Starting /dee2/code/volunteer_pipeline.sh SRR1033818 current disk space = 1548415324160 free memory = 1603764220 SRR1033818 SRAfilesize 832216ce3b19d41976437feed56285c5 SRR1033818.sra SRR1033818.sra file validated SRR1033818 is single end SRR1033818 is conventional basespace SRR1033818 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1033818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.732 33.0 29.0 33.0 4.0 33.0 2 28.9485 33.0 30.0 33.0 16.0 34.0 3 28.4795 32.0 29.0 33.0 13.0 34.0 4 28.22075 32.0 28.0 33.0 11.0 34.0 5 28.1465 32.0 28.0 33.0 11.0 33.0 6 27.93525 32.0 28.0 33.0 9.0 33.0 7 27.70425 32.0 28.0 33.0 8.0 34.0 8 27.5745 32.0 28.0 33.0 5.0 33.0 9 27.2155 32.0 27.0 33.0 4.0 33.0 10 27.20875 32.0 27.0 33.0 4.0 33.0 11 26.7895 32.0 26.0 33.0 4.0 33.0 12 25.75175 30.0 24.0 33.0 4.0 33.0 13 25.4425 30.0 23.0 33.0 4.0 33.0 14 24.81175 30.0 21.0 32.0 4.0 33.0 15 25.121 31.0 22.0 33.0 4.0 33.0 16 23.84575 29.0 19.0 32.0 4.0 33.0 17 23.2745 28.0 17.0 32.0 4.0 33.0 18 24.13725 30.0 18.0 33.0 4.0 33.0 19 23.8005 30.0 16.0 33.0 4.0 33.0 20 23.6205 30.0 15.0 33.0 4.0 33.0 21 23.708 30.0 16.0 32.0 4.0 33.0 22 23.44 29.0 16.0 32.0 4.0 33.0 23 21.3295 26.0 10.0 30.0 4.0 33.0 24 20.75 24.0 10.0 30.0 4.0 32.0 25 20.27625 23.0 9.0 30.0 4.0 32.0 26 21.467 26.0 10.0 30.0 4.0 32.0 27 21.671 27.0 8.0 31.0 4.0 33.0 28 21.88925 27.0 7.0 31.0 4.0 33.0 29 23.11375 29.0 4.0 32.0 4.0 33.0 30 22.07525 28.0 4.0 31.0 4.0 33.0 31 19.28475 22.0 4.0 29.0 4.0 32.0 32 18.67075 21.0 4.0 28.0 4.0 32.0 33 21.4405 27.0 4.0 31.0 4.0 33.0 34 22.27275 29.0 4.0 32.0 4.0 33.0 35 17.84775 21.0 4.0 29.0 4.0 31.0 36 16.382 20.0 4.0 28.0 4.0 31.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 277.0 5 43.0 6 28.0 7 32.0 8 46.0 9 43.0 10 37.0 11 50.0 12 47.0 13 57.0 14 69.0 15 66.0 16 64.0 17 51.0 18 49.0 19 44.0 20 63.0 21 70.0 22 77.0 23 108.0 24 151.0 25 182.0 26 226.0 27 281.0 28 338.0 29 384.0 30 469.0 31 384.0 32 239.0 33 25.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.599367422245653 25.092250922509223 20.2161307327359 25.092250922509223 2 28.359708615925648 24.039186134137154 21.225822657623713 26.375282592313486 3 26.0694514343231 22.672370407649723 23.15047810770005 28.10770005032713 4 26.831109992449033 24.918197835388874 22.92977598791845 25.320916184243647 5 24.395770392749245 27.341389728096676 23.94259818731118 24.3202416918429 6 22.941324603374465 25.056660790732817 25.56031226391337 26.44170234197935 7 24.949596774193548 25.756048387096776 25.680443548387093 23.61391129032258 8 23.562058526740667 24.77295660948537 26.740665993945512 24.924318869828458 9 24.59016393442623 25.069356872635563 26.35561160151324 23.98486759142497 10 27.265841959101238 27.06387275940419 21.93890431709164 23.73138096440293 11 26.75593734209197 26.32642748863062 23.34512379989894 23.572511369378475 12 25.83985855013892 26.673402374336952 23.566557211417024 23.9201818641071 13 23.115832068791097 27.921092564491655 24.32979261507334 24.633282751643907 14 22.008113590263694 27.6369168356998 25.456389452332655 24.898580121703855 15 24.671052631578945 28.99797570850202 24.215587044534413 22.115384615384613 16 25.49467275494673 