Starting /dee2/code/volunteer_pipeline.sh ERR9452520 current disk space = 1547563466752 free memory = 1369517528 ERR9452520 SRAfilesize 6f002a31ce285218e11edb7ff59b718f ERR9452520.sra ERR9452520.sra file validated ERR9452520 is paired end ERR9452520 is conventional basespace ERR9452520 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452520_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.51925 37.0 37.0 37.0 37.0 37.0 2 35.50425 37.0 37.0 37.0 37.0 37.0 3 36.08 37.0 37.0 37.0 37.0 37.0 4 35.969 37.0 37.0 37.0 37.0 37.0 5 36.004 37.0 37.0 37.0 37.0 37.0 6 35.997 37.0 37.0 37.0 37.0 37.0 7 36.003 37.0 37.0 37.0 37.0 37.0 8 36.1495 37.0 37.0 37.0 37.0 37.0 9 36.2265 37.0 37.0 37.0 37.0 37.0 10-14 36.1693 37.0 37.0 37.0 37.0 37.0 15-19 36.122800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.07619999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.996900000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.937599999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9226 37.0 37.0 37.0 37.0 37.0 40-44 35.77569999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.710300000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.84689999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.758300000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.845 37.0 37.0 37.0 37.0 37.0 65-69 35.7451 37.0 37.0 37.0 37.0 37.0 70-74 35.8083 37.0 37.0 37.0 37.0 37.0 75-79 35.75150000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.6535 37.0 37.0 37.0 37.0 37.0 85-89 35.7382 37.0 37.0 37.0 37.0 37.0 90-94 35.670100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.584500000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.57690000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.561 37.0 37.0 37.0 37.0 37.0 110-114 35.497400000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.475100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.494299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.50449999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3626 37.0 37.0 37.0 37.0 37.0 135-139 35.2199 37.0 37.0 37.0 32.2 37.0 140-144 35.2171 37.0 37.0 37.0 29.8 37.0 145-149 35.3396 37.0 37.0 37.0 37.0 37.0 150 35.4375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 3.0 24 5.0 25 13.0 26 11.0 27 26.0 28 45.0 29 52.0 30 66.0 31 84.0 32 111.0 33 150.0 34 190.0 35 381.0 36 2514.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.80745186296574 13.703425856464117 13.80345086271568 42.685671417854465 2 29.557389347336834 21.48037009252313 28.557139284821204 20.40510127531883 3 26.650000000000002 26.275 18.8 28.275 4 29.15 30.025000000000002 16.025 24.8 5 28.050000000000004 30.925000000000004 18.625 22.400000000000002 6 22.6 31.0 19.725 26.674999999999997 7 21.224999999999998 13.325000000000001 37.525 27.925 8 23.35 17.525 24.6 34.525 9 23.599999999999998 18.325 26.625 31.45 10-14 26.290000000000003 23.895 21.375 28.439999999999998 15-19 27.07 22.575 22.919999999999998 27.435 20-24 26.625 23.255 21.884999999999998 28.235 25-29 27.029999999999998 23.06 22.564999999999998 27.345000000000002 30-34 26.924999999999997 22.615 22.134999999999998 28.325 35-39 27.625 22.535 22.435 27.405 40-44 27.24 22.54 22.12 28.1 45-49 26.979999999999997 23.01 22.045 27.965 50-54 27.35 22.689999999999998 21.85 28.110000000000003 55-59 27.845 22.075 