Starting /dee2/code/volunteer_pipeline.sh SRR1033819 current disk space = 1548408684544 free memory = 1603209284 SRR1033819 SRAfilesize c61b927409d1911c661fb0db5026250a SRR1033819.sra SRR1033819.sra file validated SRR1033819 is single end SRR1033819 is conventional basespace SRR1033819 read1 length is 36 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1033819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.296 38.0 33.0 39.0 26.0 40.0 2 34.33325 38.0 33.0 39.0 22.0 40.0 3 34.44575 38.0 33.0 39.0 24.0 40.0 4 34.3575 38.0 33.0 39.0 24.0 40.0 5 34.3565 38.0 33.0 39.0 23.0 40.0 6 34.673 38.0 34.0 39.0 23.0 40.0 7 34.628 38.0 33.0 39.0 23.0 40.0 8 34.62075 38.0 33.0 39.0 24.0 40.0 9 34.45025 38.0 33.0 39.0 24.0 40.0 10 34.356 38.0 33.0 39.0 23.0 40.0 11 35.07325 38.0 33.0 39.0 28.0 40.0 12 34.7655 38.0 33.0 39.0 27.0 40.0 13 34.699 38.0 33.0 39.0 26.0 40.0 14 34.87225 38.0 33.0 39.0 27.0 40.0 15 34.87775 38.0 33.0 39.0 27.0 40.0 16 35.03175 38.0 33.0 39.0 28.0 40.0 17 34.82725 38.0 33.0 39.0 28.0 40.0 18 34.719 38.0 33.0 39.0 28.0 40.0 19 34.55075 38.0 33.0 39.0 27.0 40.0 20 34.3685 38.0 33.0 39.0 27.0 40.0 21 34.8815 38.0 34.0 39.0 29.0 40.0 22 34.926 38.0 34.0 39.0 29.0 40.0 23 34.3855 37.0 33.0 38.0 27.0 39.0 24 34.37625 37.0 33.0 38.0 28.0 40.0 25 33.9605 36.0 33.0 38.0 27.0 39.0 26 32.0505 35.0 30.0 38.0 22.0 39.0 27 32.5345 35.0 31.0 38.0 22.0 38.0 28 33.207 36.0 32.0 38.0 24.0 39.0 29 33.61525 37.0 33.0 38.0 25.0 39.0 30 33.471 37.0 33.0 38.0 24.0 39.0 31 33.07975 36.0 32.0 38.0 23.0 39.0 32 32.93275 36.0 32.0 38.0 24.0 39.0 33 33.69825 38.0 33.0 38.0 25.0 39.0 34 34.033 38.0 34.0 39.0 27.0 40.0 35 32.87675 36.0 32.0 38.0 22.0 39.0 36 29.27925 33.0 26.0 36.0 4.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 66.0 5 1.0 6 1.0 7 0.0 8 0.0 9 5.0 10 3.0 11 4.0 12 4.0 13 6.0 14 5.0 15 5.0 16 5.0 17 11.0 18 11.0 19 21.0 20 17.0 21 46.0 22 42.0 23 40.0 24 49.0 25 52.0 26 56.0 27 68.0 28 58.0 29 87.0 30 111.0 31 117.0 32 161.0 33 226.0 34 255.0 35 341.0 36 502.0 37 672.0 38 579.0 39 372.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.175523349436393 22.946859903381643 29.146537842190018 26.73107890499195 2 22.25 29.5 24.275 23.974999999999998 3 24.575 21.825 22.2 31.4 4 26.575 22.825 21.025 29.575000000000003 5 22.75 25.575 27.950000000000003 23.724999999999998 6 29.599999999999998 20.674999999999997 24.099999999999998 25.624999999999996 7 28.825 22.475 25.575 23.125 8 24.025 20.325 29.7 25.95 9 23.925 20.200000000000003 31.525 24.349999999999998 10 31.175000000000004 21.2 21.3 26.325 11 25.650000000000002 28.000000000000004 22.825 23.525 12 26.900000000000002 22.15 26.450000000000003 24.5 13 25.35 21.825 21.525 31.3 14 24.85 22.325 22.375 30.45 15 24.525 21.55 28.449999999999996 25.474999999999998 16 30.975 22.475 22.45 24.099999999999998 17 26.950000000000003 23.275000000000002 23.275000000000002 26.5 18 30.575000000000003 19.8 18.6 31.025000000000002 19 26.900000000000002 32.800000000000004 16.475 23.825 20 30.075000000000003 27.275 21.099999999999998 21.55 21 8.175 11.600000000000001 67.2 13.025 22 0.35000000000000003 0.0 48.975 50.675000000000004 23 50.675000000000004 0.05 0.42500000000000004 48.85 24 49.1 0.3 50.3 0.3 25 0.375 50.5 48.925000000000004 0.2 26 0.35000000000000003 48.699999999999996 50.724999999999994 0.22499999999999998 27 50.74999999999999 0.2 48.725 0.325 28 48.925000000000004 0.0 0.22499999999999998 50.849999999999994 29 0.8750000000000001 0.025 0.075 99.02499999999999 30 50.625 0.0 0.27499999999999997 49.1 31 50.075 0.0 49.375 0.5499999999999999 32 0.525 0.0 48.925000000000004 50.55 33 0.025 0.0 51.075 48.9 34 0.05 0.0 99.425 0.525 35 0.05 0.0 49.85 50.1 36 0.35000000000000003 0.0 51.74999999999999 47.