Starting /dee2/code/volunteer_pipeline.sh ERR9452525 current disk space = 1547754872832 free memory = 1598626428 ERR9452525 SRAfilesize e904809d0fc2472f3b61b2c91b34bb35 ERR9452525.sra ERR9452525.sra file validated ERR9452525 is paired end ERR9452525 is conventional basespace ERR9452525 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452525_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.904 37.0 37.0 37.0 37.0 37.0 2 35.658 37.0 37.0 37.0 37.0 37.0 3 36.0255 37.0 37.0 37.0 37.0 37.0 4 36.1575 37.0 37.0 37.0 37.0 37.0 5 36.262 37.0 37.0 37.0 37.0 37.0 6 36.191 37.0 37.0 37.0 37.0 37.0 7 36.16 37.0 37.0 37.0 37.0 37.0 8 36.1 37.0 37.0 37.0 37.0 37.0 9 36.17025 37.0 37.0 37.0 37.0 37.0 10-14 36.2158 37.0 37.0 37.0 37.0 37.0 15-19 36.2041 37.0 37.0 37.0 37.0 37.0 20-24 36.1269 37.0 37.0 37.0 37.0 37.0 25-29 36.0785 37.0 37.0 37.0 37.0 37.0 30-34 36.024699999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9621 37.0 37.0 37.0 37.0 37.0 40-44 35.962 37.0 37.0 37.0 37.0 37.0 45-49 35.839999999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9279 37.0 37.0 37.0 37.0 37.0 55-59 35.8705 37.0 37.0 37.0 37.0 37.0 60-64 35.8129 37.0 37.0 37.0 37.0 37.0 65-69 35.8187 37.0 37.0 37.0 37.0 37.0 70-74 35.798 37.0 37.0 37.0 37.0 37.0 75-79 35.896100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.76369999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.718900000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.720299999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.6128 37.0 37.0 37.0 37.0 37.0 100-104 35.614000000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.480199999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.598400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.4268 37.0 37.0 37.0 37.0 37.0 120-124 35.408 37.0 37.0 37.0 34.6 37.0 125-129 35.4848 37.0 37.0 37.0 37.0 37.0 130-134 35.3333 37.0 37.0 37.0 32.2 37.0 135-139 35.163599999999995 37.0 37.0 37.0 29.8 37.0 140-144 35.161300000000004 37.0 37.0 37.0 27.4 37.0 145-149 35.3592 37.0 37.0 37.0 37.0 37.0 150 35.1125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 3.0 24 2.0 25 12.0 26 14.0 27 20.0 28 30.0 29 43.0 30 56.0 31 72.0 32 110.0 33 145.0 34 183.0 35 439.0 36 2631.0 37 237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.214607303651825 12.38119059529765 14.432216108054027 43.9719859929965 2 27.474999999999998 20.825 30.725 20.974999999999998 3 26.575 24.775 20.525 28.125 4 28.875 28.875 17.5 24.75 5 28.325 29.4 19.425 22.85 6 21.775 30.525000000000002 20.549999999999997 27.150000000000002 7 21.55 13.425 37.3 27.725 8 23.425 17.9 23.425 35.25 9 22.9057264316079 18.3295823955989 27.38184546136534 31.38284571142786 10-14 25.6 23.365 22.97 28.065 15-19 26.32 21.84 23.16 28.68 20-24 27.29 22.58 22.055 28.075 25-29 25.985000000000003 23.1 22.52 28.395 30-34 26.284999999999997 22.830000000000002 22.73 28.155 35-39 26.619999999999997 22.91 22.564999999999998 27.905 40-44 26.86 22.61 21.895 28.634999999999998 45-49 27.150000000000002 22.37 22.355 28.125 50-54 26.919999999999998 22.625 22.23 28.225 55-59 27.41 22.41 21.990000000000002 28.189999999999998 60-64 27.13 22.125 22.67 28.075 65-69 26.790000000000003 22.525000000000002 22.15 28.535 70-74 27.415 22.12 22.11 28.355000000000004 75-79 27.689999999999998 22.314999999999998 22.095000000000002 27.900000000000002 80-84 27.334999999999997 22.145 21.95 28.57 85-89 27.29 21.97 22.28 28.46 90-94 27.889999999999997 22.220000000000002 22.15 27.74 95-99 27.065 22.55 21.645 28.74 