22.065 28.015 60-64 26.595000000000002 22.345000000000002 22.134999999999998 28.925 65-69 27.76 21.955 21.91 28.375 70-74 27.395000000000003 22.895 21.375 28.335 75-79 27.075 22.1 21.975 28.849999999999998 80-84 27.87 22.32 21.735 28.075 85-89 27.439999999999998 22.15 22.015 28.395 90-94 27.229999999999997 22.884999999999998 22.075 27.810000000000002 95-99 27.83 22.525000000000002 21.615000000000002 28.03 100-104 27.68 22.425 21.285 28.610000000000003 105-109 28.49 21.959999999999997 21.759999999999998 27.79 110-114 28.165000000000003 21.875 21.77 28.189999999999998 115-119 28.275 21.965 21.775 27.985 120-124 27.560000000000002 22.38 21.98 28.08 125-129 28.095 22.63 21.65 27.625 130-134 27.534999999999997 22.145 21.89 28.43 135-139 27.975 22.205 22.02 27.800000000000004 140-144 28.705000000000002 22.07 21.845 27.38 145-149 27.810000000000002 22.535 21.895 27.76 150 26.525 22.675 22.6 28.199999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.0 27 0.5 28 2.0 29 2.0 30 3.0 31 7.5 32 9.5 33 11.0 34 18.5 35 26.5 36 32.0 37 37.5 38 41.5 39 64.0 40 85.0 41 97.0 42 102.5 43 107.0 44 125.5 45 139.0 46 139.0 47 135.0 48 125.5 49 109.0 50 106.5 51 109.0 52 106.0 53 106.0 54 108.0 55 108.0 56 97.0 57 90.5 58 94.0 59 94.5 60 95.5 61 104.0 62 98.5 63 92.0 64 97.5 65 98.0 66 93.5 67 88.5 68 92.5 69 88.5 70 76.0 71 69.5 72 74.0 73 70.0 74 53.5 75 52.5 76 51.5 77 38.5 78 30.0 79 28.0 80 26.5 81 18.5 82 9.5 83 2.5 84 2.0 85 2.5 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.43339587242026 87.15 2 5.976949879388903 11.15 3 0.5360493165371214 1.5 4 0.05360493165371214 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.65 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.875 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138 1.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAGT 10 0.006973645 144.0 6 TTACTTC 10 0.006973645 144.0 3 ACTTCAG 10 0.006973645 144.0 5 GTTTACT 10 0.006973645 144.0 1 TACTTCA 10 0.006973645 144.0 4 >>END_MODULE ERR9452520 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452520_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.753 37.0 37.0 37.0 37.0 37.0 2 35.824 37.0 37.0 37.0 37.0 37.0 3 35.8995 37.0 37.0 37.0 37.0 37.0 4 35.9135 37.0 37.0 37.0 37.0 37.0 5 35.8805 37.0 37.0 37.0 37.0 37.0 6 35.782 37.0 37.0 37.0 37.0 37.0 7 35.8495 37.0 37.0 37.0 37.0 37.0 8 35.792 37.0 37.0 37.0 37.0 37.0 9 35.749 37.0 37.0 37.0 37.0 37.0 10-14 36.0158 37.0 37.0 37.0 37.0 37.0 15-19 35.884 37.0 37.0 37.0 37.0 37.0 20-24 35.796299999999995 37.0 37.0 37.0 37.0 37.0 25-29 35.9063 37.0 37.0 37.0 37.0 37.0 30-34 35.781400000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.869600000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.8324 37.0 37.0 37.0 37.0 37.0 45-49 35.6837 37.0 37.0 37.0 37.0 37.0 50-54 35.7731 37.0 37.0 37.0 37.0 37.0 55-59 35.7054 37.0 37.0 37.0 37.0 37.0 60-64 35.633500000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.649300000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.678999999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6399 37.0 37.0 37.0 37.0 37.0 80-84 35.6366 37.0 37.0 37.0 37.0 37.0 85-89 35.4745 37.0 37.0 37.0 37.0 37.0 90-94 35.499900000000004 37.0 37.0 37.0 34.6 37.0 95-99 35.416900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.4942 37.0 37.0 37.0 37.0 37.0 105-109 