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 2.5 30 4.0 31 4.0 32 7.5 33 11.0 34 11.0 35 34.5 36 58.0 37 58.0 38 87.0 39 116.0 40 179.0 41 242.0 42 242.0 43 302.0 44 362.0 45 362.0 46 429.5 47 497.0 48 497.0 49 503.5 50 510.0 51 635.5 52 761.0 53 761.0 54 628.0 55 495.0 56 495.0 57 447.5 58 400.0 59 400.0 60 332.0 61 264.0 62 264.0 63 213.0 64 162.0 65 112.5 66 63.0 67 63.0 68 50.5 69 38.0 70 38.0 71 25.5 72 13.0 73 13.0 74 7.5 75 2.0 76 1.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.8500000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 36 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.12160307438924 90.275 2 0.4666483667307164 0.8500000000000001 3 0.02744990392533626 0.075 4 0.10979961570134504 0.4 5 0.0 0.0 6 0.0 0.0 7 0.05489980785067252 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.16469942355201758 2.6 >50 0.0 0.0 >100 0.05489980785067252 5.45 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source TACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTC 111 2.775 No Hit TACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCT 107 2.675 No Hit CACGACTCTCGGCAACGGATTCGTATGCCGTCTTCT 36 0.8999999999999999 No Hit GACACGACTCTCGGCAACGGTCGTATGCCGTCTTCT 17 0.42500000000000004 No Hit CGACACGACTCTCGGCAACGGTCGTATGCCGTCTTC 16 0.4 No Hit TCTCATGGAGAGTTCGATCCTTCGTATGCCGTCTTC 15 0.375 No Hit NACCTGGTTGATCCTGCCAGTCGTATGCCGTCTTCT 10 0.25 No Hit GACACGACTCTCGGCAACGGATCGTATGCCGTCTTC 10 0.25 No Hit NACCTGGTTGATCCTGCCAGTTCGTATGCCGTCTTC 7 0.17500000000000002 No Hit NACGACTCTCGGCAACGGATTCGTATGCCGTCTTCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCTGG 30 1.7351325E-5 31.93333 1 GTCTTCT 190 0.0 29.937502 30 CAGTTCG 20 0.0046113636 29.9375 18 CCAGTTC 20 0.0046113636 29.9375 17 CAATCGT 20 0.0046113636 29.9375 19 GCCAGTT 20 0.0046113636 29.9375 16 ATCCTGC 30 2.7468464E-5 29.937498 11 GTTGATC 30 2.7468464E-5 29.937498 7 TGGTTGA 30 2.7468464E-5 29.937498 5 GGTTGAT 30 2.7468464E-5 29.937498 6 CCTGCCA 30 2.7468464E-5 29.937498 13 TGATCCT 30 2.7468464E-5 29.937498 9 CTGGTTG 30 2.7468464E-5 29.937498 4 ACCTGGT 30 2.7468464E-5 29.937498 2 GATCCTG 30 2.7468464E-5 29.937498 10 TGCCAGT 30 2.7468464E-5 29.937498 15 TTGATCC 30 2.7468464E-5 29.937498 8 CTGCCAG 30 2.7468464E-5 29.937498 14 TCCTGCC 30 2.7468464E-5 29.937498 12 CCTGGTT 35 7.8683486E-5 25.660715 3 >>END_MODULE Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459899 spots for SRR1033819.sra Written 1459899 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra Read 1459886 spots for SRR1033819.sra Written 1459886 spots for SRR1033819.sra SRR ids: ['SRR1033819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_inj_l3uc SRR1033819.sra spots: 29197733 blocks: [[1, 1459886], [1459887, 2919772], [2919773, 4379658], [4379659, 5839544], [5839545, 7299430], [7299431, 8759316], [8759317, 10219202], [10219203, 11679088], [11679089, 13138974], [13138975, 14598860], [14598861, 16058746], [16058747, 17518632], [17518633, 18978518], [18978519, 20438404], [20438405, 21898290], [21898291, 23358176], [23358177, 24818062], [24818063, 26277948], [26277949, 27737834], [27737835, 29197733]] SRR1033819 file size 4100142 SRR1033819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1033819 SRR1033819_1.fastq Input file: SRR1033819_1.fastq trimmed: SRR1033819-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 01:11:54 2024 >> started Sat Dec 7 01:12:15 2024 >> done (20.730s) 29197733 reads processed; of these: 104312 ( 0.36%) short reads filtered out after trimming by size control 22103 ( 0.08%) empty reads filtered out after trimming by size control 29071318 (99.57%) reads available; of these: 3209303 (11.04%) trimmed reads available after processing 25862015 (88.96%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 33418 0.11% 19 68382 0.24% 20 158413 0.54% 21 49493 0.17% 22 80253 0.28% 23 205809 0.71% 24 256496 0.88% 25 183082 0.63% 26 2877 0.01% 27 26000 0.09% 28 48591 0.17% 29 112521 0.39% 30 219194 0.75% 31 37082 0.13% 32 3983 0.01% 33 30460 0.10% 34 451636 1.55% 