Starting /dee2/code/volunteer_pipeline.sh SRR1033816 current disk space = 1548435525632 free memory = 1601499648 SRR1033816 SRAfilesize 12addb04ec83d53979ff00a3ed199bf8 SRR1033816.sra SRR1033816.sra file validated SRR1033816 is single end SRR1033816 is conventional basespace SRR1033816 read1 length is 42 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1033816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08025 33.0 32.0 33.0 29.0 33.0 2 31.2005 33.0 32.0 33.0 27.0 34.0 3 30.156 32.0 30.0 33.0 24.0 33.0 4 30.63575 33.0 30.0 33.0 25.0 34.0 5 31.24925 33.0 31.0 33.0 26.0 34.0 6 30.51625 32.0 30.0 33.0 24.0 34.0 7 30.09175 33.0 29.0 33.0 23.0 34.0 8 31.42775 33.0 31.0 34.0 27.0 34.0 9 31.54325 33.0 32.0 33.0 28.0 34.0 10 31.082 33.0 31.0 33.0 26.0 34.0 11 31.08175 33.0 31.0 33.0 26.0 34.0 12 30.88625 33.0 31.0 33.0 26.0 34.0 13 31.27425 33.0 31.0 33.0 27.0 34.0 14 31.0135 33.0 31.0 33.0 26.0 34.0 15 30.55675 33.0 30.0 33.0 25.0 34.0 16 30.2445 33.0 30.0 33.0 23.0 34.0 17 30.5375 33.0 30.0 33.0 24.0 34.0 18 30.18825 33.0 30.0 33.0 23.0 34.0 19 29.51025 32.0 29.0 33.0 22.0 34.0 20 29.15025 32.0 28.0 33.0 21.0 34.0 21 29.315 32.0 28.0 33.0 22.0 34.0 22 29.3665 32.0 29.0 33.0 22.0 34.0 23 27.808 31.0 26.0 33.0 18.0 33.0 24 26.018 28.0 23.0 32.0 16.0 33.0 25 25.3755 28.0 22.0 31.0 14.0 33.0 26 27.07175 30.0 25.0 32.0 18.0 33.0 27 25.749 29.0 22.0 32.0 12.0 33.0 28 27.29 30.0 26.0 32.0 18.0 33.0 29 28.19225 31.0 28.0 33.0 19.0 33.0 30 27.28275 31.0 26.0 32.0 16.0 33.0 31 23.8615 27.0 19.0 31.0 7.0 33.0 32 22.698 25.0 18.0 30.0 7.0 32.0 33 26.18525 30.0 24.0 32.0 10.0 33.0 34 27.639 31.0 28.0 33.0 10.0 33.0 35 24.057 28.0 19.0 31.0 4.0 33.0 36 21.564 25.0 15.0 30.0 4.0 32.0 37 22.0265 25.0 18.0 29.0 4.0 31.0 38 19.857 22.0 14.0 27.0 4.0 30.0 39 22.05525 25.0 16.0 30.0 4.0 32.0 40 24.91775 29.0 24.0 31.0 4.0 33.0 41 20.903 26.0 8.0 30.0 4.0 32.0 42 17.49 21.0 4.0 28.0 4.0 31.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 29.0 5 3.0 6 2.0 7 5.0 8 3.0 9 6.0 10 10.0 11 8.0 12 5.0 13 14.0 14 30.0 15 25.0 16 49.0 17 46.0 18 37.0 19 51.0 20 47.0 21 47.0 22 78.0 23 95.0 24 129.0 25 213.0 26 252.0 27 321.0 28 452.0 29 613.0 30 608.0 31 582.0 32 214.0 33 26.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.576706003078503 27.783478707029246 27.860441251924062 19.77937403796819 2 24.462231115557778 35.767883941970986 18.25912956478239 21.510755377688845 3 21.68584292146073 22.936468234117058 18.159079539769884 37.218609304652325 4 24.218163622717036 25.243932949712285 17.938453840380287 32.59944958719039 5 21.655413853463365 26.506626656664167 28.557139284821204 23.280820205051263 6 33.48337084271068 22.95573893473368 19.829957489372344 23.730932733183295 7 35.467733866933465 23.861930965482742 19.28464232116058 21.38569284642321 8 22.330582645661416 24.681170292573142 29.132283070767688 23.85596399099775 9 23.23661830915458 25.212606303151574 30.015007503751878 21.53576788394197 10 34.375 26.3 17.25 22.075 11 25.531382845711427 37.7344336084021 16.954238559639908 19.779944986246562 12 24.256064016004 26.006501625406354 29.232308077019255 20.505126281570394 13 21.680420105026258 26.25656414103526 19.72993248312078 32.3330832708177 14 20.630157539384847 27.831957989497376 21.13028257064266 30.407601900475118 15 22.900000000000002 28.000000000000004 31.374999999999996 17.724999999999998 16 34.62596947710783 26.920190142606952 20.490367775831874 17.96347260445334 17 23.150000000000002 28.749999999999996 19.05 29.049999999999997 18 27.23404255319149 21.476846057571965 19.774718397997496 31.51439299123905 19 27.85 30.275000000000002 20.45 21.425 20 32.05 20.025000000000002 28.675 19.25 21 8.027006751687923 8.427106776694174 66.2915728932233 17.254313578394598 22 3.7509377344336086 0.7001750437609402 53.088272068017005 42.460615153788446 23 42.49624812406203 1.250625312656328 5.027513756878439 