100-104 27.665 21.935 22.115000000000002 28.285 105-109 27.735 21.945 21.955 28.365000000000002 110-114 27.744999999999997 22.465 21.68 28.110000000000003 115-119 28.110000000000003 22.065 22.085 27.74 120-124 28.21 21.95 22.015 27.825 125-129 28.525 21.735 22.285 27.455000000000002 130-134 28.310000000000002 21.92 21.634999999999998 28.134999999999998 135-139 28.060000000000002 22.07 22.015 27.855 140-144 28.494999999999997 22.46 21.740000000000002 27.305 145-149 27.605 22.705000000000002 22.29 27.400000000000002 150 28.375 22.400000000000002 21.349999999999998 27.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 1.5 28 2.0 29 3.5 30 8.0 31 12.0 32 13.0 33 15.0 34 17.5 35 25.0 36 30.5 37 40.0 38 51.0 39 60.0 40 73.0 41 89.0 42 102.0 43 116.0 44 132.0 45 137.0 46 126.0 47 120.5 48 131.5 49 128.5 50 118.0 51 116.5 52 118.0 53 122.0 54 106.0 55 84.0 56 84.0 57 94.5 58 89.5 59 77.0 60 92.5 61 101.5 62 92.0 63 86.5 64 87.5 65 95.0 66 104.0 67 96.0 68 86.5 69 87.0 70 84.5 71 84.5 72 72.0 73 66.5 74 66.5 75 53.5 76 44.0 77 40.5 78 32.5 79 20.5 80 16.5 81 15.5 82 12.0 83 6.0 84 2.0 85 1.5 86 2.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.97278911564626 84.5 2 7.29251700680272 13.4 3 0.653061224489796 1.7999999999999998 4 0.0816326530612245 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.025 0.0 0.0 0.0 0.025 78-79 0.037500000000000006 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 90-91 0.05 0.0 0.0 0.0 0.025 92-93 0.05 0.0 0.0 0.0 0.025 94-95 0.075 0.0 0.0 0.0 0.025 96-97 0.075 0.0 0.0 0.0 0.025 98-99 0.075 0.0 0.0 0.0 0.025 100-101 0.0875 0.0 0.0 0.0 0.025 102-103 0.1 0.0 0.0 0.0 0.025 104-105 0.125 0.0 0.0 0.0 0.025 106-107 0.15 0.0 0.0 0.0 0.025 108-109 0.15 0.0 0.0 0.0 0.025 110-111 0.16249999999999998 0.0 0.0 0.0 0.025 112-113 0.175 0.0 0.0 0.0 0.025 114-115 0.175 0.0 0.0 0.0 0.025 116-117 0.175 0.0 0.0 0.0 0.025 118-119 0.25 0.0 0.0 0.0 0.025 120-121 0.325 0.0 0.0 0.0 0.025 122-123 0.375 0.0 0.0 0.0 0.025 124-125 0.4 0.0 0.0 0.0 0.025 126-127 0.4375 0.0 0.0 0.0 0.025 128-129 0.4625 0.0 0.0 0.0 0.025 130-131 0.5 0.0 0.0 0.0 0.025 132-133 0.5625 0.0 0.0 0.0 0.025 134-135 0.6625000000000001 0.0 0.0 0.0 0.025 136-137 0.7625 0.0 0.0 0.0 0.025 138 0.85 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACCTC 10 0.006973645 144.0 8 >>END_MODULE ERR9452525 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR9452525_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.824 37.0 37.0 37.0 37.0 37.0 2 35.8305 37.0 37.0 37.0 37.0 37.0 3 35.97 37.0 37.0 37.0 37.0 37.0 4 35.9235 37.0 37.0 37.0 37.0 37.0 5 36.045 37.0 37.0 37.0 37.0 37.0 6 35.683 37.0 37.0 37.0 37.0 37.0 7 36.086 37.0 37.0 37.0 37.0 37.0 8 35.7515 37.0 37.0 37.0 37.0 37.0 9 36.045 37.0 37.0 37.0 37.0 37.0 10-14 35.9563 37.0 37.0 37.0 37.0 37.0 15-19 35.835699999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.9265 37.0 37.0 37.0 37.0 37.0 25-29 35.8416 37.0 37.0 37.0 37.0 37.0 30-34 35.828500000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.731399999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.860499999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.797399999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.799600000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.666700000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.7107 37.0 37.0 37.0 37.0 37.0 65-69 35.730599999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.623400000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.6777 37.0 37.0 37.0 37.0 