35.4804 37.0 37.0 37.0 37.0 37.0 110-114 35.4464 37.0 37.0 37.0 34.6 37.0 115-119 35.3947 37.0 37.0 37.0 37.0 37.0 120-124 35.2575 37.0 37.0 37.0 34.6 37.0 125-129 35.231100000000005 37.0 37.0 37.0 32.2 37.0 130-134 35.2484 37.0 37.0 37.0 32.2 37.0 135-139 35.3948 37.0 37.0 37.0 34.6 37.0 140-144 35.1764 37.0 37.0 37.0 29.8 37.0 145-149 34.9133 37.0 37.0 37.0 25.0 37.0 150 35.3525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 0.0 17 2.0 18 2.0 19 4.0 20 2.0 21 0.0 22 5.0 23 7.0 24 13.0 25 12.0 26 19.0 27 24.0 28 37.0 29 39.0 30 57.0 31 72.0 32 95.0 33 130.0 34 206.0 35 545.0 36 2473.0 37 254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.050000000000004 13.475000000000001 15.275 43.2 2 28.349999999999998 21.5 27.075 23.075000000000003 3 26.825 25.75 18.35 29.075 4 31.4 28.349999999999998 15.475 24.775 5 29.175 29.9 17.95 22.975 6 21.175 32.05 20.424999999999997 26.35 7 21.25 13.15 37.75 27.85 8 21.325 18.025 25.5 35.15 9 23.200000000000003 17.849999999999998 26.400000000000002 32.550000000000004 10-14 25.97 23.61 22.205 28.215 15-19 26.340000000000003 22.15 22.884999999999998 28.625 20-24 26.445 22.985 22.335 28.235 25-29 26.115 23.16 22.770000000000003 27.955000000000002 30-34 26.265 22.945 22.29 28.499999999999996 35-39 27.33 22.705000000000002 22.17 27.794999999999998 40-44 26.865 23.400000000000002 21.525 28.21 45-49 26.72 22.5 22.66 28.12 50-54 26.945000000000004 22.835 22.495 27.725 55-59 27.42 22.235 22.55 27.794999999999998 60-64 27.665 22.575 22.13 27.63 65-69 27.125 21.965 22.875 28.035 70-74 27.68 22.264999999999997 21.975 28.08 75-79 27.189999999999998 22.06 22.58 28.17 80-84 27.46 22.295 22.585 27.66 85-89 27.83 21.785 22.165000000000003 28.22 90-94 27.935 22.39 21.72 27.955000000000002 95-99 28.27 21.72 21.755 28.255000000000003 100-104 27.810000000000002 21.82 22.814999999999998 27.555000000000003 105-109 28.035 22.175 21.654999999999998 28.134999999999998 110-114 28.18 21.66 22.475 27.685 115-119 28.410000000000004 22.045 21.77 27.775 120-124 28.315 21.82 21.975 27.889999999999997 125-129 27.74 22.55 21.81 27.900000000000002 130-134 27.855 21.51 21.77 28.865000000000002 135-139 28.125 21.815 22.295 27.765 140-144 28.455000000000002 22.195 22.085 27.265 145-149 28.225 22.32 21.925 27.529999999999998 150 28.775000000000002 21.925 21.55 27.750000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 3.0 30 7.0 31 9.5 32 12.5 33 12.5 34 11.5 35 19.5 36 33.5 37 47.5 38 58.0 39 64.5 40 78.5 41 87.0 42 92.5 43 115.5 44 133.5 45 139.5 46 134.0 47 131.5 48 127.5 49 124.5 50 123.0 51 108.5 52 100.5 53 101.5 54 106.0 55 106.0 56 102.5 57 92.0 58 86.5 59 96.0 60 92.0 61 96.0 62 96.5 63 79.5 64 77.5 65 88.0 66 99.5 67 94.5 68 92.5 69 100.0 70 86.5 71 76.0 72 82.5 73 76.5 74 64.0 75 51.5 76 36.5 77 26.5 78 27.0 79 21.0 80 16.0 81 15.0 82 8.5 83 8.0 84 7.0 85 4.5 86 1.5 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.37090713902309 86.97500000000001 2 5.984970477724101 11.15 3 0.5904455179817499 1.6500000000000001 4 0.026838432635534086 0.1 5 0.026838432635534086 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCGCCTCCTCTCACTCCCCTCCTCCTCTCGCCCCCACCCATGGCGACGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.575 0.0 0.0 0.0 0.0 128-129 0.5874999999999999 0.0 0.0 0.0 0.0 130-131 0.7125 0.0 0.0 0.0 0.0 132-133 0.825 0.0 0.0 0.0 0.0 134-135 0.95 0.0 0.0 0.0 0.0 136-137 1.0499999999999998 0.0 0.0 0.0 0.0 138 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATCCT 10 0.006973645 144.0 1 TATCCTT 10 0.006973645 144.0 2 GAAAACA 20 3.687869E-4 108.0 1 >>END_MODULE Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245792 spots for ERR9452520.sra Written 1245792 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra Read 1245788 spots for ERR9452520.sra Written 1245788 spots for ERR9452520.sra SRR ids: ['ERR9452520.