Starting /dee2/code/volunteer_pipeline.sh SRR1033813 current disk space = 1548165337088 free memory = 1600970580 SRR1033813 SRAfilesize bdc92e5b63334e3e1e26edf0db690130 SRR1033813.sra SRR1033813.sra file validated SRR1033813 is single end SRR1033813 is conventional basespace SRR1033813 read1 length is 42 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1033813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6285 33.0 32.0 33.0 30.0 33.0 2 29.894 32.0 29.0 33.0 24.0 33.0 3 29.6095 32.0 28.0 33.0 22.0 33.0 4 30.0715 32.0 29.0 33.0 24.0 33.0 5 28.07375 30.0 26.0 32.0 19.0 33.0 6 26.99875 30.0 24.0 32.0 17.0 33.0 7 26.3155 29.0 22.0 32.0 15.0 33.0 8 28.5275 31.0 26.0 33.0 20.0 33.0 9 28.92325 31.0 27.0 33.0 22.0 33.0 10 28.848 31.0 27.0 33.0 22.0 33.0 11 29.071 31.0 27.0 33.0 21.0 33.0 12 29.40175 31.0 28.0 33.0 23.0 33.0 13 26.92075 29.0 23.0 32.0 17.0 33.0 14 29.00075 31.0 27.0 33.0 23.0 33.0 15 28.82075 31.0 27.0 33.0 21.0 33.0 16 27.888 30.0 26.0 32.0 20.0 33.0 17 28.32025 31.0 26.0 33.0 21.0 33.0 18 26.65575 29.0 24.0 32.0 17.0 33.0 19 26.82225 29.0 25.0 32.0 18.0 33.0 20 25.1945 28.0 22.0 31.0 13.0 33.0 21 24.59825 28.0 21.0 31.0 8.0 33.0 22 24.05475 27.0 21.0 31.0 4.0 32.0 23 22.03925 25.0 18.0 29.0 4.0 31.0 24 23.237 26.0 20.0 30.0 4.0 32.0 25 21.112 24.0 17.0 28.0 4.0 31.0 26 20.9035 24.0 16.0 28.0 4.0 31.0 27 17.812 20.0 10.0 25.0 4.0 29.0 28 18.476 21.0 8.0 26.0 4.0 30.0 29 20.688 24.0 11.0 29.0 4.0 31.0 30 16.934 19.0 4.0 25.0 4.0 28.0 31 14.14225 13.0 4.0 22.0 4.0 28.0 32 19.05675 23.0 4.0 28.0 4.0 31.0 33 19.8165 25.0 4.0 30.0 4.0 31.0 34 17.75425 21.0 4.0 28.0 4.0 31.0 35 15.09825 15.0 4.0 25.0 4.0 29.0 36 13.60825 11.0 4.0 23.0 4.0 28.0 37 14.90025 7.0 4.0 27.0 4.0 31.0 38 11.51675 4.0 4.0 22.0 4.0 30.0 39 9.50575 4.0 4.0 15.0 4.0 25.0 40 9.716 4.0 4.0 15.0 4.0 27.0 41 8.7615 4.0 4.0 4.0 4.0 27.0 42 8.181 4.0 4.0 4.0 4.0 28.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 4 11.0 5 2.0 6 7.0 7 2.0 8 6.0 9 17.0 10 26.0 11 43.0 12 65.0 13 95.0 14 110.0 15 109.0 16 126.0 17 132.0 18 153.0 19 181.0 20 211.0 21 253.0 22 331.0 23 377.0 24 395.0 25 395.0 26 354.0 27 267.0 28 199.0 29 74.0 30 29.0 31 10.0 32 18.0 33 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 16.526824307144675 36.76582761250953 32.29087210780575 14.416475972540047 2 27.85696424106027 23.15578894723681 20.955238809702426 28.032008002000502 3 33.80845211302826 27.081770442610654 19.954988747186796 19.154788697174293 4 25.900000000000002 26.35 20.575 27.175 5 22.755688922230558 29.75743935983996 27.081770442610654 20.40510127531883 6 21.8304576144036 25.581395348837212 31.182795698924732 21.405351337834457 7 29.382345586396596 25.831457864466117 24.15603900975244 20.630157539384847 8 30.69034517258629 25.237618809404704 23.611805902951478 20.460230115057527 9 26.825 23.724999999999998 30.175 19.275000000000002 10 35.6 24.025 19.875 20.5 11 24.60615153788447 25.63140785196299 22.48062015503876 27.28182045511378 12 28.307076769192296 32.883220805201304 19.629907476869217 