Starting /dee2/code/volunteer_pipeline.sh ERR9452521 current disk space = 1547546071040 free memory = 1603050264 ERR9452521 SRAfilesize 3203cb9e0689cd8287448f7ae6d1272b ERR9452521.sra ERR9452521.sra file validated ERR9452521 is paired end ERR9452521 is conventional basespace ERR9452521 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452521_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8785 37.0 37.0 37.0 37.0 37.0 2 35.84575 37.0 37.0 37.0 37.0 37.0 3 36.1425 37.0 37.0 37.0 37.0 37.0 4 36.149 37.0 37.0 37.0 37.0 37.0 5 36.152 37.0 37.0 37.0 37.0 37.0 6 36.2575 37.0 37.0 37.0 37.0 37.0 7 36.1315 37.0 37.0 37.0 37.0 37.0 8 36.263 37.0 37.0 37.0 37.0 37.0 9 36.292 37.0 37.0 37.0 37.0 37.0 10-14 36.298 37.0 37.0 37.0 37.0 37.0 15-19 36.250899999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.2577 37.0 37.0 37.0 37.0 37.0 25-29 36.1459 37.0 37.0 37.0 37.0 37.0 30-34 36.066100000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.0714 37.0 37.0 37.0 37.0 37.0 40-44 35.955200000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.8914 37.0 37.0 37.0 37.0 37.0 50-54 35.918099999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.9596 37.0 37.0 37.0 37.0 37.0 60-64 36.034800000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.96660000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.961 37.0 37.0 37.0 37.0 37.0 75-79 35.873900000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.8776 37.0 37.0 37.0 37.0 37.0 85-89 35.8731 37.0 37.0 37.0 37.0 37.0 90-94 35.8213 37.0 37.0 37.0 37.0 37.0 95-99 35.8291 37.0 37.0 37.0 37.0 37.0 100-104 35.708 37.0 37.0 37.0 37.0 37.0 105-109 35.7344 37.0 37.0 37.0 37.0 37.0 110-114 35.6655 37.0 37.0 37.0 37.0 37.0 115-119 35.6685 37.0 37.0 37.0 37.0 37.0 120-124 35.6952 37.0 37.0 37.0 37.0 37.0 125-129 35.698800000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.5711 37.0 37.0 37.0 37.0 37.0 135-139 35.4248 37.0 37.0 37.0 34.6 37.0 140-144 35.4268 37.0 37.0 37.0 37.0 37.0 145-149 35.5554 37.0 37.0 37.0 37.0 37.0 150 35.501 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 2.0 21 0.0 22 1.0 23 3.0 24 2.0 25 9.0 26 10.0 27 15.0 28 23.0 29 46.0 30 45.0 31 71.0 32 91.0 33 132.0 34 188.0 35 349.0 36 2684.0 37 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.6 13.350000000000001 15.174999999999999 38.875 2 23.942957217913435 22.466850137603203 31.74881160870653 21.841381035776834 3 26.75 26.05 19.625 27.575 4 29.549999999999997 29.525000000000002 18.15 22.775000000000002 5 26.424999999999997 30.0 20.375 23.200000000000003 6 20.349999999999998 33.25 23.125 23.275000000000002 7 19.975 14.05 38.675 27.3 8 22.125 18.525 26.450000000000003 32.9 9 22.175 19.825 28.749999999999996 29.25 10-14 25.14 24.675 23.244999999999997 26.939999999999998 15-19 25.71 23.53 24.13 26.63 20-24 25.674999999999997 24.335 23.5 26.490000000000002 25-29 25.474999999999998 23.89 23.525 27.11 30-34 25.535000000000004 23.77 23.724999999999998 26.97 35-39 25.515 23.935000000000002 23.655 26.895000000000003 40-44 26.11 23.705000000000002 23.77 26.415 45-49 25.66 23.935000000000002 23.415 26.99 50-54 25.345000000000002 24.585 23.57 26.5 55-59 25.915 24.135 23.244999999999997 26.705000000000002 60-64 25.82 24.64 22.939999999999998 26.6 65-69 26.58 23.22 23.595 26.605 70-74 26.255 23.25 23.935000000000002 26.56 75-79 26.35 23.7 23.26 26.69 80-84 26.25 23.84 23.27 26.640000000000004 85-89 26.455000000000002 23.445 23.035 27.065 90-94 26.295 23.885 23.86 25.96 95-99 27.165 23.35 23.485 26.0 100-104 26.474999999999998 23.830000000000002 23.585 26.11 105-109 26.515 23.674999999999997 23.810000000000002 26.0 110-114 26.845000000000002 23.36 23.005 26.790000000000003 115-119 26.529999999999998 23.405 23.580000000000002 26.484999999999996 120-124 26.810000000000002 23.485 23.235 26.47 125-129 26.32 23.76 23.0 26.919999999999998 130-134 26.179999999999996 23.52 23.849999999999998 26.450000000000003 135-139 26.215 23.535 23.44 26.810000000000002 140-144 26.815 24.125 22.884999999999998 26.174999999999997 145-149 26.22 23.755000000000003 23.275000000000002 26.75 150 26.1 23.674999999999997 22.875 27.