28.31050228310502 24.759005580923386 21.43581938102486 17 24.366125760649087 28.524340770791074 24.087221095334684 23.02231237322515 18 29.0913718503436 25.60447951132604 21.226775260880633 24.07737337744973 19 29.821882951653944 27.65903307888041 20.15267175572519 22.366412213740457 20 25.292919001528276 24.732552215995923 27.024961793173713 22.949566989302088 21 8.64134590874331 8.590364516951313 68.34055569717053 14.427733877134846 22 3.3647718582717303 1.1470813153199082 41.42238083099669 54.065765995411674 23 53.30104511853173 1.198062707111904 4.307927606423656 41.192964567932705 24 41.4329423763386 1.9122896481387048 55.583885772565026 1.0708822029576748 25 1.9662921348314606 54.060265577119516 42.18590398365679 1.787538304392237 26 1.9181585677749362 41.023017902813294 55.67774936061382 1.381074168797954 27 51.59805676297622 0.9716185118895424 44.92457172078752 2.5057530043467144 28 43.87493593029216 0.8713480266529985 1.1019989748846746 54.15171706817017 29 3.6363636363636362 0.8450704225352111 0.7682458386683738 94.75032010243278 30 54.1025641025641 0.9743589743589745 1.8461538461538463 43.07692307692308 31 43.67786611951783 0.3847140292382662 53.39830725827135 2.539112592972557 32 3.051282051282051 0.6923076923076923 40.94871794871795 55.3076923076923 33 0.641025641025641 0.6923076923076923 58.23076923076923 40.43589743589743 34 0.3334188253398307 0.5898948448320082 96.79404975634777 2.2826365734803797 35 0.6157003591585428 0.7439712673165726 50.05130836326322 48.58902001026168 36 1.334359763920965 0.43623299974339236 63.07415960995638 35.155247626379264 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 19.0 1 18.5 2 18.0 3 18.0 4 13.0 5 8.0 6 8.0 7 5.0 8 2.0 9 2.0 10 3.5 11 5.0 12 5.0 13 8.5 14 12.0 15 18.0 16 24.0 17 24.0 18 25.0 19 26.0 20 26.0 21 40.0 22 54.0 23 54.0 24 57.5 25 61.0 26 54.5 27 48.0 28 48.0 29 44.5 30 41.0 31 41.0 32 50.5 33 60.0 34 60.0 35 90.0 36 120.0 37 120.0 38 145.0 39 170.0 40 218.0 41 266.0 42 266.0 43 312.5 44 359.0 45 359.0 46 378.0 47 397.0 48 397.0 49 409.5 50 422.0 51 423.5 52 425.0 53 425.0 54 427.0 55 429.0 56 429.0 57 399.0 58 369.0 59 369.0 60 317.0 61 265.0 62 265.0 63 224.5 64 184.0 65 143.5 66 103.0 67 103.0 68 80.5 69 58.0 70 58.0 71 43.5 72 29.0 73 29.0 74 21.0 75 13.0 76 8.5 77 4.0 78 4.0 79 3.5 80 3.0 81 3.0 82 3.0 83 3.0 84 3.0 85 1.5 86 0.0 87 0.0 88 1.5 89 3.0 90 1.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.1499999999999995 2 0.475 3 0.65 4 0.675 5 0.7000000000000001 6 0.7250000000000001 7 0.8 8 0.8999999999999999 9 0.8750000000000001 10 0.975 11 1.05 12 1.0250000000000001 13 1.15 14 1.4000000000000001 15 1.2 16 1.4500000000000002 17 1.4000000000000001 18 1.775 19 1.7500000000000002 20 1.8499999999999999 21 1.925 22 1.925 23 1.925 24 1.95 25 2.1 26 2.25 27 2.225 28 2.45 29 2.375 30 2.5 31 2.5250000000000004 32 2.5 33 2.5 34 2.5250000000000004 35 2.55 36 2.5749999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10438847052714 94.45 2 1.3762659049597508 2.65 3 0.18177096857958971 0.525 4 0.12983640612827838 0.5 5 0.051934562451311346 0.25 6 0.025967281225655673 0.15 7 0.025967281225655673 0.17500000000000002 8 0.025967281225655673 