19.179794948737182 13 34.70867716929232 26.9567391847962 18.454613653413354 19.879969992498125 14 24.656164041010253 35.408852213053265 20.330082520630157 19.604901225306325 15 26.96348174087044 27.03851925962982 28.114057028514257 17.883941970985493 16 26.025 26.474999999999998 21.3 26.200000000000003 17 34.625 24.975 22.575 17.825 18 34.33358339584896 22.005501375343837 21.705426356589147 21.955488872218055 19 33.91695847923962 21.68584292146073 21.5607803901951 22.836418209104554 20 25.969477107830873 29.12184138103578 23.44258193645234 21.46609957468101 21 26.081520380095025 21.255313828457115 24.081020255063766 28.582145536384097 22 23.525 17.7 35.099999999999994 23.674999999999997 23 22.875 25.95 20.549999999999997 30.625000000000004 24 29.5647823911956 17.90895447723862 34.21710855427714 18.309154577288645 25 7.078539269634818 5.6278139069534765 71.73586793396697 15.557778889444723 26 12.956478239119559 17.358679339669834 12.506253126563283 57.17858929464732 27 56.32816408204102 3.7518759379689848 30.21510755377689 9.704852426213106 28 21.43035758939735 9.577394348587147 58.61465366341585 10.37759439859965 29 6.62997247935952 50.68801601200901 17.237928446334752 25.444083062296723 30 13.034776082061548 2.877157868401301 60.120090067550656 23.967975981986488 31 58.15 1.4749999999999999 23.375 17.0 32 7.378689344672336 0.9004502251125562 24.112056028014006 67.6088044022011 33 11.989987484355444 0.37546933667083854 13.842302878598248 73.79224030037547 34 53.553553553553556 0.2502502502502503 33.58358358358358 12.612612612612612 35 5.951487871967992 0.17504376094023505 75.4438609652413 18.42960740185046 36 3.3525143857893425 0.5504128096072054 28.946710032524393 67.15036277207906 37 4.479479479479479 0.7257257257257258 86.38638638638638 8.408408408408409 38 11.783837878408807 2.001501125844383 72.80460345258945 13.41005754315737 39 6.053026513256628 4.102051025512756 33.04152076038019 56.80340170085042 40 8.30207551887972 6.726681670417604 78.66966741685421 6.301575393848462 41 33.39169584792396 8.704352176088044 47.52376188094047 10.380190095047524 42 15.45 13.0 29.475 42.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.5 24 2.0 25 1.0 26 0.0 27 2.5 28 5.0 29 5.0 30 9.0 31 13.0 32 21.0 33 29.0 34 29.0 35 41.5 36 54.0 37 91.5 38 129.0 39 184.0 40 239.0 41 239.0 42 317.5 43 396.0 44 468.5 45 541.0 46 577.5 47 614.0 48 614.0 49 601.0 50 588.0 51 532.0 52 476.0 53 476.0 54 433.5 55 391.0 56 338.5 57 286.0 58 207.5 59 129.0 60 129.0 61 82.5 62 36.0 63 25.5 64 15.0 65 10.5 66 6.0 67 6.0 68 3.5 69 1.0 70 2.0 71 3.0 72 3.0 73 1.5 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 0.5 93 0.0 94 0.5 95 1.0 96 6.0 97 11.0 98 11.0 99 20.5 100 30.