Starting /dee2/code/volunteer_pipeline.sh SRR1033817 current disk space = 1548425506816 free memory = 1599275156 SRR1033817 SRAfilesize 54d97ffa3e065df1a29a7bedb31d0ecf SRR1033817.sra SRR1033817.sra file validated SRR1033817 is single end SRR1033817 is conventional basespace SRR1033817 read1 length is 42 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1033817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5005 33.0 32.0 33.0 30.0 33.0 2 30.39075 32.0 30.0 33.0 25.0 33.0 3 29.82825 32.0 29.0 33.0 23.0 33.0 4 29.31125 31.0 28.0 33.0 22.0 33.0 5 30.78175 32.0 30.0 33.0 26.0 34.0 6 29.267 31.0 28.0 33.0 22.0 33.0 7 29.1915 31.0 27.0 33.0 22.0 33.0 8 28.42725 30.0 26.0 33.0 20.0 33.0 9 28.5335 31.0 27.0 32.0 20.0 33.0 10 28.7175 31.0 26.0 33.0 20.0 33.0 11 28.74175 31.0 27.0 33.0 21.0 33.0 12 29.548 31.0 28.0 33.0 23.0 33.0 13 29.3935 32.0 28.0 33.0 22.0 33.0 14 30.44175 32.0 30.0 33.0 25.0 33.0 15 30.243 32.0 30.0 33.0 24.0 33.0 16 29.26675 31.0 28.0 33.0 22.0 33.0 17 29.837 32.0 29.0 33.0 24.0 33.0 18 28.94675 31.0 28.0 33.0 21.0 33.0 19 28.7095 31.0 27.0 33.0 21.0 33.0 20 27.6355 30.0 26.0 32.0 20.0 33.0 21 29.035 32.0 28.0 33.0 22.0 33.0 22 27.734 30.0 26.0 32.0 20.0 33.0 23 23.18175 25.0 19.0 29.0 12.0 31.0 24 20.1195 21.0 16.0 26.0 9.0 29.0 25 25.383 27.0 23.0 31.0 16.0 33.0 26 25.9115 28.0 24.0 31.0 16.0 33.0 27 24.916 28.0 22.0 31.0 10.0 33.0 28 23.2575 26.0 19.0 30.0 8.0 32.0 29 25.796 28.0 25.0 31.0 13.0 32.0 30 21.6415 24.0 17.0 28.0 4.0 31.0 31 19.91225 21.0 15.0 26.0 4.0 29.0 32 21.69125 24.0 18.0 28.0 4.0 31.0 33 24.9645 28.0 22.0 31.0 4.0 33.0 34 27.40975 31.0 29.0 33.0 4.0 33.0 35 21.75075 26.0 13.0 31.0 4.0 32.0 36 19.03775 22.0 11.0 26.0 4.0 29.0 37 15.8185 14.0 4.0 26.0 4.0 29.0 38 13.06825 13.0 4.0 20.0 4.0 24.0 39 17.894 20.0 4.0 28.0 4.0 31.0 40 21.15 28.0 4.0 30.0 4.0 32.0 41 14.42225 9.0 4.0 27.0 4.0 30.0 42 9.66875 4.0 4.0 19.0 4.0 26.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 4 16.0 5 2.0 6 1.0 7 3.0 8 6.0 9 5.0 10 7.0 11 15.0 12 21.0 13 34.0 14 50.0 15 58.0 16 64.0 17 81.0 18 54.0 19 66.0 20 98.0 21 149.0 22 192.0 23 243.0 24 274.0 25 378.0 26 423.0 27 529.0 28 471.0 29 388.0 30 266.0 31 91.0 32 14.0 33 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.91057741440981 24.01635155850792 31.119059785385794 19.954011241696474 2 23.20580145036259 31.682920730182545 20.980245061265315 24.131032758189548 3 22.311155577788895 19.109554777388695 22.18609304652326 36.39319659829915 4 23.06153076538269 22.411205602801402 20.735367683841922 33.79189594797399 5 21.525 23.825 30.875000000000004 23.775 6 32.800000000000004 20.3 22.775000000000002 24.125 7 34.08352088022005 21.330332583145786 23.755938984746187 20.830207551887973 8 21.73043260815204 21.405351337834457 35.13378344586147 21.73043260815204 9 22.25 21.425 35.825 20.5 10 35.43385846461615 21.75543885971493 21.255313828457115 21.555388847211805 11 23.605901475368842 35.3088272068017 21.280320080020005 19.80495123780945 12 23.575 24.375 31.7 20.349999999999998 13 20.955238809702426 23.980995248812203 21.8304576144036 33.23330832708177 14 21.380345086271568 24.381095273818453 22.43060765191298 31.807951987997 15 22.56128064032016 24.262131065532767 32.36618309154578 20.810405202601302 16 34.058514628657164 23.93098274568642 23.355838959739934 18.65466366591648 17 23.330832708177045 25.6064016004001 21.530382595648913 29.532383095773945 18 27.227227227227228 21.27127127127127 19.794794794794797 31.706706706706704 19 26.056514128532132 34.45861465366342 18.37959489872468 21.10527631907977 20 30.990495247623812 