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_df1xfabx ERR9452520.sra spots: 24915764 blocks: [[1, 1245788], [1245789, 2491576], [2491577, 3737364], [3737365, 4983152], [4983153, 6228940], [6228941, 7474728], [7474729, 8720516], [8720517, 9966304], [9966305, 11212092], [11212093, 12457880], [12457881, 13703668], [13703669, 14949456], [14949457, 16195244], [16195245, 17441032], [17441033, 18686820], [18686821, 19932608], [19932609, 21178396], [21178397, 22424184], [22424185, 23669972], [23669973, 24915764]] ERR9452520 file size 8372770 ERR9452520 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR9452520 ERR9452520_1.fastq ERR9452520_2.fastq Input file: ERR9452520_1.fastq Paired file: ERR9452520_2.fastq trimmed: ERR9452520-trimmed-pair1.fastq, ERR9452520-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:30:41 2024 >> started Fri Dec 6 23:31:11 2024 >> done (29.145s) 24915764 read pairs processed; of these: 293 ( 0.00%) short read pairs filtered out after trimming by size control 766 ( 0.00%) empty read pairs filtered out after trimming by size control 24914705 (100.00%) read pairs available; of these: 697064 ( 2.80%) trimmed read pairs available after processing 24217641 (97.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 30 0.00% 20 3063 0.01% 21 46 0.00% 22 12 0.00% 23 14 0.00% 24 19 0.00% 25 13 0.00% 26 18 0.00% 27 16 0.00% 28 22 0.00% 29 41 0.00% 30 133 0.00% 31 48 0.00% 32 23 0.00% 33 22 0.00% 34 24 0.00% 35 25 0.00% 36 23 0.00% 37 32 0.00% 38 23 0.00% 39 42 0.00% 40 41 0.00% 41 35 0.00% 42 49 0.00% 43 43 0.00% 44 36 0.00% 45 61 0.00% 46 73 0.00% 47 96 0.00% 48 89 0.00% 49 103 0.00% 50 116 0.00% 51 144 0.00% 52 163 0.00% 53 164 0.00% 54 171 0.00% 55 216 0.00% 56 225 0.00% 57 300 0.00% 58 372 0.00% 59 385 0.00% 60 411 0.00% 61 422 0.00% 62 405 0.00% 63 528 0.00% 64 573 0.00% 65 565 0.00% 66 650 0.00% 67 711 0.00% 68 767 0.00% 69 712 0.00% 70 789 0.00% 71 875 0.00% 72 989 0.00% 73 965 0.00% 74 1095 0.00% 75 1169 0.00% 76 1155 0.00% 77 1219 0.00% 78 1255 0.01% 79 1447 0.01% 80 1462 0.01% 81 1628 0.01% 82 1638 0.01% 83 1741 0.01% 84 1797 0.01% 85 1867 0.01% 86 2096 0.01% 87 2140 0.01% 88 2249 0.01% 89 2346 0.01% 90 2335 0.01% 91 2632 0.01% 92 2669 0.01% 93 2744 0.01% 94 3027 0.01% 95 2957 0.01% 96 3243 0.01% 97 3452 0.01% 98 3349 0.01% 99 3567 0.01% 100 3652 0.01% 101 4033 0.02% 102 4057 0.02% 103 4325 0.02% 104 4562 0.02% 105 4786 0.02% 106 4910 0.02% 107 5106 0.02% 108 5245 0.02% 109 5456 0.02% 110 5873 0.02% 111 5698 0.02% 112 6212 0.02% 113 6543 0.03% 114 6996 0.03% 115 7252 0.03% 116 7530 0.03% 117 7579 0.03% 118 7931 0.03% 119 8254 0.03% 120 8503 0.03% 121 8660 0.03% 122 9465 0.04% 123 9906 0.04% 124 10576 0.04% 125 10508 0.04% 126 11155 0.04% 127 11880 0.05% 128 12045 0.05% 129 12750 0.05% 130 13210 0.05% 131 13422 0.05% 132 14181 0.06% 133 