37.0 80-84 35.649 37.0 37.0 37.0 37.0 37.0 85-89 35.5869 37.0 37.0 37.0 37.0 37.0 90-94 35.588499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.466 37.0 37.0 37.0 37.0 37.0 100-104 35.547900000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.5418 37.0 37.0 37.0 37.0 37.0 110-114 35.1657 37.0 37.0 37.0 29.8 37.0 115-119 35.356100000000005 37.0 37.0 37.0 34.6 37.0 120-124 35.198600000000006 37.0 37.0 37.0 29.8 37.0 125-129 35.3239 37.0 37.0 37.0 34.6 37.0 130-134 35.3232 37.0 37.0 37.0 37.0 37.0 135-139 35.2173 37.0 37.0 37.0 29.8 37.0 140-144 35.0758 37.0 37.0 37.0 25.0 37.0 145-149 34.8756 37.0 37.0 37.0 25.0 37.0 150 35.1215 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 0.0 21 1.0 22 1.0 23 10.0 24 9.0 25 15.0 26 15.0 27 27.0 28 41.0 29 47.0 30 42.0 31 69.0 32 96.0 33 112.0 34 232.0 35 636.0 36 2484.0 37 161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.22822822822823 14.089089089089088 14.664664664664665 43.01801801801802 2 26.724999999999998 21.625 29.175 22.475 3 24.975 25.374999999999996 18.025 31.624999999999996 4 31.175000000000004 28.9 14.975 24.95 5 28.625 31.05 18.05 22.275 6 22.975 29.575000000000003 20.849999999999998 26.6 7 20.25 13.275 37.574999999999996 28.9 8 22.1 18.4 25.224999999999998 34.275 9 24.375 17.8 26.400000000000002 31.424999999999997 10-14 26.085 23.51 21.85 28.555000000000003 15-19 26.41 22.28 23.235 28.075 20-24 26.525 22.765 22.415 28.294999999999998 25-29 26.740000000000002 22.24 22.84 28.18 30-34 26.915 22.24 22.295 28.549999999999997 35-39 26.900000000000002 22.99 22.14 27.97 40-44 26.565 22.865 22.264999999999997 28.305000000000003 45-49 26.889999999999997 22.425 22.1 28.585 50-54 27.310000000000002 21.86 22.31 28.52 55-59 27.38 22.21 22.395 28.015 60-64 26.745 22.54 21.88 28.835 65-69 27.384999999999998 21.825 22.33 28.46 70-74 27.24 21.78 22.59 28.389999999999997 75-79 27.939999999999998 22.085 22.075 27.900000000000002 80-84 27.455000000000002 22.64 21.435000000000002 28.470000000000002 85-89 27.36 22.040000000000003 21.795 28.804999999999996 90-94 27.644999999999996 21.705 22.415 28.235 95-99 27.200000000000003 21.705 22.7 28.395 100-104 26.88 22.255 22.145 28.720000000000002 105-109 28.07 22.12 21.555 28.255000000000003 110-114 27.084999999999997 22.439999999999998 22.18 28.294999999999998 115-119 27.765 21.595 21.975 28.665000000000003 120-124 27.694999999999997 21.68 22.27 28.355000000000004 125-129 28.294999999999998 21.765 21.865000000000002 28.075 130-134 27.794999999999998 21.91 22.11 28.185 135-139 28.15 21.959999999999997 22.38 27.51 140-144 28.194999999999997 21.740000000000002 22.065 28.000000000000004 145-149 28.88 22.285 21.404999999999998 27.43 150 29.099999999999998 21.925 22.1 26.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 1.5 28 3.5 29 3.5 30 3.5 31 5.5 32 8.0 33 13.5 34 17.5 35 22.5 36 27.5 37 37.5 38 47.5 39 65.5 40 85.0 41 93.0 42 112.0 43 119.0 44 122.0 45 132.5 46 123.0 47 118.5 48 123.5 49 130.5 50 124.0 51 119.5 52 112.5 53 104.5 54 97.0 55 91.0 56 96.0 57 89.0 58 85.0 59 77.5 60 82.5 61 94.0 62 102.5 63 103.0 64 101.5 65 94.5 66 90.5 67 97.5 68 96.5 69 86.5 70 81.5 71 82.0 72 72.0 73 69.5 74 63.5 75 50.5 76 47.5 77 43.0 78 37.0 79 26.0 80 14.5 81 10.5 82 10.5 83 10.0 84 5.0 85 3.5 86 2.0 87 0.5 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5945945945946 85.65 2 6.756756756756757 12.5 3 0.5945945945945946 1.6500000000000001 4 0.05405405405405406 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0125 0.0 0.025 0.0 0.0 