Starting /dee2/code/volunteer_pipeline.sh SRR1033810 current disk space = 1548086505472 free memory = 1597074168 SRR1033810 SRAfilesize b4c11a60972123280f479192a29de6ea SRR1033810.sra SRR1033810.sra file validated SRR1033810 is single end SRR1033810 is conventional basespace SRR1033810 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1033810_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 70.9335 71.0 71.0 71.0 71.0 71.0 2 70.85525 71.0 71.0 71.0 71.0 71.0 3 70.5445 71.0 71.0 71.0 71.0 71.0 4 70.9545 71.0 71.0 71.0 71.0 71.0 5 70.853 71.0 71.0 71.0 71.0 71.0 6 70.8475 71.0 71.0 71.0 71.0 71.0 7 70.7035 71.0 71.0 71.0 71.0 71.0 8 70.6505 71.0 71.0 71.0 71.0 71.0 9 70.87525 71.0 71.0 71.0 71.0 71.0 10 70.7805 71.0 71.0 71.0 71.0 71.0 11 70.94825 71.0 71.0 71.0 71.0 71.0 12 70.42875 71.0 71.0 71.0 71.0 71.0 13 70.46975 71.0 71.0 71.0 71.0 71.0 14 69.63525 71.0 71.0 71.0 71.0 71.0 15 70.50775 71.0 71.0 71.0 71.0 71.0 16 70.38575 71.0 71.0 71.0 71.0 71.0 17 70.41475 71.0 71.0 71.0 71.0 71.0 18 70.352 71.0 71.0 71.0 71.0 71.0 19 70.34825 71.0 71.0 71.0 71.0 71.0 20 70.48025 71.0 71.0 71.0 71.0 71.0 21 70.50325 71.0 71.0 71.0 71.0 71.0 22 70.58575 71.0 71.0 71.0 71.0 71.0 23 70.3215 71.0 71.0 71.0 71.0 71.0 24 69.99 71.0 71.0 71.0 71.0 71.0 25 70.355 71.0 71.0 71.0 71.0 71.0 26 69.36925 71.0 71.0 71.0 71.0 71.0 27 70.18875 71.0 71.0 71.0 71.0 71.0 28 69.14025 71.0 71.0 71.0 71.0 71.0 29 69.54425 71.0 71.0 71.0 71.0 71.0 30 70.1205 71.0 71.0 71.0 71.0 71.0 31 69.5795 71.0 71.0 71.0 71.0 71.0 32 70.409 71.0 71.0 71.0 71.0 71.0 33 70.31475 71.0 71.0 71.0 71.0 71.0 34 69.73525 71.0 71.0 71.0 71.0 71.0 35 68.518 71.0 71.0 71.0 61.0 71.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 53 2.0 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 3.0 60 1.0 61 4.0 62 5.0 63 8.0 64 16.0 65 34.0 66 40.0 67 107.0 68 213.0 69 437.0 70 1201.0 71 1927.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.5 87.2 0.1 0.2 2 34.875 22.6 19.55 22.975 3 31.15 22.55 32.824999999999996 13.475000000000001 4 27.3 21.7 36.05 14.95 5 24.075 23.075000000000003 20.3 32.550000000000004 6 18.125 22.3 42.525 17.05 7 22.1 34.275 22.15 21.475 8 19.8 20.65 29.225 30.325000000000003 9 19.475 40.225 22.85 17.45 10 42.55 18.2 21.55 17.7 11 23.75 19.625 38.6 18.025 12 23.075000000000003 20.974999999999998 22.025 33.925 13 24.31823867900926 23.592694520890667 19.914936202151615 32.17413059794846 14 33.17488116087065 29.44708531398549 18.363772829622217 19.014260695521642 15 24.64348261195897 37.378033525143856 20.31523642732049 17.663247435576682 16 25.469101826369776 24.74355766825119 18.739054290718038 31.048286214660997 17 40.075 21.675 22.7 15.55 18 27.495621716287218 33.52514385789342 22.892169126845133 16.08706529897423 19 27.47060295221416 16.91268451338504 39.35451588691519 16.262196647485613 20 23.54265699274456 19.06429822366775 29.67225419064298 27.72079059294471 21 27.0 15.975 38.25 18.775 22 27.375 15.5 23.400000000000002 33.725 23 37.95 21.4 23.400000000000002 17.25 24 18.9 18.475 43.7 18.925 25 