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.025 3 0.025 4 0.0 5 0.025 6 0.025 7 0.025 8 0.05 9 0.0 10 0.0 11 0.025 12 0.025 13 0.025 14 0.025 15 0.05 16 0.0 17 0.0 18 0.025 19 0.05 20 0.075 21 0.025 22 0.0 23 0.0 24 0.05 25 0.05 26 0.05 27 0.05 28 0.025 29 0.075 30 0.075 31 0.0 32 0.05 33 0.125 34 0.1 35 0.025 36 0.075 37 0.1 38 0.075 39 0.05 40 0.025 41 0.05 42 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 42 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.32041049030786 85.35000000000001 2 1.3683010262257698 2.4 3 0.45610034207525657 1.2 4 0.19954389965792474 0.7000000000000001 5 0.08551881413911061 0.375 6 0.028506271379703536 0.15 7 0.05701254275940707 0.35000000000000003 8 0.0 0.0 9 0.028506271379703536 0.22499999999999998 >10 0.42759407069555305 6.800000000000001 >50 0.028506271379703536 2.45 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TCGCTTGGTGCAGATCGGGACTCGTATGCCGTCTTCTGCTTG 98 2.45 TruSeq Adapter, Index 15 (95% over 24bp) TCGCTTGGTGCAGATCGGGACTCGTATGCCGTCTTCTTCTTG 48 1.2 Illumina Single End Adapter 2 (95% over 22bp) CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC 29 0.7250000000000001 No Hit TGACAGAAGAGAGTGAGCACTCGTATGCCGTCTTCTGCTTGA 28 0.7000000000000001 TruSeq Adapter, Index 19 (95% over 24bp) TTCTACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTGAAA 25 0.625 RNA PCR Primer, Index 47 (96% over 29bp) TCGCTTGGTGCAGATCGGGACTCGTATGCCGTCTTCTTCTTT 22 0.5499999999999999 Illumina Single End Adapter 2 (95% over 21bp) TCGCTTGGTGCAGATCGGGACTCGTATGCCGTCTTTTGCTTG 17 0.42500000000000004 Illumina Single End Adapter 2 (95% over 22bp) TCTACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTGAAAA 15 0.375 RNA PCR Primer, Index 47 (96% over 29bp) TCGCTTGGTGCAGATCGGGACTCGTATGCCGTCTTCTGCTTT 14 0.35000000000000003 TruSeq Adapter, Index 15 (95% over 23bp) TCGCTTGGTGCAGATCGGGACTCGTATGCCGTCTTTTTCTTG 12 0.3 No Hit CTACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTGAAAAA 12 0.3 Illumina PCR Primer Index 1 (96% over 28bp) TTGACAGAAGAGAGTGAGCACTCGTATGCCGTCTTCTGCTTG 10 0.25 TruSeq Adapter, Index 13 (95% over 24bp) AGAATCTTGATGATGCTGCATTCGTATGCCGTCTTCTGCTTG 10 0.25 Illumina Single End Adapter 2 (95% over 22bp) TCTACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTTAAAA 10 0.25 RNA PCR Primer, Index 47 (96% over 28bp) TGAAGCTGCCAGCATGATCTGATCGTATGCCGTCTTCTGCTT 10 0.25 Illumina Single End Adapter 1 (95% over 22bp) TCGGACCAGGCTTCATTCCCCTCGTATGCCGTCTTCTGCTTG 10 0.25 TruSeq Adapter, Index 16 (96% over 25bp) CTACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTTAAAAA 9 0.22499999999999998 Illumina PCR Primer Index 1 (96% over 27bp) TTCTACAGTCCGACGATCTCGTATGCCGTCTTCTTCTTGAAA 7 0.17500000000000002 Illumina PCR Primer Index 1 (96% over 27bp) TCGCTTGGTGCAGATCGGGACTCGTATTCCGTCTTCTTCTTT 7 0.17500000000000002 No Hit AGTTCTACAGTCCGACGATCTCGTATGCCGTCTTCTGCTTGA 6 0.15 Illumina PCR Primer Index 1 (96% over 28bp) GACACGACTCTCGGCAACGGATATCTTCGTATGCCGTCTTTT 5 0.125 No Hit TCGCTTGGTGCAGATCGGGACTCGTATGCCGTCTTTTTCTTT 5 0.125 No Hit TTGACAGAAGAGAGTGAGCACTCGTATGCCGTCTTCTTCTTG 5 0.125 Illumina Single End Adapter 1 (95% over 22bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTCTT 25 0.005295735 29.09367 35 TATCGTA 25 0.005640617 28.730001 23 ATTCGTA 45 3.6041583E-6 27.931944 23 TCTTCTG 190 0.0 22.968689 35 GTCGTAT 55 1.7165268E-5 22.853409 24 CATCGTA 40 0.0019236922 