22.36118059029515 25.68784392196098 20.96048024012006 21 6.478239119559779 7.603801900950476 72.93646823411706 12.981490745372687 22 1.225 0.325 51.675000000000004 46.775 23 46.51162790697674 0.45011252813203295 1.72543135783946 51.312828207051766 24 50.412603150787696 1.1252813203300824 47.961990497624406 0.5001250312578145 25 0.7251812953238309 46.73668417104276 52.188047011752936 0.3500875218804701 26 1.1005502751375689 51.05052526263132 47.073536768384194 0.7753876938469234 27 46.09804902451226 0.22511255627813906 52.10105052526263 1.5757878939469734 28 50.92546273136568 0.22511255627813906 1.0755377688844423 47.77388694347174 29 1.6516516516516515 0.12512512512512514 0.6506506506506506 97.57257257257257 30 45.925 0.075 2.225 51.775000000000006 31 50.300601202404806 0.0250501002004008 48.24649298597195 1.4278557114228456 32 0.35035035035035034 0.10010010010010009 52.9029029029029 46.646646646646644 33 0.17521902377972465 0.05006257822277847 48.710888610763455 51.06382978723404 34 0.15015015015015015 0.050050050050050046 98.74874874874875 1.0510510510510511 35 0.40040040040040037 0.050050050050050046 56.106106106106104 43.44344344344344 36 0.9754877438719359 0.0750375187593797 49.02451225612807 49.92496248124062 37 33.9584896224056 0.1000250062515629 64.9412353088272 1.000250062515629 38 45.38634658664667 0.12503125781445362 7.851962990747687 46.6366591647912 39 0.5001250312578145 0.27506876719179796 49.53738434608652 49.68742185546387 40 0.8502125531382845 0.6751687921980495 98.22455613903476 0.25006251562890724 41 38.70967741935484 1.72543135783946 59.489872468117035 0.07501875468867217 42 34.3671835917959 48.3991995997999 17.083541770885443 0.1500750375187594 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 3.0 16 4.0 17 4.0 18 3.5 19 3.0 20 5.0 21 7.0 22 7.0 23 11.5 24 16.0 25 21.5 26 27.0 27 27.5 28 28.0 29 28.0 30 24.5 31 21.0 32 22.0 33 23.0 34 23.0 35 40.5 36 58.0 37 104.0 38 150.0 39 184.0 40 218.0 41 218.0 42 261.0 43 304.0 44 376.0 45 448.0 46 448.5 47 449.0 48 449.0 49 489.5 50 530.0 51 616.0 52 702.0 53 702.0 54 514.5 55 327.0 56 298.5 57 270.0 58 226.0 59 182.0 60 182.0 61 156.0 62 130.0 63 94.5 64 59.0 65 44.0 66 29.0 67 29.0 68 19.0 69 9.0 70 6.0 71 3.0 72 3.0 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.025 3 0.05 4 0.05 5 0.0 6 0.0 7 0.025 8 0.025 9 0.0 10 0.025 11 0.025 12 0.0 13 0.025 14 0.025 15 0.05 16 0.025 17 0.025 18 0.1 19 0.025 20 0.05 21 0.05 22 0.0 23 0.025 24 0.025 25 0.025 26 0.05 27 0.05 28 0.05 29 0.1 30 0.0 31 0.2 32 0.1 33 0.125 34 0.1 35 0.1 36 0.05 37 0.025 38 0.025 39 0.025 40 0.025 41 0.025 42 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 42 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.066935949221 84.975 2 0.9809578765147143 1.7000000000000002 3 0.3173687247547605 0.8250000000000001 4 0.259665320253895 0.8999999999999999 5 0.1154068090017311 0.5 6 0.0 0.0 7 0.1154068090017311 0.7000000000000001 8 0.0 0.0 9 0.0 0.0 >10 0.05770340450086555 0.8 >50 0.05770340450086555 3.5249999999999995 >100 0.028851702250432775 6.075 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTCTGCTTG 243 6.075 Illumina Single End Adapter 2 (95% over 24bp) TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCTGCTTGA 84 2.1 Illumina Single End Adapter 2 (95% over 22bp) TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTCTGCTTT 57 1.425 Illumina Single End Adapter 2 (95% over 23bp) CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCTGCTTGA 19 0.475 Illumina Single End Adapter 2 (95% over 22bp) TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCTTCTTGA 13 0.325 Illumina Single End Adapter 1 (95% over 21bp) GACACGACTCTCGGCAACGGTCGTATGCCGTCTTCTGCTTGA 7 0.17500000000000002 Illumina Single End Adapter 2 (95% over 23bp) TCTCATGGAGAGTTCGATCCTTCGTATGCCGTCTTCTGCTTG 7 0.17500000000000002 Illumina Single End Adapter 1 (95% over 22bp) CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCTGCTTTA 7 0.17500000000000002 Illumina Single End Adapter 2 (95% over 21bp) AAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTGAA 7 0.17500000000000002 Illumina Single End Adapter 1 (95% over 24bp) AAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTGCTTGA 5 0.125 Illumina Single End Adapter 1 (95% over 24bp) TCAAAAGAGGAAAGGCTTGCTCGTATGCCGTCTTCTGCTTGA 5 0.125 TruSeq Adapter, Index 23 (95% over 24bp) CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCTTCTTTA 5 0.125 No Hit GACACGACTCTCGGCAACGGATCGTATGCCGTCTTCTGCTTT 5 0.125 Illumina Single End Adapter 2 (95% over 22bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCTGG 50 1.0004442E-10 36.602566 1 CAGTTCG 30 7.5327625E-6 36.13924 18 CCAGTTC 30 7.5327625E-6 36.13924 17 CCAGTCG 25 1.17765245E-4 36.13924 17 GCCAGTT 30 7.5327625E-6 36.13924 16 GCCAGTC 25 1.17765245E-4 36.13924 16 ACCTGGT 50 1.1641532E-10 36.13924 2 TGCCAGT 50 1.1641532E-10 36.13924 15 CTGCCAG 50 1.1641532E-10 36.13924 14 AGTTCGT 40 3.0098818E-8 36.13924 19 CCTGGTT 50 1.1641532E-10 36.13924 3 ATCCTGC 50 1.3460522E-10 35.687504 11 GTTGATC 50 1.3460522E-10 35.687504 7 TGGTTGA 50 1.3460522E-10 35.687504 5 GGTTGAT 50 1.3460522E-10 35.687504 6 CCTGCCA 50 1.3460522E-10 35.687504 13 TGATCCT 50 1.3460522E-10 35.687504 9 CTGGTTG 50 1.3460522E-10 35.687504 4 GATCCTG 50 1.3460522E-10 35.687504 10 TTGATCC 50 1.3460522E-10 35.687504 8 >>END_MODULE Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730883 spots for SRR1033817.sra Written 730883 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra Read 730865 spots for SRR1033817.sra Written 730865 spots for SRR1033817.sra SRR ids: ['SRR1033817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f9e37mz4 SRR1033817.sra spots: 14617318 blocks: [[1, 730865], [730866, 1461730], [1461731, 2192595], [2192596, 2923460], [2923461, 3654325], [3654326, 4385190], [4385191, 5116055], [5116056, 5846920], [5846921, 6577785], [6577786, 7308650], [7308651, 8039515], [8039516, 8770380], [8770381, 9501245], [9501246, 10232110], [10232111, 10962975], [10962976, 11693840], [11693841, 12424705], [12424706, 13155570], [13155571, 13886435], [13886436, 14617318]] SRR1033817 file size 2143917 SRR1033817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1033817 SRR1033817_1.fastq Input file: SRR1033817_1.fastq trimmed: SRR1033817-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 01:10:34 2024 >> started Sat Dec 7 01:10:41 2024 >> done (7.204s) 14617318 reads processed; of these: 289334 ( 1.98%) short reads filtered out after trimming by size control 55047 ( 0.38%) empty reads filtered out after trimming by size control 14272937 (97.64%) reads available; of these: 5717962 (40.06%) trimmed reads available after processing 8554975 (59.