9.25 18.475 56.425000000000004 15.85 26 18.75 6.7 25.275 49.275000000000006 27 62.375 4.75 21.325 11.55 28 11.75 11.725 51.075 25.45 29 10.7 42.95 18.8 27.55 30 29.65 2.375 53.675 14.299999999999999 31 50.61295971978984 0.8006004503377533 25.494120590442833 23.092319239429575 32 7.755816862646986 0.42531898924193146 16.61245934450838 75.2064048036027 33 13.710282712034024 0.3752814610958219 31.523642732049034 54.39079309482111 34 45.33400050037528 0.475356517388041 40.03002251688766 14.16062046534901 35 7.10532899674756 0.7755816862646986 60.39529647235427 31.723792844633476 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 1.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 5.0 31 10.0 32 10.0 33 22.5 34 35.0 35 35.0 36 51.5 37 68.0 38 68.0 39 127.5 40 187.0 41 245.5 42 304.0 43 304.0 44 376.5 45 449.0 46 449.0 47 569.5 48 690.0 49 690.0 50 901.0 51 1112.0 52 1112.0 53 909.0 54 706.0 55 706.0 56 482.5 57 259.0 58 259.0 59 185.0 60 111.0 61 77.0 62 43.0 63 43.0 64 29.5 65 16.0 66 16.0 67 11.0 68 6.0 69 6.0 70 3.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.075 14 0.075 15 0.075 16 0.075 17 0.0 18 0.075 19 0.075 20 0.075 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.075 32 0.075 33 0.075 34 0.075 35 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 74.8 #Duplication Level Percentage of deduplicated Percentage of total 1 95.02005347593582 71.075 2 2.7072192513368987 4.05 3 0.8021390374331552 1.7999999999999998 4 0.5681818181818182 1.7000000000000002 5 0.16711229946524064 0.625 6 0.1002673796791444 0.44999999999999996 7 0.0 0.0 8 0.267379679144385 1.6 9 0.03342245989304812 0.22499999999999998 >10 0.267379679144385 4.925 >50 0.03342245989304812 1.625 >100 0.03342245989304812 11.924999999999999 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source AGTTCTACAGTCCGACGATCTCGTATGCCGTCTTC 477 11.924999999999999 Illumina PCR Primer Index 1 (95% over 22bp) GCGTCTGTAGTCCAACGGTTCGTATGCCGTCTTCT 65 1.625 No Hit ACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTG 48 1.2 RNA PCR Primer, Index 47 (96% over 29bp) GGGGATGTAGCTCAGATGGTTCGTATGCCGTCTTC 33 0.8250000000000001 No Hit ACGACTCTCGGCAACGGATATCTTCGTATGCCGTC 32 0.8 No Hit ACCTGCTCTGATACCATGTTGTGATCGTATGCCGT 30 0.75 No Hit ACGACTCTCGGCAACGGATATCTCTCGTATGCCGT 19 0.475 No Hit AGTTCTACAGTCCGACGATCATCGTATGCCGTCTT 13 0.325 No Hit ACACGACTCTCGGCAACGGATATCTTCGTATGCCG 12 0.3 No Hit ACACGACTCTCGGCAACGGATATTCGTATGCCGTC 10 0.25 No Hit GCGTCTGTAGTCCAACGGTCGTATGCCGTCTTCTG 9 0.22499999999999998 No Hit ACGACTCTCGGCAACGGATATCGTATGCCGTCTTC 8 0.2 No Hit GCGTTTGTAGTCCAACGGTTCGTATGCCGTCTTCT 8 0.2 No Hit AAGGTCTGTCAGAAGGGTGATACTCGTATGCCGTC 8 0.2 No Hit ACGACTCTCGGCAACGGATATTCGTATGCCGTCTT 8 0.2 No Hit GTTCTACAGTCCGACGATCGTATGCCGTCTTCTGC 8 0.2 No Hit AAGTTCTACAGTCCGACGATCATCGTATGCCGTCT 8 0.2 Illumina DpnII expression Sequencing Primer (95% over 21bp) GGGGATGTAGCTCAGATCGTATGCCGTCTTCTGCT 8 0.2 Illumina Single End Adapter 1 (95% over 22bp) ATCTACAGTCCGACGATCATCGTATGCCGTCTTCT 8 0.2 No Hit ACAGTCCGACGATCATCGTATGCCGTCTTCTGCTT 6 0.15 