22.445312 22 CTTCTGC 195 0.0 22.379747 36 TTCGTAT 115 1.8189894E-12 21.859785 24 GTCTTCT 265 0.0 21.271317 34 CGTCTTC 265 0.0 21.271317 33 GCCGTCT 295 0.0 20.340914 31 TCTTTTG 45 0.0035381867 20.203938 34 ATGCCGT 305 0.0 20.016804 29 TGCCGTC 300 0.0 19.751875 30 GTATGCC 315 0.0 19.38135 27 TATGCCG 315 0.0 19.38135 28 CGTATGC 315 0.0 19.38135 26 TCGTATG 315 0.0 19.38135 25 CCGTCTT 335 0.0 18.997732 32 CTCGTAT 90 3.7857302E-5 15.96111 24 >>END_MODULE Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532586 spots for SRR1033813.sra Written 532586 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra Read 532584 spots for SRR1033813.sra Written 532584 spots for SRR1033813.sra SRR ids: ['SRR1033813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_43wgmg28 SRR1033813.sra spots: 10651682 blocks: [[1, 532584], [532585, 1065168], [1065169, 1597752], [1597753, 2130336], [2130337, 2662920], [2662921, 3195504], [3195505, 3728088], [3728089, 4260672], [4260673, 4793256], [4793257, 5325840], [5325841, 5858424], [5858425, 6391008], [6391009, 6923592], [6923593, 7456176], [7456177, 7988760], [7988761, 8521344], [8521345, 9053928], [9053929, 9586512], [9586513, 10119096], [10119097, 10651682]] SRR1033813 file size 1559616 SRR1033813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1033813 SRR1033813_1.fastq Input file: SRR1033813_1.fastq trimmed: SRR1033813-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 01:00:58 2024 >> started Sat Dec 7 01:01:04 2024 >> done (6.140s) 10651682 reads processed; of these: 393905 ( 3.70%) short reads filtered out after trimming by size control 49221 ( 0.46%) empty reads filtered out after trimming by size control 10208556 (95.84%) reads available; of these: 7620330 (74.65%) trimmed reads available after processing 2588226 (25.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 119027 1.17% 19 176893 1.73% 20 241459 2.37% 21 254335 2.49% 22 208585 2.04% 23 198518 1.94% 24 313575 3.07% 25 233636 2.29% 26 337687 3.31% 27 383125 3.75% 28 140341 1.37% 29 172093 1.69% 30 237795 2.33% 31 284687 2.79% 32 313315 3.07% 33 455472 4.46% 34 357229 3.50% 35 243014 2.38% 36 233404 2.29% 37 552283 5.41% 38 688603 6.75% 39 307301 3.01% 40 632228 6.19% 41 535725 5.25% 42 2588226 25.35% 10208556 reads passed initial QC criterion=sequence-density sequence-density=49.10 sequence-density-rank=1 fanout-score=38.12 fanout-score-rank=3 prefix-density=58.36 prefix-fanout=32.1 sequence=TCGTATGCCGTCTTCTGCTTGAAAAACA criterion=fanout-score sequence-density=1.85 sequence-density-rank=2 fanout-score=1009.25 fanout-score-rank=1 prefix-density=58.36 prefix-fanout=32.1 sequence=TCGTATGCCGGCTTCTGCTTGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGAAAAACA -o SRR1033813 - Input file: STDIN trimmed: SRR1033813-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGAAAAACA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 01:01:16 2024 >> started Sat Dec 7 01:01:26 2024 >> done (9.892s) 9800214 reads processed; of these: 430359 ( 4.39%) short reads filtered out after trimming by size control 1982 ( 0.02%) empty reads filtered out after trimming by size control 9367873 (95.59%) reads available; of these: 7624266 (81.39%) trimmed reads available after processing 1743607 (18.