0.2 9 0.0 0.0 >10 0.07790184367696702 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCT 20 0.5 No Hit CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCT 13 0.325 No Hit AAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTCTG 11 0.27499999999999997 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit AAAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTC 7 0.17500000000000002 No Hit AAGGCCTAAACAGCAGCTCTCGTATGCCGTCTTCTG 6 0.15 Illumina PCR Primer Index 9 (95% over 23bp) TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTC 5 0.125 No Hit AAAAAAAAAAAAAAAAAAGTTCGTATGCCGTCTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCGTA 20 0.004623894 29.911392 19 AATCGTA 35 2.1025298E-6 29.911392 19 GGTCGTA 20 0.004623894 29.911392 20 GTCTTCT 200 0.0 29.537502 30 GTCGTAT 40 5.3704625E-6 26.50801 21 CTCGTAT 80 5.456968E-12 24.303007 20 ATCGTAT 85 1.0326403E-8 19.354431 20 GTTCGTA 55 7.025651E-5 19.034523 19 TTCGTAT 135 0.0 18.833097 20 CGTCTTC 315 0.0 18.75397 29 TCGTATG 335 0.0 18.538652 21 TGCCGTC 335 0.0 18.08649 26 CCGTCTT 335 0.0 18.08649 28 GCCGTCT 335 0.0 18.08649 27 ATGCCGT 340 0.0 17.820513 25 GTATGCC 350 0.0 17.74414 23 CGTATGC 350 0.0 17.74414 22 TATGCCG 355 0.0 17.49422 24 >>END_MODULE Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903059 spots for SRR1033818.sra Written 903059 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra Read 903042 spots for SRR1033818.sra Written 903042 spots for SRR1033818.sra SRR ids: ['SRR1033818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iqcp4mnm SRR1033818.sra spots: 18060857 blocks: [[1, 903042], [903043, 1806084], [1806085, 2709126], [2709127, 3612168], [3612169, 4515210], [4515211, 5418252], [5418253, 6321294], [6321295, 7224336], [7224337, 8127378], [8127379, 9030420], [9030421, 9933462], [9933463, 10836504], [10836505, 11739546], [11739547, 12642588], [12642589, 13545630], [13545631, 14448672], [14448673, 15351714], [15351715, 16254756], [16254757, 17157798], [17157799, 18060857]] SRR1033818 file size 2351844 SRR1033818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1033818 SRR1033818_1.fastq Input file: SRR1033818_1.fastq trimmed: SRR1033818-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 01:11:08 2024 >> started Sat Dec 7 01:11:17 2024 >> done (8.216s) 18060857 reads processed; of these: 2596810 (14.38%) short reads filtered out after trimming by size control 969371 ( 5.37%) empty reads filtered out after trimming by size control 14494676 (80.25%) reads available; of these: 5506891 (37.99%) trimmed reads available after processing 8987785 (62.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 231015 1.59% 19 149646 1.03% 20 189766 1.31% 21 203435 1.40% 22 110913 0.77% 23 100221 0.69% 24 83735 0.58% 25 42593 0.29% 26 74812 0.52% 27 130667 0.90% 28 147034 1.01% 29 256114 1.77% 30 295308 2.04% 31 177060 1.22% 32 68650 0.47% 33 273218 1.88% 34 1290235 8.90% 35 1682469 11.61% 36 8987785 62.01% 14494676 reads passed initial QC criterion=sequence-density sequence-density=80.27 sequence-density-rank=1 fanout-score=44.97 fanout-score-rank=1 prefix-density=83.90 prefix-fanout=43.0 