Illumina Single End Adapter 1 (95% over 21bp) ATACTCGGAGGTAATGCCCTTTCGTATGCCGTCTT 6 0.15 No Hit GGGGATGTAGCTCAGATGGTATCGTATGCCGTCTT 6 0.15 No Hit ACACGACTCTCGGCAACGGATATCTCGTATGCCGT 5 0.125 No Hit ACGACTCTCGGCAACGGATATCTCGTATGCCGTCT 5 0.125 TruSeq Adapter, Index 25 (95% over 22bp) AGTTCTACAGTCTGACGATCTCGTATGCCGTCTTC 5 0.125 RNA PCR Primer, Index 47 (95% over 22bp) GTCTGTAGTCCAACGGTTCGTATGCCGTCTTCTGC 5 0.125 No Hit GCGTCTGTAGTCCAACGGTTTCGTATGCCGTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACGG 25 4.303467E-4 29.0 12 TAGTCCA 20 0.005388326 29.0 8 TGTAGTC 20 0.005388326 29.0 6 GTCCAAC 25 4.303467E-4 29.0 10 GCGTCTG 20 0.005388326 29.0 1 TCCAACG 25 4.303467E-4 29.0 11 AGTCCAA 25 4.303467E-4 29.0 9 GTAGTCC 20 0.005388326 29.0 7 CAACGGT 25 4.303467E-4 29.0 13 AACGGTT 30 0.0012503903 24.166668 14 CGGTTCG 30 0.0012503903 24.166668 16 GTCGTAT 45 1.9003104E-5 22.555557 24 GGTTCGT 35 0.0030680934 20.714287 17 ACGGTTC 35 0.0030680934 20.714287 15 ATCTCGT 60 7.233124E-6 19.333334 18 GATCTCG 60 7.233124E-6 19.333334 17 ACGATCT 55 8.954825E-5 18.454544 15 CGATCTC 55 8.954825E-5 18.454544 16 TCTCGTA 75 4.961129E-5 15.466665 19 AGTTCTA 70 5.675242E-4 14.5 1 >>END_MODULE Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338875 spots for SRR1033810.sra Written 338875 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra Read 338863 spots for SRR1033810.sra Written 338863 spots for SRR1033810.sra SRR ids: ['SRR1033810.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y8wcuef_ SRR1033810.sra spots: 6777272 blocks: [[1, 338863], [338864, 677726], [677727, 1016589], [1016590, 1355452], [1355453, 1694315], [1694316, 2033178], [2033179, 2372041], [2372042, 2710904], [2710905, 3049767], [3049768, 3388630], [3388631, 3727493], [3727494, 4066356], [4066357, 4405219], [4405220, 4744082], [4744083, 5082945], [5082946, 5421808], [5421809, 5760671], [5760672, 6099534], [6099535, 6438397], [6438398, 6777272]] SRR1033810 file size 937149 SRR1033810 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1033810 SRR1033810_1.fastq Input file: SRR1033810_1.fastq trimmed: SRR1033810-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:58:57 2024 >> started Sat Dec 7 00:59:00 2024 >> done (3.602s) 6777272 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 6777272 (100.00%) reads available; of these: 6777272 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 35 6777272 100.00% 6777272 reads passed initial QC criterion=sequence-density sequence-density=64.01 sequence-density-rank=1 fanout-score=17.28 fanout-score-rank=1 prefix-density=93.22 prefix-fanout=11.9 sequence=TCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=64.01 sequence-density-rank=1 fanout-score=17.28 fanout-score-rank=1 prefix-density=93.22 prefix-fanout=11.9 sequence=TCGTATGCCGTCTTCTGCTTGAAAAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGAAAAA -o SRR1033810 - Input file: STDIN trimmed: SRR1033810-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGAAAAA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 00:59:08 2024 >> started Sat Dec 7 00:59:15 2024 >> done (7.196s) 6568741 reads processed; of these: 982158 (14.95%) short reads filtered out after trimming by size control 17055 ( 0.26%) empty reads filtered out after trimming by size control 5569528 (84.79%) reads available; of these: 5186574 (93.12%) trimmed reads available after processing 382954 ( 6.