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 3.0 29 6.5 30 10.5 31 13.0 32 16.5 33 19.0 34 19.5 35 35.0 36 48.5 37 52.5 38 66.5 39 82.5 40 100.0 41 119.0 42 135.0 43 153.0 44 150.5 45 153.5 46 168.0 47 156.0 48 155.0 49 141.0 50 118.5 51 114.0 52 116.5 53 118.0 54 95.5 55 91.0 56 94.5 57 89.5 58 86.5 59 81.5 60 85.0 61 84.0 62 77.5 63 73.0 64 71.5 65 73.0 66 78.0 67 83.0 68 79.0 69 75.0 70 67.5 71 56.0 72 46.0 73 43.0 74 47.5 75 33.0 76 21.0 77 24.5 78 22.0 79 13.5 80 7.5 81 6.5 82 4.0 83 4.0 84 4.5 85 2.5 86 1.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.8108108108108 85.85000000000001 2 6.432432432432432 11.899999999999999 3 0.6756756756756757 1.875 4 0.0 0.0 5 0.08108108108108107 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACC 5 0.125 No Hit GGACAAGACTCTAGGAGCCTTCTCATTCTTAGGGAACACTTCACATTCTG 5 0.125 No Hit CTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0375 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.05 0.0 0.0 0.0 0.0 122-123 1.1125 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.8624999999999998 0.0 0.0 0.0 0.0 138 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGGGT 10 0.006973645 144.0 1 AGGATCA 10 0.006973645 144.0 3 AGAGGGA 10 0.006973645 144.0 8 >>END_MODULE ERR9452521 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452521_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.932 37.0 37.0 37.0 37.0 37.0 2 35.8685 37.0 37.0 37.0 37.0 37.0 3 36.073 37.0 37.0 37.0 37.0 37.0 4 36.079 37.0 37.0 37.0 37.0 37.0 5 36.015 37.0 37.0 37.0 37.0 37.0 6 36.081 37.0 37.0 37.0 37.0 37.0 7 35.959 37.0 37.0 37.0 37.0 37.0 8 36.055 37.0 37.0 37.0 37.0 37.0 9 36.1405 37.0 37.0 37.0 37.0 37.0 10-14 36.1691 37.0 37.0 37.0 37.0 37.0 15-19 36.05720000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.0536 37.0 37.0 37.0 37.0 37.0 25-29 36.0939 37.0 37.0 37.0 37.0 37.0 30-34 36.0495 37.0 37.0 37.0 37.0 37.0 35-39 36.061099999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9953 37.0 37.0 37.0 37.0 37.0 45-49 35.9672 37.0 37.0 37.0 37.0 37.0 50-54 35.9726 37.0 37.0 37.0 37.0 37.0 55-59 35.90410000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.8435 37.0 37.0 37.0 37.0 37.0 65-69 35.8155 37.0 37.0 37.0 37.0 37.0 70-74 35.8468 37.0 37.0 37.0 37.0 37.0 75-79 35.763600000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.774899999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.7362 37.0 37.0 37.0 37.0 37.0 90-94 35.724799999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.6605 37.0 37.0 37.0 37.0 37.0 100-104 35.718599999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.7648 37.0 37.0 37.0 37.0 37.0 110-114 35.61469999999999 37.0 37.0 37.0 34.6 37.0 115-119 35.5918 37.0 37.0 37.0 37.0 37.0 120-124 35.4936 37.0 37.0 37.0 37.0 37.0 125-129 35.4481 37.0 37.0 37.0 34.6 37.0 130-134 35.45569999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.4911 37.0 37.0 37.0 37.0 37.0 140-144 35.343999999999994 37.0 37.0 37.0 32.2 37.0 145-149 35.1231 37.0 37.0 37.0 27.4 37.0 150 35.4095 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 4.0 24 8.0 25 7.0 26 17.0 27 18.0 28 26.0 