Starting /dee2/code/volunteer_pipeline.sh SRR10380961 current disk space = 1542257524736 free memory = 1594290476 SRR10380961 SRAfilesize f2f85fdd9390c86dc118bf83da954e8d SRR10380961.sra SRR10380961.sra file validated SRR10380961 is paired end SRR10380961 is conventional basespace SRR10380961 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380961_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72025 34.0 33.0 34.0 31.0 34.0 2 33.049 34.0 34.0 34.0 31.0 34.0 3 33.2745 34.0 34.0 34.0 31.0 34.0 4 36.58775 37.0 37.0 37.0 35.0 37.0 5 36.46125 37.0 37.0 37.0 35.0 37.0 6 36.5055 37.0 37.0 37.0 35.0 37.0 7 36.43325 37.0 37.0 37.0 35.0 37.0 8 36.493 37.0 37.0 37.0 35.0 37.0 9 38.39225 39.0 39.0 39.0 37.0 39.0 10-11 38.429 39.0 39.0 39.0 37.0 39.0 12-13 38.420125 39.0 39.0 39.0 37.0 39.0 14-15 40.094750000000005 41.0 40.0 41.0 38.0 41.0 16-17 40.10525 41.0 40.0 41.0 38.0 41.0 18-19 40.072500000000005 41.0 40.0 41.0 38.0 41.0 20-21 40.035250000000005 41.0 40.0 41.0 38.0 41.0 22-23 39.975875 41.0 40.0 41.0 38.0 41.0 24-25 39.987 41.0 40.0 41.0 38.0 41.0 26-27 39.92400000000001 41.0 40.0 41.0 38.0 41.0 28-29 39.841875 41.0 40.0 41.0 37.0 41.0 30-31 39.71725 41.0 40.0 41.0 37.0 41.0 32-33 39.625 41.0 40.0 41.0 36.0 41.0 34-35 39.526375 41.0 40.0 41.0 36.0 41.0 36-37 39.33625 41.0 39.0 41.0 35.0 41.0 38-39 39.2765 41.0 39.0 41.0 35.0 41.0 40-41 39.094625 41.0 39.0 41.0 35.0 41.0 42-43 38.991875 41.0 38.0 41.0 35.0 41.0 44-45 38.73075 41.0 37.5 41.0 35.0 41.0 46-47 38.638999999999996 41.0 37.0 41.0 35.0 41.0 48-49 38.460499999999996 41.0 36.5 41.0 35.0 41.0 50-51 38.289375 40.5 36.0 41.0 35.0 41.0 52-53 38.073875 40.0 35.0 41.0 35.0 41.0 54-55 37.8435 39.5 35.0 41.0 35.0 41.0 56-57 37.654125 39.0 35.0 41.0 34.0 41.0 58-59 37.35725 39.0 35.0 41.0 34.0 41.0 60-61 37.179625 38.0 35.0 41.0 34.0 41.0 62-63 36.910250000000005 37.0 35.0 41.0 34.0 41.0 64-65 36.56 37.0 35.0 40.0 33.5 41.0 66-67 36.222625 36.0 35.0 39.0 33.0 41.0 68-69 35.9315 35.5 35.0 39.0 33.0 41.0 70-71 35.6255 35.0 35.0 38.5 33.0 41.0 72-73 35.204375 35.0 35.0 37.0 33.0 39.5 74-75 34.802625000000006 35.0 35.0 37.0 33.0 39.0 76-77 34.249875 35.0 35.0 36.0 32.0 39.0 78-79 34.0245 35.0 35.0 36.0 32.0 37.0 80-81 33.8645 35.0 35.0 35.5 32.0 37.0 82-83 33.6355 35.0 35.0 35.0 31.0 36.5 84-85 33.59075 35.0 35.0 35.0 32.0 36.0 86-87 33.495125 35.0 35.0 35.0 32.0 36.0 88-89 33.37075 35.0 35.0 35.0 31.5 36.0 90-91 33.277874999999995 35.0 35.0 35.0 31.0 36.0 92-93 33.170125 35.0 35.0 35.0 31.0 35.0 94-95 33.089 35.0 35.0 35.0 31.0 35.0 96-97 33.03275 35.0 35.0 35.0 31.0 35.0 98-99 32.939499999999995 35.0 35.0 35.0 31.0 35.0 100-101 31.955625 34.5 33.0 35.0 27.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 3.0 10 3.0 11 2.0 12 4.0 13 1.0 14 0.0 15 3.0 16 2.0 17 4.0 18 5.0 19 1.0 20 5.0 21 5.0 22 8.0 23 3.0 24 5.0 25 17.0 26 13.0 27 18.0 28 22.0 29 61.0 30 45.0 31 51.0 32 53.0 33 62.0 34 115.0 35 195.0 36 589.0 37 977.0 38 1379.0 39 347.