sequence=TCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=80.27 sequence-density-rank=1 fanout-score=44.97 fanout-score-rank=1 prefix-density=83.90 prefix-fanout=43.0 sequence=TCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTG -o SRR1033818 - Input file: STDIN trimmed: SRR1033818-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 01:11:34 2024 >> started Sat Dec 7 01:11:46 2024 >> done (12.041s) 14136783 reads processed; of these: 32821 ( 0.23%) short reads filtered out after trimming by size control 11 ( 0.00%) empty reads filtered out after trimming by size control 14103951 (99.77%) reads available; of these: 13148528 (93.23%) trimmed reads available after processing 955423 ( 6.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 253975 1.80% 19 264985 1.88% 20 7626646 54.07% 21 5720873 40.56% 22 117114 0.83% 23 39213 0.28% 24 2856 0.02% 25 1619 0.01% 26 1675 0.01% 27 2017 0.01% 28 1684 0.01% 29 2678 0.02% 30 2640 0.02% 31 1944 0.01% 32 1795 0.01% 33 2591 0.02% 34 6846 0.05% 35 7439 0.05% 36 45361 0.32% criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=24 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=13.98 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.7 sequence=TGCATGCATGTGTACTTGTACGCCGTAGATCAACTTGTACCTTTGTCTAGTTATGTGTTGATTTGTACCATGGTGGAGTGAACCCCGCGCAATGTAATTAAGCATGAG Started job on | Dec 07 01:12:00 Started mapping on | Dec 07 01:12:00 Finished on | Dec 07 01:12:28 Mapping speed, Million of reads per hour | 1859.38 Number of input reads | 14461844 Average input read length | 20 UNIQUE READS: Uniquely mapped reads number | 11840957 Uniquely mapped reads % | 81.88% Average mapped length | 20.27 Number of splices: Total | 225373 Number of splices: Annotated (sjdb) | 194411 Number of splices: GT/AG | 223074 Number of splices: GC/AG | 1834 Number of splices: AT/AC | 76 Number of splices: Non-canonical | 389 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1928436 % of reads mapped to multiple loci | 13.33% Number of reads mapped to too many loci | 306168 % of reads mapped to too many loci | 2.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 692451 692451 692451 N_multimapping 1928436 1928436 1928436 N_noFeature 621756 756583 11485228 N_ambiguous 233497 12411 1445 UnstrandedReadsAssigned:10985704 PositiveStrandReadsAssigned:11071963 NegativeStrandReadsAssigned:354284 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR1033818 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR1033818-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,461,844 reads, 10,678,625 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR1033818.ke.tsv 35125 SRR1033818.se.tsv 88098 total ==> SRR1033818.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 4.00219 0.264064 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 108.998 9.58714 PNS24243 293 194 0 0 KQK14069 1603 1504 9251.12 742.287 KQK14071 474 375 89.56 28.8209 ==> SRR1033818.se.tsv <== BRADI_1g14170v3 8894 BRADI_1g53295v3 4 BRADI_1g59795v3 32 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 40 BRADI_1g74790v3 50 BRADI_1g09890v3 3 BRADI_1g77505v3 203 BRADI_1g48960v3 2 SRR1033818 completed mapping pipeline successfully