51.2256128064032 24 51.087771942985746 3.2758189547386842 44.01100275068767 1.6254063515878971 25 2.5250000000000004 42.199999999999996 53.949999999999996 1.325 26 3.8259564891222806 50.88772193048262 43.51087771942986 1.7754438609652412 27 41.485371342835705 1.2253063265816453 52.938234558639664 4.351087771942986 28 51.975987993996995 0.4502251125562781 1.9509754877438719 45.62281140570285 29 4.926231557889473 0.3500875218804701 1.7504376094023506 92.9732433108277 30 42.575 0.22499999999999998 4.0 53.2 31 52.30345518277416 0.050075112669003496 42.513770655983976 5.132699048572859 32 2.4012006003001503 0.12506253126563283 54.87743871935968 42.596298149074535 33 0.7507507507507507 0.12512512512512514 47.247247247247245 51.87687687687688 34 0.5003752814610958 0.15011258443832876 94.97122842131598 4.378283712784588 35 1.1266900350525788 0.17526289434151227 57.986980470706065 40.71106659989985 36 3.1 0.375 47.599999999999994 48.925000000000004 37 42.03550887721931 0.30007501875468867 53.48837209302325 4.176044011002751 38 49.98749687421856 0.6501625406351588 7.526881720430108 41.83545886471618 39 2.1026282853566958 0.9762202753441803 47.53441802252816 49.38673341677096 40 3.1765882941470736 2.001000500250125 93.37168584292147 1.4507253626813406 41 37.525 5.1 56.8 0.575 42 47.86196549137284 46.786696674168546 4.951237809452363 0.4001000250062516 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 6.0 19 10.0 20 13.5 21 17.0 22 17.0 23 29.0 24 41.0 25 60.5 26 80.0 27 122.5 28 165.0 29 165.0 30 90.0 31 15.0 32 12.0 33 9.0 34 9.0 35 13.5 36 18.0 37 40.0 38 62.0 39 87.0 40 112.0 41 112.0 42 159.0 43 206.0 44 278.0 45 350.0 46 339.5 47 329.0 48 329.0 49 363.5 50 398.0 51 601.0 52 804.0 53 804.0 54 571.5 55 339.0 56 325.0 57 311.0 58 291.0 59 271.0 60 271.0 61 235.5 62 200.0 63 174.5 64 149.0 65 110.5 66 72.0 67 72.0 68 48.0 69 24.0 70 14.5 71 5.0 72 5.0 73 4.0 74 3.0 75 2.0 76 1.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.05 3 0.05 4 0.075 5 0.025 6 0.025 7 0.05 8 0.025 9 0.05 10 0.0 11 0.025 12 0.025 13 0.025 14 0.025 15 0.0 16 0.075 17 0.0 18 0.125 19 0.0 20 0.0 21 0.025 22 0.025 23 0.05 24 0.025 25 0.0 26 0.025 27 0.025 28 0.05 29 0.025 30 0.0 31 0.15 32 0.05 33 0.1 34 0.075 35 0.15 36 0.0 37 0.025 38 0.025 39 0.125 40 0.05 41 0.0 42 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 42 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.38724727838259 78.27499999999999 2 1.1508553654743392 1.8499999999999999 3 0.4976671850699844 1.2 4 0.18662519440124417 0.6 5 0.15552099533437014 0.625 6 0.06220839813374805 0.3 7 0.0 0.0 8 0.06220839813374805 0.4 9 0.06220839813374805 0.44999999999999996 >10 0.34214618973561434 5.2 >50 0.06220839813374805 3.6249999999999996 >100 0.031104199066874026 7.475 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTCTGCTTG 299 7.475 Illumina Single End Adapter 2 (95% over 24bp) TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCTGCTTGA 93 2.325 Illumina Single End Adapter 2 (95% over 22bp) AAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTGA 52 1.3 Illumina Single End Adapter 1 (95% over 24bp) AAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTGAA 41 1.0250000000000001 Illumina Single End Adapter 1 (95% over 24bp) CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCTGCTTGA 26 0.65 Illumina Single End Adapter 2 (95% over 22bp) AGTTCTGCCAGCTTTGATTAATCGTATGCCGTCTTCTGCTTG 25 0.625 Illumina Single End Adapter 1 (95% over 22bp) AAAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTG 21 0.525 Illumina Single End Adapter 1 (95% over 24bp) GACACGACTCTCGGCAACGGTCGTATGCCGTCTTCTGCTTGA 17 0.42500000000000004 Illumina Single End Adapter 2 (95% over 23bp) ACCGTGCCGCGATAGTAATTCTCGTATGCCGTCTTCTGCTTG 15 0.375 TruSeq Adapter, Index 19 (96% over 26bp) AAAAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTT 14 0.35000000000000003 Illumina Single End Adapter 