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.57389537836465 12.468257998984257 11.579481970543423 45.37836465210766 2 26.700000000000003 19.925 27.525 25.85 3 25.5 19.625 23.1 31.775 4 30.225 22.775000000000002 17.150000000000002 29.849999999999998 5 31.715857928964482 26.713356678339167 20.635317658829415 20.935467733866933 6 27.05 30.975 20.200000000000003 21.775 7 23.150000000000002 22.45 31.825 22.575 8 21.6 25.374999999999996 24.85 28.175 9 24.9 21.625 28.499999999999996 24.975 10-11 26.437500000000004 28.5875 20.875 24.099999999999998 12-13 24.3125 24.325 23.9375 27.425 14-15 24.6625 24.6625 23.875 26.8 16-17 26.787499999999998 24.474999999999998 22.5625 26.174999999999997 18-19 25.025 24.575 24.15 26.25 20-21 25.162499999999998 24.5375 24.5 25.8 22-23 25.55 25.7375 23.1125 25.6 24-25 24.675 24.587500000000002 24.0625 26.674999999999997 26-27 23.825 24.275 23.674999999999997 28.225 28-29 26.400000000000002 24.45 22.7 26.450000000000003 30-31 24.5625 24.9125 24.099999999999998 26.424999999999997 32-33 25.25 25.374999999999996 22.8875 26.487500000000004 34-35 27.175 23.974999999999998 22.6375 26.2125 36-37 24.85 24.875 24.837500000000002 25.4375 38-39 25.900000000000002 24.637500000000003 22.7 26.7625 40-41 25.0375 24.975 24.05 25.937500000000004 42-43 25.5 24.349999999999998 24.525 25.624999999999996 44-45 25.05 24.2375 24.8 25.912499999999998 46-47 25.887500000000003 24.125 23.4875 26.5 48-49 25.390673834229275 24.32804100512564 25.278159769971246 25.003125390673837 50-51 26.65666416604151 24.281070267566893 24.256064016004 24.8062015503876 52-53 25.812906453226613 23.774387193596798 23.24912456228114 27.163581790895446 54-55 26.575787893946973 23.699349674837418 23.66183091545773 26.063031515757878 56-57 24.874937468734366 23.81190595297649 24.512256128064035 26.80090045022511 58-59 25.143785946486624 24.356089022255563 24.193548387096776 26.30657664416104 60-61 25.900000000000002 24.775 23.6875 25.637500000000003 62-63 26.0125 23.775 24.425 25.7875 64-65 26.3125 24.3875 24.0125 25.2875 66-67 25.112499999999997 25.900000000000002 23.6875 25.3 68-69 25.650000000000002 24.85 23.625 25.874999999999996 70-71 25.174999999999997 25.162499999999998 22.95 26.7125 72-73 25.074999999999996 25.7625 23.3125 25.85 74-75 25.662499999999998 25.825 24.5125 24.0 76-77 24.6875 25.4625 23.6625 26.187500000000004 78-79 25.137500000000003 24.95 24.0625 25.85 80-81 26.6 24.462500000000002 23.7875 25.15 82-83 25.55 24.375 24.462500000000002 25.6125 84-85 24.75 25.337500000000002 24.025 25.887500000000003 86-87 26.55 24.8125 23.8125 24.825 88-89 26.05 24.5625 24.587500000000002 24.8 90-91 25.525 24.474999999999998 24.6875 25.3125 92-93 25.2625 25.174999999999997 23.6625 25.900000000000002 94-95 26.0 24.2875 23.65 26.0625 96-97 25.7625 24.65 23.7 25.887500000000003 98-99 25.75 24.587500000000002 24.349999999999998 25.3125 100-101 26.1625 24.625 23.0875 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 0.5 27 1.0 28 2.5 29 4.0 30 6.0 31 6.0 32 10.5 33 20.0 34 25.0 35 28.5 36 38.0 37 60.5 38 72.5 39 78.5 40 98.0 41 122.0 42 144.0 43 147.0 44 158.0 45 174.5 46 176.0 47 172.0 48 155.5 49 156.5 50 154.0 51 135.5 52 130.5 53 123.0 54 116.0 55 112.0 56 112.0 57 101.0 58 90.5 59 83.5 60 82.5 61 80.0 62 61.0 63 65.5 64 71.0 65 66.5 66 59.0 67 55.0 68 57.5 69 53.0 70 54.0 71 51.5 72 42.0 73 40.0 74 34.5 75 27.0 76 24.0 77 16.0 78 11.5 79 11.0 80 9.5 81 5.5 82 2.