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 84104 0.59% 19 68031 0.48% 20 82371 0.58% 21 102706 0.72% 22 103281 0.72% 23 143853 1.01% 24 121320 0.85% 25 30570 0.21% 26 45599 0.32% 27 109208 0.77% 28 76474 0.54% 29 143141 1.00% 30 147142 1.03% 31 84818 0.59% 32 38397 0.27% 33 124142 0.87% 34 316254 2.22% 35 283803 1.99% 36 172204 1.21% 37 192854 1.35% 38 115192 0.81% 39 305425 2.14% 40 1261862 8.84% 41 1565211 10.97% 42 8554975 59.94% 14272937 reads passed initial QC criterion=sequence-density sequence-density=84.94 sequence-density-rank=1 fanout-score=31.33 fanout-score-rank=4 prefix-density=87.86 prefix-fanout=30.3 sequence=TCGTATGCCGTCTTCTGCTTGAAAAA criterion=fanout-score sequence-density=1.49 sequence-density-rank=4 fanout-score=57.64 fanout-score-rank=1 prefix-density=85.16 prefix-fanout=1.0 sequence=TATGCCGTCTTTTGCTTGAA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGAAAAA -o SRR1033817 - Input file: STDIN trimmed: SRR1033817-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGAAAAA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 01:10:58 2024 >> started Sat Dec 7 01:11:13 2024 >> done (15.513s) 13937103 reads processed; of these: 30554 ( 0.22%) short reads filtered out after trimming by size control 17 ( 0.00%) empty reads filtered out after trimming by size control 13906532 (99.78%) reads available; of these: 13390514 (96.29%) trimmed reads available after processing 516018 ( 3.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 114543 0.82% 19 171676 1.23% 20 6163308 44.32% 21 7233403 52.01% 22 116042 0.83% 23 70854 0.51% 24 5977 0.04% 25 2312 0.02% 26 1418 0.01% 27 1701 0.01% 28 744 0.01% 29 947 0.01% 30 818 0.01% 31 513 0.00% 32 405 0.00% 33 588 0.00% 34 1014 0.01% 35 1247 0.01% 36 1317 0.01% 37 1072 0.01% 38 570 0.00% 39 875 0.01% 40 2647 0.02% 41 3232 0.02% 42 9309 0.07% criterion=sequence-density sequence-density=13.25 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=20 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGTTC criterion=fanout-score sequence-density=0.30 sequence-density-rank=2 fanout-score=44.43 fanout-score-rank=1 prefix-density=13.27 prefix-fanout=1.0 sequence=TTGATCCTGCCCGT Started job on | Dec 07 01:11:29 Started mapping on | Dec 07 01:11:29 Finished on | Dec 07 01:12:14 Mapping speed, Million of reads per hour | 1139.39 Number of input reads | 14242366 Average input read length | 21 UNIQUE READS: Uniquely mapped reads number | 10017756 Uniquely mapped reads % | 70.34% Average mapped length | 20.40 Number of splices: Total | 238952 Number of splices: Annotated (sjdb) | 218331 Number of splices: GT/AG | 236164 Number of splices: GC/AG | 2602 Number of splices: AT/AC | 118 Number of splices: Non-canonical | 68 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.23 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1446958 % of reads mapped to multiple loci | 10.16% Number of reads mapped to too many loci | 2390353 % of reads mapped to too many loci | 16.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2777652 2777652 2777652 N_multimapping 1446958 1446958 1446958 N_noFeature 642732 771345 9717119 N_ambiguous 189254 17269 880 UnstrandedReadsAssigned:9185770 PositiveStrandReadsAssigned:9229142 NegativeStrandReadsAssigned:299757 Dataset is classified positive stranded MeadianReadLen=21 20thPercentileLength=20 echo kmer=19 SRR1033817 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR1033817-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,242,366 reads, 9,085,638 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,269 rounds 52973 SRR1033817.ke.tsv 35125 SRR1033817.se.tsv 88098 total ==> SRR1033817.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 181 20.1826 PNS24243 293 194 14 11.0403 KQK14069 1603 1504 4625.18 470.472 KQK14071 474 375 227.02 92.6161 ==> SRR1033817.se.tsv <== BRADI_1g14170v3 4578 BRADI_1g53295v3 0 BRADI_1g59795v3 18 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 536 BRADI_1g74790v3 59 BRADI_1g09890v3 0 BRADI_1g77505v3 183 BRADI_1g48960v3 0 SRR1033817 completed mapping pipeline successfully