44-45 0.025 0.0 0.025 0.0 0.0 46-47 0.025 0.0 0.025 0.0 0.0 48-49 0.025 0.0 0.025 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.037500000000000006 0.0 0.025 0.0 0.0 80-81 0.05 0.0 0.025 0.0 0.0 82-83 0.05 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.075 0.0 0.025 0.0 0.0 96-97 0.0875 0.0 0.025 0.0 0.0 98-99 0.1 0.0 0.025 0.0 0.0 100-101 0.1 0.0 0.025 0.0 0.0 102-103 0.1 0.0 0.025 0.0 0.0 104-105 0.125 0.0 0.025 0.0 0.0 106-107 0.15 0.0 0.025 0.0 0.0 108-109 0.15 0.0 0.025 0.0 0.0 110-111 0.16249999999999998 0.0 0.025 0.0 0.0 112-113 0.175 0.0 0.025 0.0 0.0 114-115 0.175 0.0 0.025 0.0 0.0 116-117 0.1875 0.0 0.025 0.0 0.0 118-119 0.275 0.0 0.025 0.0 0.0 120-121 0.35 0.0 0.025 0.0 0.0 122-123 0.4 0.0 0.025 0.0 0.0 124-125 0.42500000000000004 0.0 0.025 0.0 0.0 126-127 0.4625 0.0 0.025 0.0 0.0 128-129 0.5125 0.0 0.025 0.0 0.0 130-131 0.55 0.0 0.025 0.0 0.0 132-133 0.6125 0.0 0.025 0.0 0.0 134-135 0.7124999999999999 0.0 0.025 0.0 0.0 136-137 0.8125 0.0 0.025 0.0 0.0 138 0.925 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGCCT 10 0.006973645 144.0 8 CATCGCC 10 0.006973645 144.0 7 >>END_MODULE Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489474 spots for ERR9452525.sra Written 1489474 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra Read 1489456 spots for ERR9452525.sra Written 1489456 spots for ERR9452525.sra SRR ids: ['ERR9452525.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xuopt17s ERR9452525.sra spots: 29789138 blocks: [[1, 1489456], [1489457, 2978912], [2978913, 4468368], [4468369, 5957824], [5957825, 7447280], [7447281, 8936736], [8936737, 10426192], [10426193, 11915648], [11915649, 13405104], [13405105, 14894560], [14894561, 16384016], [16384017, 17873472], [17873473, 19362928], [19362929, 20852384], [20852385, 22341840], [22341841, 23831296], [23831297, 25320752], [25320753, 26810208], [26810209, 28299664], [28299665, 29789138]] ERR9452525 file size 10014679 ERR9452525 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR9452525 ERR9452525_1.fastq ERR9452525_2.fastq Input file: ERR9452525_1.fastq Paired file: ERR9452525_2.fastq trimmed: ERR9452525-trimmed-pair1.fastq, ERR9452525-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:10:59 2024 >> started Sat Dec 7 00:11:31 2024 >> done (32.241s) 29789138 read pairs processed; of these: 192 ( 0.00%) short read pairs filtered out after trimming by size control 679 ( 0.00%) empty read pairs filtered out after trimming by size control 29788267 (100.00%) read pairs available; of these: 531000 ( 1.78%) trimmed read pairs available after processing 29257267 (98.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 189 0.00% 21 16 0.00% 22 8 0.00% 23 9 0.00% 24 5 0.00% 25 10 0.00% 26 10 0.00% 27 20 0.00% 28 22 0.00% 29 27 0.00% 30 106 0.00% 31 22 0.00% 32 25 0.00% 33 28 0.00% 34 24 0.00% 35 21 0.00% 36 26 0.00% 37 26 0.00% 38 23 0.00% 39 20 0.00% 40 29 0.00% 41 35 0.00% 42 34 0.00% 43 39 0.00% 44 49 0.00% 45 55 0.00% 46 54 0.00% 47 73 0.00% 48 68 0.00% 49 92 0.00% 50 102 0.00% 51 97 0.00% 52 97 0.00% 53 113 0.00% 54 124 0.00% 55 147 0.00% 56 164 0.00% 57 157 0.00% 58 211 0.00% 59 214 0.00% 60 243 0.00% 61 277 0.00% 62 272 0.00% 63 374 0.00% 64 323 0.00% 65 355 0.00% 66 400 0.00% 67 446 0.00% 68 485 0.00% 69 515 0.00% 70 537 0.00% 71 531 0.00% 72 619 0.00% 73 580 0.00% 74 693 0.00% 75 789 0.00% 76 803 0.00% 77 769 0.00% 78 831 0.00% 79 904 0.00% 80 1011 0.00% 81 1035 0.00% 82 1062 0.00% 83 1205 0.00% 84 1134 0.00% 85 1247 0.00% 86 1244 0.00% 