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.025 52-53 0.05 54-55 0.05 56-57 0.05 58-59 0.025 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7963858488165 98.02499999999999 2 0.15271061338763045 0.3 3 0.025451768897938407 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025451768897938407 1.6 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGTAATCTCGTAT 64 1.6 TruSeq Adapter, Index 22 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR10380961 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380961_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2525 34.0 31.0 34.0 31.0 34.0 2 32.38825 34.0 33.0 34.0 31.0 34.0 3 32.47 34.0 33.0 34.0 31.0 34.0 4 35.71775 37.0 37.0 37.0 35.0 37.0 5 35.703 37.0 37.0 37.0 35.0 37.0 6 35.65 37.0 37.0 37.0 35.0 37.0 7 35.6475 37.0 37.0 37.0 35.0 37.0 8 35.67875 37.0 37.0 37.0 35.0 37.0 9 37.4225 39.0 39.0 39.0 37.0 39.0 10-11 37.4805 39.0 39.0 39.0 37.0 39.0 12-13 37.430375 39.0 39.0 39.0 37.0 39.0 14-15 39.067499999999995 41.0 40.0 41.0 37.0 41.0 16-17 39.04175 41.0 40.0 41.0 37.0 41.0 18-19 38.98525 41.0 40.0 41.0 37.0 41.0 20-21 38.972624999999994 41.0 40.0 41.0 37.0 41.0 22-23 38.935874999999996 41.0 40.0 41.0 37.0 41.0 24-25 38.873625000000004 41.0 40.0 41.0 36.0 41.0 26-27 38.838875 41.0 40.0 41.0 36.0 41.0 28-29 38.728875 41.0 40.0 41.0 36.0 41.0 30-31 38.627125 41.0 40.0 41.0 35.0 41.0 32-33 38.544 41.0 40.0 41.0 35.0 41.0 34-35 38.483000000000004 41.0 39.0 41.0 35.0 41.0 36-37 38.320750000000004 41.0 39.0 41.0 35.0 41.0 38-39 38.146375 41.0 39.0 41.0 35.0 41.0 40-41 38.035125 41.0 38.5 41.0 35.0 41.0 42-43 37.9195 41.0 38.0 41.0 34.5 41.0 44-45 37.689125000000004 41.0 37.5 41.0 34.0 41.0 46-47 37.549875 41.0 36.5 41.0 33.5 41.0 48-49 37.35575 41.0 36.0 41.0 33.0 41.0 50-51 37.2085 40.0 35.0 41.0 33.0 41.0 52-53 36.984750000000005 40.0 35.0 41.0 33.0 41.0 54-55 36.771375000000006 39.5 35.0 41.0 33.0 41.0 56-57 36.524125 39.0 35.0 41.0 33.0 41.0 58-59 36.2545 39.0 35.0 41.0 33.0 41.0 60-61 35.982 37.5 35.0 41.0 32.0 41.0 62-63 35.732625 37.0 35.0 41.0 32.0 41.0 64-65 35.486875 36.5 35.0 40.5 32.0 41.0 66-67 35.17125 36.0 35.0 39.5 31.0 41.0 68-69 34.80875 35.5 35.0 39.0 31.0 41.0 70-71 34.4965 35.0 35.0 38.5 31.0 41.0 72-73 34.2795 35.0 35.0 37.0 31.0 39.5 74-75 33.988375000000005 35.0 35.0 37.0 31.0 39.0 76-77 33.76975 35.0 35.0 36.0 31.0 39.0 78-79 33.457875 35.0 35.0 36.0 30.5 37.5 80-81 33.144 35.0 35.0 36.0 29.5 37.0 82-83 32.953 35.0 35.0 35.0 29.5 37.0 84-85 32.845 35.0 35.0 35.0 30.0 36.0 86-87 32.72425 35.0 35.0 35.0 29.5 36.0 88-89 32.618375 35.0 35.0 35.0 29.0 36.0 90-91 32.5105 35.0 35.0 35.0 29.0 36.0 92-93 32.269375 35.0 34.0 35.0 28.0 35.0 94-95 32.290875 35.0 34.0 35.0 29.0 35.0 96-97 32.154625 35.0 34.0 35.0 29.0 35.0 98-99 32.043375 35.0 34.0 35.0 29.0 35.0 100-101 30.941875 34.5 32.5 35.0 22.