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 579042 10.40% 19 628791 11.29% 20 473305 8.50% 21 1388364 24.93% 22 217662 3.91% 23 417654 7.50% 24 1334597 23.96% 25 87489 1.57% 26 32554 0.58% 27 10608 0.19% 28 3686 0.07% 29 1963 0.04% 30 958 0.02% 31 7206 0.13% 32 2695 0.05% 33 0 0.00% 34 0 0.00% 35 382954 6.88% criterion=sequence-density sequence-density=3.22 sequence-density-rank=1 fanout-score=1.25 fanout-score-rank=16 prefix-density=0.29 prefix-fanout=1.2 sequence=AGTTCTACAGTCCGACGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=28 fanout-score=143.31 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=20.9 sequence=TCGGATGCCGGCTTC Started job on | Dec 07 00:59:30 Started mapping on | Dec 07 00:59:30 Finished on | Dec 07 00:59:50 Mapping speed, Million of reads per hour | 1040.05 Number of input reads | 5778059 Average input read length | 22 UNIQUE READS: Uniquely mapped reads number | 2964819 Uniquely mapped reads % | 51.31% Average mapped length | 21.26 Number of splices: Total | 53040 Number of splices: Annotated (sjdb) | 2702 Number of splices: GT/AG | 51439 Number of splices: GC/AG | 1156 Number of splices: AT/AC | 5 Number of splices: Non-canonical | 440 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.01% Deletion average length | 1.14 Insertion rate per base | 0.00% Insertion average length | 1.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1553691 % of reads mapped to multiple loci | 26.89% Number of reads mapped to too many loci | 736673 % of reads mapped to too many loci | 12.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.09% % of reads unmapped: other | 0.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1259549 1259549 1259549 N_multimapping 1553691 1553691 1553691 N_noFeature 1688996 1784966 2860312 N_ambiguous 14636 5445 798 UnstrandedReadsAssigned:1261187 PositiveStrandReadsAssigned:1174408 NegativeStrandReadsAssigned:103709 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=19 echo kmer=19 SRR1033810 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR1033810-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,778,059 reads, 1,907,684 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 960 rounds 52973 SRR1033810.ke.tsv 35125 SRR1033810.se.tsv 88098 total ==> SRR1033810.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 3 0.926947 PNS24243 293 194 0 0 KQK14069 1603 1504 27.9938 7.89046 KQK14071 474 375 8.02015 9.06649 ==> SRR1033810.se.tsv <== BRADI_1g14170v3 39 BRADI_1g53295v3 0 BRADI_1g59795v3 0 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 1 BRADI_1g74790v3 14 BRADI_1g09890v3 0 BRADI_1g77505v3 2 BRADI_1g48960v3 0 SRR1033810 completed mapping pipeline successfully