15129 0.06% 134 15858 0.06% 135 16705 0.07% 136 17175 0.07% 137 17613 0.07% 138 18396 0.07% 139 18998 0.08% 140 19667 0.08% 141 20667 0.08% 142 21357 0.09% 143 22151 0.09% 144 23677 0.10% 145 24648 0.10% 146 26190 0.11% 147 26949 0.11% 148 28261 0.11% 149 29135 0.12% 150 24217641 97.20% 24914705 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=35 prefix-density=0.29 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAATCCGGCAAGGCATAAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATAAAGTGTCAGCTCAGTTTTGTCAACTCTGACATTGCTTTGAGTTTTCTATTTTTCATCCCCAAGATTGTTGTTGTGTGTAGCAACCTGGCTCTCGATCGAGGAGCTAGCTTGCATATGTGAATTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=30 fanout-score=148.88 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=16.9 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=33 prefix-density=0.28 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAATCCGGCAAGGCATAAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATAAAGTGTCAGCTCAGTTTTGTCAACTCTGACATTGCTTTGAGTTTTCTATTTTTCATCCCCAAGATTGTTGTTGTGTGTAGCAACCTGGCTCTCGATCGAGGAGCTAGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=145.78 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=17.8 sequence=GCCGCCGCCGCCA ERR9452520 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:32:20 Started mapping on | Dec 06 23:32:21 Finished on | Dec 06 23:35:09 Mapping speed, Million of reads per hour | 533.89 Number of input reads | 24914705 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23250643 Uniquely mapped reads % | 93.32% Average mapped length | 297.13 Number of splices: Total | 22241443 Number of splices: Annotated (sjdb) | 20976911 Number of splices: GT/AG | 21896690 Number of splices: GC/AG | 283738 Number of splices: AT/AC | 9324 Number of splices: Non-canonical | 51691 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356428 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 73411 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 2.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1307634 1307634 1307634 N_multimapping 356428 356428 356428 N_noFeature 779563 11761403 11834754 N_ambiguous 566147 68474 68266 UnstrandedReadsAssigned:21904933 PositiveStrandReadsAssigned:11420766 NegativeStrandReadsAssigned:11347623 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 ERR9452520 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR9452520-trimmed-pair1.fastq ERR9452520-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,914,705 reads, 22,787,465 reads pseudoaligned [quant] estimated average fragment length: 238.431 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52973 ERR9452520.ke.tsv 35125 ERR9452520.se.tsv 88098 total ==> ERR9452520.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.855 0 0 PNS24247 1044 806.569 23.0244 1.58333 PNS24249 1928 1690.57 331.253 10.868 PNS24246 1044 806.569 23.0244 1.58333 PNS24248 1044 806.569 23.0244 1.58333 PNS24244 1471 1233.57 29.6739 1.33424 PNS24243 293 69.0965 32 25.6872 KQK14069 1603 1365.57 16128.7 655.103 KQK14071 474 238.627 1822.17 423.54 ==> ERR9452520.se.tsv <== BRADI_1g14170v3 19875 BRADI_1g53295v3 588 BRADI_1g59795v3 108 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 849 BRADI_1g74790v3 434 BRADI_1g09890v3 3 BRADI_1g77505v3 561 BRADI_1g48960v3 0 ERR9452520 completed mapping pipeline successfully