87 1277 0.00% 88 1387 0.00% 89 1562 0.01% 90 1502 0.01% 91 1693 0.01% 92 1742 0.01% 93 1900 0.01% 94 1953 0.01% 95 1951 0.01% 96 2076 0.01% 97 2300 0.01% 98 2366 0.01% 99 2428 0.01% 100 2641 0.01% 101 2918 0.01% 102 2822 0.01% 103 3028 0.01% 104 3216 0.01% 105 3376 0.01% 106 3394 0.01% 107 3519 0.01% 108 3684 0.01% 109 3840 0.01% 110 4032 0.01% 111 4224 0.01% 112 4439 0.01% 113 4679 0.02% 114 5038 0.02% 115 5139 0.02% 116 5357 0.02% 117 5826 0.02% 118 5892 0.02% 119 5912 0.02% 120 6523 0.02% 121 6797 0.02% 122 7225 0.02% 123 7295 0.02% 124 7714 0.03% 125 8026 0.03% 126 8845 0.03% 127 8825 0.03% 128 9477 0.03% 129 9688 0.03% 130 10062 0.03% 131 10666 0.04% 132 11087 0.04% 133 11610 0.04% 134 12118 0.04% 135 12738 0.04% 136 13676 0.05% 137 14024 0.05% 138 14516 0.05% 139 15445 0.05% 140 15747 0.05% 141 16168 0.05% 142 17451 0.06% 143 18140 0.06% 144 19138 0.06% 145 20104 0.07% 146 21362 0.07% 147 22010 0.07% 148 22451 0.08% 149 23660 0.08% 150 29257267 98.22% 29788267 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=22 prefix-density=0.24 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=180.22 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=20.7 sequence=GCCGCCGCCGCC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.2 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=179.54 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=19.4 sequence=CCGCCGCCGCCG ERR9452525 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:12:26 Started mapping on | Dec 07 00:12:26 Finished on | Dec 07 00:16:17 Mapping speed, Million of reads per hour | 464.23 Number of input reads | 29788267 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 27691470 Uniquely mapped reads % | 92.96% Average mapped length | 297.73 Number of splices: Total | 26378654 Number of splices: Annotated (sjdb) | 24905516 Number of splices: GT/AG | 25983667 Number of splices: GC/AG | 320657 Number of splices: AT/AC | 11310 Number of splices: Non-canonical | 63020 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440369 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 86692 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 2.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1656428 1656428 1656428 N_multimapping 440369 440369 440369 N_noFeature 951760 14026886 14118817 N_ambiguous 651378 79374 79918 UnstrandedReadsAssigned:26088332 PositiveStrandReadsAssigned:13585210 NegativeStrandReadsAssigned:13492735 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 ERR9452525 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR9452525-trimmed-pair1.fastq ERR9452525-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,788,267 reads, 27,066,428 reads pseudoaligned [quant] estimated average fragment length: 246.89 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 ERR9452525.ke.tsv 35125 ERR9452525.se.tsv 88098 total ==> ERR9452525.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.325 0 0 PNS24247 1044 798.11 65.804 3.94126 PNS24249 1928 1682.11 374.203 10.634 PNS24246 1044 798.11 65.804 3.94126 PNS24248 1044 798.11 65.804 3.94126 PNS24244 1471 1225.11 76.3846 2.98041 PNS24243 293 63.2346 24 18.1427 KQK14069 1603 1357.11 13426.3 472.92 KQK14071 474 230.392 1663.2 345.081 ==> ERR9452525.se.tsv <== BRADI_1g14170v3 17737 BRADI_1g53295v3 687 BRADI_1g59795v3 106 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 1443 BRADI_1g74790v3 679 BRADI_1g09890v3 4 BRADI_1g77505v3 590 BRADI_1g48960v3 0 ERR9452525 completed mapping pipeline successfully