29 31.0 30 55.0 31 56.0 32 79.0 33 122.0 34 198.0 35 556.0 36 2601.0 37 219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.424999999999997 12.85 16.175 39.550000000000004 2 24.099999999999998 21.575 32.375 21.95 3 25.95 27.275 19.925 26.85 4 30.4 30.15 17.424999999999997 22.025 5 29.075 29.375 20.05 21.5 6 20.875 31.724999999999998 21.525 25.874999999999996 7 20.525 14.625 37.675 27.175 8 21.425 18.75 27.05 32.775 9 24.025 18.625 28.725 28.625 10-14 25.15 24.72 23.59 26.540000000000003 15-19 25.205 23.455000000000002 24.595 26.745 20-24 25.735000000000003 24.0 23.599999999999998 26.665 25-29 25.874999999999996 23.935000000000002 23.974999999999998 26.215 30-34 26.125 24.11 23.435 26.33 35-39 26.240000000000002 24.23 22.85 26.68 40-44 26.325 24.33 23.11 26.235000000000003 45-49 26.165 23.794999999999998 23.44 26.6 50-54 25.45 23.985 23.835 26.729999999999997 55-59 26.135 24.03 22.975 26.86 60-64 26.13 23.785 23.74 26.345000000000002 65-69 26.375 23.685000000000002 23.23 26.71 70-74 26.545 22.95 23.515 26.99 75-79 26.63 23.825 22.695 26.85 80-84 26.825 23.445 23.24 26.490000000000002 85-89 26.729999999999997 23.505000000000003 22.735 27.029999999999998 90-94 26.590000000000003 23.419999999999998 23.445 26.545 95-99 26.779999999999998 23.535 23.39 26.295 100-104 26.790000000000003 23.505000000000003 23.78 25.924999999999997 105-109 26.255 23.885 23.54 26.32 110-114 26.445 24.345 23.165 26.045 115-119 26.805 23.494999999999997 23.3 26.400000000000002 120-124 27.189999999999998 22.994999999999997 23.57 26.245 125-129 27.43 24.075 22.55 25.945 130-134 26.150000000000002 24.18 23.080000000000002 26.590000000000003 135-139 26.525 23.880000000000003 23.71 25.885 140-144 26.924999999999997 23.87 23.615 25.590000000000003 145-149 27.639999999999997 23.22 23.1 26.040000000000003 150 28.299999999999997 23.95 22.825 24.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 1.5 27 3.0 28 4.0 29 5.0 30 6.5 31 9.0 32 12.0 33 15.0 34 23.0 35 28.5 36 43.0 37 64.5 38 70.5 39 81.5 40 106.0 41 110.0 42 120.0 43 150.5 44 164.0 45 159.0 46 153.0 47 150.5 48 134.0 49 130.0 50 136.5 51 120.5 52 110.5 53 121.0 54 110.5 55 104.5 56 99.0 57 84.0 58 85.0 59 81.0 60 86.5 61 87.0 62 82.5 63 74.5 64 71.0 65 89.0 66 76.0 67 77.0 68 80.0 69 57.5 70 56.0 71 59.5 72 62.5 73 44.5 74 34.5 75 39.5 76 34.5 77 24.5 78 15.0 79 12.5 80 10.5 81 9.0 82 6.0 83 3.0 84 2.5 85 1.5 86 1.0 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.99380220964699 86.275 2 6.305578011317705 11.700000000000001 3 0.6467259498787389 1.7999999999999998 4 0.026946914578280787 0.1 5 0.026946914578280787 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGCAGTTCTTGATACCATCAATCACCGGTATATAGAAAAATAGTGGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.025 62-63 0.05 0.0 0.0 0.0 0.025 64-65 0.05 0.0 0.0 0.0 0.025 66-67 0.05 0.0 0.0 0.0 0.025 68-69 0.05 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.075 0.0 0.0 0.0 0.025 76-77 0.075 0.0 0.0 0.0 0.025 78-79 0.075 0.0 0.0 0.0 0.025 80-81 0.0875 0.0 0.0 0.0 0.025 82-83 0.125 0.0 0.0 0.0 0.025 84-85 0.125 0.0 0.0 0.0 0.025 86-87 0.15 0.0 0.0 0.0 0.025 88-89 0.15 0.0 0.0 0.0 0.025 90-91 0.175 0.0 0.0 0.0 0.025 92-93 0.21250000000000002 0.0 0.0 0.0 0.025 94-95 0.2375 0.0 0.0 0.0 0.025 96-97 0.2875 0.0 0.0 0.0 0.025 98-99 0.3 0.0 0.0 0.0 0.025 100-101 0.35 0.0 0.0 0.0 0.025 102-103 0.4 0.0 0.0 0.0 0.025 104-105 0.4375 0.0 0.0 0.0 0.025 106-107 0.5125 0.0 0.0 0.0 0.025 108-109 0.5874999999999999 0.0 0.0 0.0 0.025 110-111 0.75 0.0 0.0 0.0 0.025 112-113 0.8625 0.0 0.0 0.0 0.025 114-115 0.8875 0.0 0.0 0.0 0.025 116-117 0.925 0.0 0.0 0.0 0.025 118-119 0.95 0.0 0.0 0.0 0.025 120-121 1.025 0.0 0.0 0.0 0.025 122-123 1.0875 0.0 0.0 0.0 0.025 124-125 1.1 0.0 0.0 0.0 0.025 126-127 1.2000000000000002 0.0 0.0 0.0 0.025 128-129 1.275 0.0 0.0 0.0 0.025 130-131 1.3875 0.0 0.0 0.0 0.025 132-133 1.4625 0.0 0.0 0.0 0.025 134-135 1.6 0.0 0.0 0.0 0.025 136-137 1.8375 0.0 0.0 0.0 0.025 138 2.