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 84.0 3 5.0 4 4.0 5 4.0 6 3.0 7 7.0 8 2.0 9 2.0 10 6.0 11 6.0 12 7.0 13 3.0 14 2.0 15 8.0 16 5.0 17 4.0 18 1.0 19 4.0 20 7.0 21 3.0 22 7.0 23 10.0 24 7.0 25 9.0 26 12.0 27 17.0 28 24.0 29 39.0 30 46.0 31 40.0 32 50.0 33 68.0 34 113.0 35 199.0 36 510.0 37 939.0 38 1380.0 39 363.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.207207207207205 12.712712712712712 11.936936936936938 43.14314314314314 2 25.85 18.6 28.125 27.425 3 24.725 19.975 21.9 33.4 4 29.225 23.150000000000002 16.35 31.275 5 32.1 26.125 20.575 21.2 6 28.199999999999996 31.65 20.150000000000002 20.0 7 24.4 21.099999999999998 32.875 21.625 8 22.45 24.275 26.05 27.224999999999998 9 24.474999999999998 20.125 29.2 26.200000000000003 10-11 26.0375 29.4125 21.6625 22.8875 12-13 26.674999999999997 23.025000000000002 24.462500000000002 25.837500000000002 14-15 24.9125 24.1875 24.55 26.35 16-17 26.650000000000002 23.6125 23.549999999999997 26.187500000000004 18-19 26.7625 24.0 23.6125 25.624999999999996 20-21 25.687500000000004 25.15 23.9375 25.224999999999998 22-23 27.700000000000003 23.8375 23.5125 24.95 24-25 25.724999999999998 25.162499999999998 23.2875 25.825 26-27 25.587500000000002 25.5375 23.825 25.05 28-29 26.275 25.224999999999998 23.1875 25.3125 30-31 27.1375 23.8875 24.0375 24.9375 32-33 26.437500000000004 24.2 23.849999999999998 25.5125 34-35 26.1125 25.2875 23.8875 24.712500000000002 36-37 25.650000000000002 23.962500000000002 25.174999999999997 25.2125 38-39 25.387500000000003 24.762500000000003 24.3 25.55 40-41 26.3125 23.2625 23.775 26.650000000000002 42-43 26.5125 24.3875 24.15 24.95 44-45 25.837500000000002 24.712500000000002 23.799999999999997 25.650000000000002 46-47 26.237500000000004 24.65 23.525 25.587500000000002 48-49 24.5125 24.3625 23.5625 27.5625 50-51 26.8 23.125 24.337500000000002 25.7375 52-53 25.624999999999996 24.625 24.0375 25.7125 54-55 25.05 24.675 24.3 25.974999999999998 56-57 24.3625 24.25 25.7875 25.6 58-59 25.112499999999997 25.074999999999996 23.875 25.937500000000004 60-61 24.762500000000003 26.087500000000002 23.6625 25.4875 62-63 25.412499999999998 25.2 24.0625 25.324999999999996 64-65 25.45 24.725 23.5125 26.3125 66-67 25.6 25.2 24.2375 24.962500000000002 68-69 25.912499999999998 25.087500000000002 23.25 25.75 70-71 24.962500000000002 25.7125 24.4125 24.9125 72-73 26.387500000000003 24.3 24.175 25.137500000000003 74-75 24.7 24.8625 24.925 25.5125 76-77 26.0625 25.1875 23.3875 25.362499999999997 78-79 24.9875 24.9375 24.55 25.525 80-81 26.687499999999996 24.2 23.549999999999997 25.5625 82-83 25.4875 24.2 23.9875 26.325 84-85 25.8625 24.887500000000003 24.337500000000002 24.9125 86-87 25.7375 24.3125 23.4375 26.5125 88-89 26.1 24.525 24.125 25.25 90-91 27.175 24.1125 23.674999999999997 25.0375 92-93 26.2625 23.9875 25.112499999999997 24.637500000000003 94-95 26.575 24.1125 24.2625 25.05 96-97 27.0625 23.962500000000002 23.4625 25.5125 98-99 25.8 24.5 24.4125 25.2875 100-101 25.587500000000002 23.925 24.4 26.087500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 0.5 27 1.5 28 3.5 29 4.0 30 6.5 31 10.0 32 10.0 33 11.0 34 20.5 35 31.5 36 35.0 37 51.0 38 70.0 39 86.5 40 106.0 41 121.0 42 143.5 43 158.5 44 144.0 45 152.5 46 173.0 47 167.0 48 175.0 49 176.5 50 156.5 51 144.0 52 135.5 53 131.0 54 133.5 55 120.0 56 98.5 57 88.0 58 85.5 59 84.5 60 79.0 61 72.5 62 70.5 63 61.5 64 57.0 65 67.5 66 70.0 67 66.5 68 59.5 69 49.0 70 51.5 71 45.0 72 32.0 73 34.5 74 34.5 75 25.0 76 20.5 77 18.0 78 14.0 79 9.5 80 5.0 81 4.5 82 4.5 83 3.5 84 2.