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 373123 3.98% 19 385763 4.12% 20 612923 6.54% 21 1723665 18.40% 22 508549 5.43% 23 951753 10.16% 24 4015955 42.87% 25 340172 3.63% 26 314795 3.36% 27 69196 0.74% 28 24684 0.26% 29 6428 0.07% 30 2162 0.02% 31 1754 0.02% 32 1371 0.01% 33 1635 0.02% 34 1348 0.01% 35 1353 0.01% 36 1321 0.01% 37 2158 0.02% 38 2747 0.03% 39 2556 0.03% 40 3395 0.04% 41 3267 0.03% 42 15800 0.17% criterion=sequence-density sequence-density=7.81 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=14 prefix-density=0.00 prefix-fanout=1.0 sequence=TCGCTTGGTGCAGATCGGGACTCG criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=7.90 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=1.0 sequence=GACCAGGCTTCGATCCCT Started job on | Dec 07 01:01:40 Started mapping on | Dec 07 01:01:40 Finished on | Dec 07 01:02:16 Mapping speed, Million of reads per hour | 977.62 Number of input reads | 9776215 Average input read length | 23 UNIQUE READS: Uniquely mapped reads number | 5745574 Uniquely mapped reads % | 58.77% Average mapped length | 22.59 Number of splices: Total | 51558 Number of splices: Annotated (sjdb) | 2888 Number of splices: GT/AG | 50168 Number of splices: GC/AG | 939 Number of splices: AT/AC | 4 Number of splices: Non-canonical | 447 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.08 Insertion rate per base | 0.00% Insertion average length | 1.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2351061 % of reads mapped to multiple loci | 24.05% Number of reads mapped to too many loci | 1127514 % of reads mapped to too many loci | 11.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 2.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1679580 1679580 1679580 N_multimapping 2351061 2351061 2351061 N_noFeature 4335479 4604453 5464535 N_ambiguous 17098 3719 1597 UnstrandedReadsAssigned:1392997 PositiveStrandReadsAssigned:1137402 NegativeStrandReadsAssigned:279442 Dataset is classified unstranded MeadianReadLen=24 20thPercentileLength=21 echo kmer=19 SRR1033813 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR1033813-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,776,215 reads, 2,794,219 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52973 SRR1033813.ke.tsv 35125 SRR1033813.se.tsv 88098 total ==> SRR1033813.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 4.00219 0.545941 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 1.24267 0.225976 PNS24243 293 194 0 0 KQK14069 1603 1504 64.7219 10.7366 KQK14071 474 375 6.48546 4.31491 ==> SRR1033813.se.tsv <== BRADI_1g14170v3 90 BRADI_1g53295v3 2 BRADI_1g59795v3 0 BRADI_1g07683v3 2 BRADI_1g00485v3 2 BRADI_1g20270v3 3 BRADI_1g74790v3 154 BRADI_1g09890v3 2 BRADI_1g77505v3 1 BRADI_1g48960v3 2 SRR1033813 completed mapping pipeline successfully