 Number of splices: Total | 26077552 Number of splices: Annotated (sjdb) | 24621673 Number of splices: GT/AG | 25677800 Number of splices: GC/AG | 330394 Number of splices: AT/AC | 9991 Number of splices: Non-canonical | 59367 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418514 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 69093 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 2.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1365981 1365981 1365981 N_multimapping 418514 418514 418514 N_noFeature 939291 13766783 13878712 N_ambiguous 671104 80158 80346 UnstrandedReadsAssigned:25612808 PositiveStrandReadsAssigned:13376262 NegativeStrandReadsAssigned:13264145 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 ERR9452518 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR9452518-trimmed-pair1.fastq ERR9452518-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,007,698 reads, 26,640,101 reads pseudoaligned [quant] estimated average fragment length: 244.306 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 ERR9452518.ke.tsv 35125 ERR9452518.se.tsv 88098 total ==> ERR9452518.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.982 0 0 PNS24247 1044 800.694 32.0875 1.89263 PNS24249 1928 1684.69 339.17 9.50808 PNS24246 1044 800.694 32.0875 1.89263 PNS24248 1044 800.694 32.0875 1.89263 PNS24244 1471 1227.69 33.5677 1.2913 PNS24243 293 65.5318 30 21.6205 KQK14069 1603 1359.69 16355.3 568.086 KQK14071 474 233.079 1760.29 356.68 ==> ERR9452518.se.tsv <== BRADI_1g14170v3 19644 BRADI_1g53295v3 822 BRADI_1g59795v3 121 BRADI_1g07683v3 0 BRADI_1g00485v3 66 BRADI_1g20270v3 1189 BRADI_1g74790v3 527 BRADI_1g09890v3 4 BRADI_1g77505v3 603 BRADI_1g48960v3 0 ERR9452518 completed mapping pipeline successfully