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTCAT 10 0.006973645 144.0 5 GTAGCCG 10 0.006973645 144.0 8 AAAAAAA 20 0.006139246 28.8 65-69 >>END_MODULE Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250014 spots for ERR9452521.sra Written 1250014 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra Read 1250006 spots for ERR9452521.sra Written 1250006 spots for ERR9452521.sra SRR ids: ['ERR9452521.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i71wljsw ERR9452521.sra spots: 25000128 blocks: [[1, 1250006], [1250007, 2500012], [2500013, 3750018], [3750019, 5000024], [5000025, 6250030], [6250031, 7500036], [7500037, 8750042], [8750043, 10000048], [10000049, 11250054], [11250055, 12500060], [12500061, 13750066], [13750067, 15000072], [15000073, 16250078], [16250079, 17500084], [17500085, 18750090], [18750091, 20000096], [20000097, 21250102], [21250103, 22500108], [22500109, 23750114], [23750115, 25000128]] ERR9452521 file size 8401194 ERR9452521 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR9452521 ERR9452521_1.fastq ERR9452521_2.fastq Input file: ERR9452521_1.fastq Paired file: ERR9452521_2.fastq trimmed: ERR9452521-trimmed-pair1.fastq, ERR9452521-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:41:12 2024 >> started Fri Dec 6 23:41:39 2024 >> done (26.191s) 25000128 read pairs processed; of these: 60 ( 0.00%) short read pairs filtered out after trimming by size control 657 ( 0.00%) empty read pairs filtered out after trimming by size control 24999411 (100.00%) read pairs available; of these: 912441 ( 3.65%) trimmed read pairs available after processing 24086970 (96.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 47 0.00% 20 5996 0.02% 21 46 0.00% 22 5 0.00% 23 1 0.00% 24 7 0.00% 25 12 0.00% 26 5 0.00% 27 9 0.00% 28 19 0.00% 29 44 0.00% 30 118 0.00% 31 54 0.00% 32 19 0.00% 33 8 0.00% 34 5 0.00% 35 15 0.00% 36 8 0.00% 37 13 0.00% 38 20 0.00% 39 20 0.00% 40 18 0.00% 41 17 0.00% 42 40 0.00% 43 50 0.00% 44 40 0.00% 45 59 0.00% 46 56 0.00% 47 69 0.00% 48 86 0.00% 49 105 0.00% 50 115 0.00% 51 187 0.00% 52 172 0.00% 53 184 0.00% 54 182 0.00% 55 243 0.00% 56 241 0.00% 57 328 0.00% 58 361 0.00% 59 439 0.00% 60 522 0.00% 61 598 0.00% 62 609 0.00% 63 604 0.00% 64 636 0.00% 65 788 0.00% 66 653 0.00% 67 897 0.00% 68 859 0.00% 69 929 0.00% 70 1066 0.00% 71 1093 0.00% 72 1172 0.00% 73 1347 0.01% 74 1343 0.01% 75 1448 0.01% 76 1451 0.01% 77 1567 0.01% 78 1515 0.01% 79 1742 0.01% 80 1866 0.01% 81 1882 0.01% 82 1985 0.01% 83 2149 0.01% 84 2290 0.01% 85 2432 0.01% 86 2559 0.01% 87 2656 0.01% 88 2920 0.01% 89 2909 0.01% 90 2937 0.01% 91 3110 0.01% 92 3402 0.01% 93 3555 0.01% 94 3864 0.02% 95 3977 0.02% 96 4087 0.02% 97 4325 0.02% 98 4512 0.02% 99 4667 0.02% 100 4872 0.02% 101 4979 0.02% 102 5165 0.02% 103 5660 0.02% 104 5882 0.02% 105 6263 0.03% 106 6501 0.03% 107 6893 0.03% 108 7036 0.03% 109 7295 0.03% 110 7465 0.03% 111 7927 0.03% 112 8203 0.03% 113 8665 0.03% 114 9271 0.04% 115 9984 0.04% 116 10018 0.04% 117 10263 0.04% 118 10671 0.04% 119 10972 0.04% 120 11489 0.05% 121 12107 0.05% 122 12586 0.05% 123 13278 0.05% 124 13678 0.05% 125 14382 0.06% 126 15109 0.06% 127 15517 0.06% 128 16614 0.07% 129 16915 0.07% 130 17036 0.07% 131 18123 0.07% 132 19560 0.08% 133 19775 0.08% 134 