1 (95% over 23bp) AAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTGAAA 14 0.35000000000000003 Illumina Single End Adapter 1 (95% over 24bp) ACACCGATGACGACTGTGAATCGTATGCCGTCTTCTGCTTGA 12 0.3 Illumina Single End Adapter 2 (95% over 22bp) CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCTGCTTTA 12 0.3 Illumina Single End Adapter 2 (95% over 21bp) GCGACCCCAGGTCAGGCGGGATCGTATGCCGTCTTCTGCTTG 11 0.27499999999999997 Illumina Paired End PCR Primer 2 (95% over 22bp) TTCAACCAATAGACACCGATTCGTATGCCGTCTTCTGCTTGA 9 0.22499999999999998 Illumina Single End Adapter 1 (95% over 22bp) AGAAGATTAGAAGATTATGATCGTATGCCGTCTTCTGCTTGA 9 0.22499999999999998 Illumina Single End Adapter 2 (95% over 23bp) AGTTCTGCCAGCTTTGATTATCGTATGCCGTCTTCTGCTTGA 8 0.2 TruSeq Adapter, Index 20 (95% over 24bp) AAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTTA 8 0.2 Illumina Single End Adapter 1 (95% over 23bp) NACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTCTGCTTG 6 0.15 Illumina Single End Adapter 2 (95% over 24bp) GACACGACTCTCGGCAACGGATCGTATGCCGTCTTCTGCTTG 6 0.15 Illumina Single End Adapter 2 (95% over 23bp) GGTAGTTGAATGTTTTGTTTTCGTATGCCGTCTTCTGCTTGA 5 0.125 TruSeq Adapter, Index 23 (95% over 24bp) ATGCGTGCGAGTCGACGGGTTCGTATGCCGTCTTCTGCTTGA 5 0.125 Illumina Single End Adapter 2 (95% over 23bp) GCGACCCCAGGTCAGGCGGGTCGTATGCCGTCTTCTGCTTGA 5 0.125 Illumina Single End Adapter 1 (95% over 23bp) AAAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGTTTG 5 0.125 Illumina DpnII expression Adapter 2 (95% over 21bp) AAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTGAAAA 5 0.125 Illumina Single End Adapter 1 (95% over 24bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCTGG 35 4.044159E-7 36.897438 1 CAGTCGT 25 1.2125555E-4 35.975002 18 TGCTTTA 25 1.2125555E-4 35.975002 36 ATCCTGC 35 4.978265E-7 35.975 11 GTTGATC 35 4.978265E-7 35.975 7 TGGTTGA 35 4.978265E-7 35.975 5 GGTTGAT 35 4.978265E-7 35.975 6 CCAGTCG 20 0.0018728375 35.975 17 CCTGCCA 35 4.978265E-7 35.975 13 TGATCCT 35 4.978265E-7 35.975 9 GCCAGTC 20 0.0018728375 35.975 16 CTGGTTG 35 4.978265E-7 35.975 4 ACCTGGT 35 4.978265E-7 35.975 2 GATCCTG 35 4.978265E-7 35.975 10 TGCCAGT 35 4.978265E-7 35.975 15 TTGATCC 35 4.978265E-7 35.975 8 TCCTGCC 35 4.978265E-7 35.975 12 CCTGGTT 35 4.978265E-7 35.975 3 TGCTTGA 180 0.0 32.97708 36 CTGCCAG 40 1.4169473E-6 31.478125 14 >>END_MODULE Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604940 spots for SRR1033816.sra Written 604940 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra Read 604922 spots for SRR1033816.sra Written 604922 spots for SRR1033816.sra SRR ids: ['SRR1033816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yrz2gbig SRR1033816.sra spots: 12098458 blocks: [[1, 604922], [604923, 1209844], [1209845, 1814766], [1814767, 2419688], [2419689, 3024610], [3024611, 3629532], [3629533, 4234454], [4234455, 4839376], [4839377, 5444298], [5444299, 6049220], [6049221, 6654142], [6654143, 7259064], [7259065, 7863986], [7863987, 8468908], [8468909, 9073830], [9073831, 9678752], [9678753, 10283674], [10283675, 10888596], [10888597, 11493518], [11493519, 12098458]] SRR1033816 file size 1772551 SRR1033816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1033816 SRR1033816_1.fastq Input file: SRR1033816_1.fastq trimmed: SRR1033816-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 01:10:22 2024 >> started Sat Dec 7 01:10:28 2024 >> done (6.300s) 12098458 reads processed; of these: 340486 ( 2.81%) short reads filtered out after trimming by size control 64129 ( 0.53%) empty reads filtered out after trimming by size control 11693843 (96.66%) reads available; of these: 5367840 (45.90%) trimmed reads available after processing 6326003 (54.