35 1241613 4.27% 36 25862015 88.96% 29071318 reads passed initial QC criterion=sequence-density sequence-density=94.02 sequence-density-rank=1 fanout-score=39.52 fanout-score-rank=1 prefix-density=94.75 prefix-fanout=39.2 sequence=TCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=94.02 sequence-density-rank=1 fanout-score=39.52 fanout-score-rank=1 prefix-density=94.75 prefix-fanout=39.2 sequence=TCGTATGCCGTCTTCTGCTTGA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCGTATGCCGTCTTCTGCTTGA -o SRR1033819 - Input file: STDIN trimmed: SRR1033819-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 01:12:52 2024 >> started Sat Dec 7 01:13:22 2024 >> done (30.541s) 28459290 reads processed; of these: 32646 ( 0.11%) short reads filtered out after trimming by size control 396 ( 0.00%) empty reads filtered out after trimming by size control 28426248 (99.88%) reads available; of these: 27940590 (98.29%) trimmed reads available after processing 485658 ( 1.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 44969 0.16% 19 126255 0.44% 20 14624490 51.45% 21 13415522 47.19% 22 96011 0.34% 23 59067 0.21% 24 18477 0.06% 25 13617 0.05% 26 666 0.00% 27 2880 0.01% 28 1162 0.00% 29 3025 0.01% 30 1640 0.01% 31 316 0.00% 32 160 0.00% 33 348 0.00% 34 1782 0.01% 35 1133 0.00% 36 14728 0.05% criterion=sequence-density sequence-density=6.44 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=23 prefix-density=0.00 prefix-fanout=1.0 sequence=TACCTGGTTGATCCTGCCAGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=51.71 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.9 sequence=GAGCTCAAGGTCAAGGAGCTCAAGAACGGC Started job on | Dec 07 01:13:40 Started mapping on | Dec 07 01:13:41 Finished on | Dec 07 01:14:36 Mapping speed, Million of reads per hour | 1900.69 Number of input reads | 29038276 Average input read length | 20 UNIQUE READS: Uniquely mapped reads number | 23197686 Uniquely mapped reads % | 79.89% Average mapped length | 20.42 Number of splices: Total | 761323 Number of splices: Annotated (sjdb) | 738659 Number of splices: GT/AG | 753211 Number of splices: GC/AG | 7474 Number of splices: AT/AC | 355 Number of splices: Non-canonical | 283 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2392738 % of reads mapped to multiple loci | 8.24% Number of reads mapped to too many loci | 2840322 % of reads mapped to too many loci | 9.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3447852 3447852 3447852 N_multimapping 2392738 2392738 2392738 N_noFeature 827617 1026183 22604517 N_ambiguous 420537 25214 2018 UnstrandedReadsAssigned:21949532 PositiveStrandReadsAssigned:22146289 NegativeStrandReadsAssigned:591151 Dataset is classified positive stranded MeadianReadLen=20 20thPercentileLength=20 echo kmer=19 SRR1033819 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=19 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 19 [index] number of targets: 52,972 [index] number of k-mers: 65,492,969 [index] number of equivalence classes: 320,172 [quant] running in single-end mode [quant] will process file 1: SRR1033819-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,038,276 reads, 22,873,428 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,288 rounds 52973 SRR1033819.ke.tsv 35125 SRR1033819.se.tsv 88098 total ==> SRR1033819.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 7.72307 0.495831 PNS24249 1928 1829 85.1089 2.82317 PNS24246 1044 945 7.72307 0.495831 PNS24248 1044 945 7.72307 0.495831 PNS24244 1471 1372 347.722 15.3764 PNS24243 293 194 0 0 KQK14069 1603 1504 3459.84 139.568 KQK14071 474 375 220.188 35.6237 ==> SRR1033819.se.tsv <== BRADI_1g14170v3 3513 BRADI_1g53295v3 16 BRADI_1g59795v3 11 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 1175 BRADI_1g74790v3 66 BRADI_1g09890v3 40 BRADI_1g77505v3 422 BRADI_1g48960v3 1 SRR1033819 completed mapping pipeline successfully