20756 0.08% 135 21453 0.09% 136 21963 0.09% 137 22774 0.09% 138 23872 0.10% 139 25506 0.10% 140 26339 0.11% 141 27078 0.11% 142 28435 0.11% 143 29409 0.12% 144 30335 0.12% 145 31880 0.13% 146 32578 0.13% 147 35083 0.14% 148 35555 0.14% 149 36882 0.15% 150 24086970 96.35% 24999411 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=31 prefix-density=0.27 prefix-fanout=2.1 sequence=CTCCGATCCCGAAGGCCAACACAATAGGACCGGAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGATGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACGACCCGGCCAATTAAGGCTAGGAGCGCATCGCCGGCTGAAGGGTCGAGTAGGTCGGTGCTCGCCGTGAGGCGGACCGGCCGACCCGGCCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=120.82 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=9.9 sequence=GAGGAGAAGAAACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCCGTGCCGTCCGAATTGTAGTCTGGAGAGGCGTCCTCAGCGACGGACCGGGCCCAAGTCCCCTGGAAAGGGGCGCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAAT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=31 prefix-density=0.29 prefix-fanout=2.1 sequence=CTCCGATCCCGAAGGCCAACACAATAGGACCGGAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGATGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACGACCCGGCCAATTAAGGCTAGGAGCGCATCGCCGGCTGAAGGGTCGAGTAGGTCGGTGCTCGCCGTGAGGCGGACCGGCCGACCCGGCCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCT criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=122.72 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=14.4 sequence=GCCGCCGCCGCCA ERR9452521 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:42:44 Started mapping on | Dec 06 23:42:44 Finished on | Dec 06 23:45:51 Mapping speed, Million of reads per hour | 481.27 Number of input reads | 24999411 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 23327641 Uniquely mapped reads % | 93.31% Average mapped length | 297.13 Number of splices: Total | 24113850 Number of splices: Annotated (sjdb) | 22862163 Number of splices: GT/AG | 23762733 Number of splices: GC/AG | 290112 Number of splices: AT/AC | 12565 Number of splices: Non-canonical | 48440 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431274 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 77567 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 2.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1240496 1240496 1240496 N_multimapping 431274 431274 431274 N_noFeature 967862 11914162 11977329 N_ambiguous 513991 56952 57204 UnstrandedReadsAssigned:21845788 PositiveStrandReadsAssigned:11356527 NegativeStrandReadsAssigned:11293108 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 ERR9452521 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR9452521-trimmed-pair1.fastq ERR9452521-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,999,411 reads, 22,675,613 reads pseudoaligned [quant] estimated average fragment length: 230.981 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52973 ERR9452521.ke.tsv 35125 ERR9452521.se.tsv 88098 total ==> ERR9452521.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 706.263 0 0 PNS24247 1044 814.019 59.5587 4.40274 PNS24249 1928 1698.02 203.085 7.19694 PNS24246 1044 814.019 59.5587 4.40274 PNS24248 1044 814.019 59.5587 4.40274 PNS24244 1471 1241.02 38.2388 1.85412 PNS24243 293 73.467 23 18.8386 KQK14069 1603 1373.02 17459.5 765.188 KQK14071 474 245.92 5558.93 1360.22 ==> ERR9452521.se.tsv <== BRADI_1g14170v3 25197 BRADI_1g53295v3 675 BRADI_1g59795v3 145 BRADI_1g07683v3 0 BRADI_1g00485v3 75 BRADI_1g20270v3 1162 BRADI_1g74790v3 260 BRADI_1g09890v3 3 BRADI_1g77505v3 451 BRADI_1g48960v3 0 ERR9452521 completed mapping pipeline successfully