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 99244 0.85% 19 80986 0.69% 20 95759 0.82% 21 123635 1.06% 22 126554 1.08% 23 169450 1.45% 24 145739 1.25% 25 41301 0.35% 26 56805 0.49% 27 115347 0.99% 28 90163 0.77% 29 141834 1.21% 30 157683 1.35% 31 98647 0.84% 32 50982 0.44% 33 133590 1.14% 34 299398 2.56% 35 288313 2.47% 36 156358 1.34% 37 213978 1.83% 38 127528 1.09% 39 300145 2.57% 40 1034088 8.84% 41 1220313 10.44% 42 6326003 54.10% 11693843 reads passed initial QC criterion=sequence-density sequence-density=76.07 sequence-density-rank=1 fanout-score=30.55 fanout-score-rank=4 prefix-density=80.29 prefix-fanout=28.9 sequence=TCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=1.61 sequence-density-rank=3 fanout-score=1439.73 fanout-score-rank=1 prefix-density=80.29 prefix-fanout=28.9 sequence=TCGTATGCCGGCTTCTGCTTGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGAAAAA -o SRR1033816 - Input file: STDIN trimmed: SRR1033816-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGAAAAA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 01:10:42 2024 >> started Sat Dec 7 01:10:52 2024 >> done (10.882s) 11390107 reads processed; of these: 92246 ( 0.81%) short reads filtered out after trimming by size control 14 ( 0.00%) empty reads filtered out after trimming by size control 11297847 (99.19%) reads available; of these: 10684980 (94.58%) trimmed reads available after processing 612867 ( 5.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 204851 1.81% 19 372248 3.29% 20 4655508 41.21% 21 5784057 51.20% 22 145538 1.29% 23 84180 0.75% 24 7515 0.07% 25 2291 0.02% 26 1393 0.01% 27 1944 0.02% 28 1284 0.01% 29 1384 0.01% 30 1164 0.01% 31 725 0.01% 32 632 0.01% 33 881 0.01% 34 1485 0.01% 35 1636 0.01% 36 1613 0.01% 37 1501 0.01% 38 971 0.01% 39 1335 0.01% 40 3623 0.03% 41 4341 0.04% 42 15747 0.14% criterion=sequence-density sequence-density=11.92 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=16 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGTTCGTATGC criterion=fanout-score sequence-density=0.20 sequence-density-rank=5 fanout-score=59.73 fanout-score-rank=1 prefix-density=11.99 prefix-fanout=1.0 sequence=TTGATCCTGCCCGT Started job on | Dec 07 01:11:08 Started mapping on | Dec 07 01:11:08 Finished on | Dec 07 01:11:36 Mapping speed, Million of reads per hour | 1491.63 Number of input reads | 11601583 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 7932086 Uniquely mapped reads % | 68.37% Average mapped length | 20.35 Number of splices: Total | 218830 Number of splices: Annotated (sjdb) | 203827 Number of splices: GT/AG | 216660 Number of splices: GC/AG | 1916 Number of splices: AT/AC | 153 Number of splices: Non-canonical | 101 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1380864 % of reads mapped to multiple loci | 11.90% Number of reads mapped to too many loci | 1922790 % of reads mapped to too many loci | 16.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2288633 2288633 2288633 N_multimapping 1380864 1380864 1380864 N_noFeature 401062 491194 7713653 N_ambiguous 136958 9069 484 UnstrandedReadsAssigned:7394066 PositiveStrandReadsAssigned:7431823 NegativeStrandReadsAssigned:217949 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=20 echo kmer=19 SRR1033816 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR1033816-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,601,583 reads, 7,454,672 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52973 SRR1033816.ke.tsv 35125 SRR1033816.se.tsv 88098 total ==> SRR1033816.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 32.0175 2.99699 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 100.982 12.601 PNS24243 293 194 1 0.882491 KQK14069 1603 1504 8458.78 962.879 KQK14071 474 375 1893.91 864.648 ==> SRR1033816.se.tsv <== BRADI_1g14170v3 9275 BRADI_1g53295v3 13 BRADI_1g59795v3 3 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 78 BRADI_1g74790v3 538 BRADI_1g09890v3 0 BRADI_1g77505v3 101 BRADI_1g48960v3 0 SRR1033816 completed mapping pipeline successfully