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0125 0.0 0.0 54-55 0.05 0.0 0.025 0.0 0.0 56-57 0.05 0.0 0.025 0.0 0.0 58-59 0.05 0.0 0.025 0.0 0.0 60-61 0.05 0.0 0.025 0.0 0.0 62-63 0.05 0.0 0.025 0.0 0.0 64-65 0.05 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.05 0.0 0.025 0.0 0.0 72-73 0.1125 0.0 0.025 0.0 0.0 74-75 0.125 0.0 0.025 0.0 0.0 76-77 0.15 0.0 0.025 0.0 0.0 78-79 0.175 0.0 0.025 0.0 0.0 80-81 0.175 0.0 0.025 0.0 0.0 82-83 0.175 0.0 0.025 0.0 0.0 84-85 0.2625 0.0 0.025 0.0 0.0 86-87 0.3375 0.0 0.025 0.0 0.0 88-89 0.4125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921016 spots for SRR10380961.sra Written 921016 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra Read 921001 spots for SRR10380961.sra Written 921001 spots for SRR10380961.sra SRR ids: ['SRR10380961.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vz4ml7uc SRR10380961.sra spots: 18420035 blocks: [[1, 921001], [921002, 1842002], [1842003, 2763003], [2763004, 3684004], [3684005, 4605005], [4605006, 5526006], [5526007, 6447007], [6447008, 7368008], [7368009, 8289009], [8289010, 9210010], [9210011, 10131011], [10131012, 11052012], [11052013, 11973013], [11973014, 12894014], [12894015, 13815015], [13815016, 14736016], [14736017, 15657017], [15657018, 16578018], [16578019, 17499019], [17499020, 18420035]] SRR10380961 file size 5052712 SRR10380961 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380961 SRR10380961_1.fastq SRR10380961_2.fastq Input file: SRR10380961_1.fastq Paired file: SRR10380961_2.fastq trimmed: SRR10380961-trimmed-pair1.fastq, SRR10380961-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:42:32 2024 >> started Sat Dec 7 15:42:51 2024 >> done (18.471s) 18420035 read pairs processed; of these: 65732 ( 0.36%) short read pairs filtered out after trimming by size control 475564 ( 2.58%) empty read pairs filtered out after trimming by size control 17878739 (97.06%) read pairs available; of these: 1608957 ( 9.00%) trimmed read pairs available after processing 16269782 (91.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 121 0.00% 19 124 0.00% 20 149 0.00% 21 163 0.00% 22 211 0.00% 23 271 0.00% 24 287 0.00% 25 333 0.00% 26 390 0.00% 27 379 0.00% 28 467 0.00% 29 532 0.00% 30 602 0.00% 31 668 0.00% 32 723 0.00% 33 801 0.00% 34 839 0.00% 35 948 0.01% 36 1059 0.01% 37 1105 0.01% 38 1174 0.01% 39 1191 0.01% 40 1265 0.01% 41 1330 0.01% 42 1424 0.01% 43 1475 0.01% 44 1457 0.01% 45 1570 0.01% 46 1639 0.01% 47 1730 0.01% 48 1760 0.01% 49 1838 0.01% 50 1927 0.01% 51 2058 0.01% 52 2244 0.01% 53 2306 0.01% 54 2418 0.01% 55 2674 0.01% 56 2805 0.02% 57 3083 0.02% 58 3430 0.02% 59 7073 0.04% 60 11026 0.06% 61 11952 0.07% 62 12783 0.07% 63 13841 0.08% 64 14347 0.08% 65 14893 0.08% 66 15917 0.09% 67 16177 0.09% 68 16782 0.09% 69 17432 0.10% 70 17993 0.10% 71 17810 0.10% 72 18610 0.10% 73 19396 0.11% 74 19645 0.11% 75 19807 0.11% 76 20286 0.11% 77 20350 0.11% 78 21200 0.12% 79 21717 0.12% 80 22310 0.12% 81 22897 0.13% 82 24410 0.14% 83 24671 0.14% 84 25925 0.15% 85 26505 0.15% 86 27829 0.16% 87 29568 0.17% 88 31032 0.17% 89 33682 0.19% 90 36738 0.21% 91 39481 0.22% 92 42984 0.24% 93 49056 0.27% 94 55100 0.31% 95 62864 0.35% 96 78498 0.44% 97 86319 0.48% 98 108918 0.61% 99 142702 0.80% 100 237461 1.33% 101 16269782 91.00% 17878739 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=178.12 fanout-score-rank=13 prefix-density=0.89 prefix-fanout=22.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=344.32 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=22.9 sequence=CGCCGCCGCCGTC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=185.04 fanout-score-rank=11 prefix-density=0.87 prefix-fanout=23.6 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=356.51 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=23.6 sequence=CGCCGCCGCCGT SRR10380961 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:43:21 Started mapping on | Dec 07 15:43:21 Finished on | Dec 07 15:44:54 Mapping speed, Million of reads per hour | 692.08 Number of input reads | 17878739 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 16730854 Uniquely mapped reads % | 93.58% Average mapped length | 198.54 Number of splices: Total | 9010558 Number of splices: Annotated (sjdb) | 8424556 Number of splices: GT/AG | 8878473 Number of splices: GC/AG | 114249 Number of splices: AT/AC | 6124 Number of splices: Non-canonical | 11712 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.01% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192799 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 67141 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 2.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 968810 968810 968810 N_multimapping 192799 192799 192799 N_noFeature 596041 8428651 8523208 N_ambiguous 416620 21821 21481 UnstrandedReadsAssigned:15718193 PositiveStrandReadsAssigned:8280382 NegativeStrandReadsAssigned:8186165 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380961 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380961-trimmed-pair1.fastq SRR10380961-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,878,739 reads, 16,455,907 reads pseudoaligned [quant] estimated average fragment length: 186.659 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR10380961.ke.tsv 35125 SRR10380961.se.tsv 88098 total ==> SRR10380961.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.627 0 0 PNS24247 1044 858.341 69.2864 6.66023 PNS24249 1928 1742.34 181.598 8.59961 PNS24246 1044 858.341 69.2864 6.66023 PNS24248 1044 858.341 69.2864 6.66023 PNS24244 1471 1285.34 188.543 12.103 PNS24243 293 124.19 10 6.64379 KQK14069 1603 1417.34 19236 1119.8 KQK14071 474 292.474 1242.74 350.584 ==> SRR10380961.se.tsv <== BRADI_1g14170v3 21410 BRADI_1g53295v3 96 BRADI_1g59795v3 376 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 771 BRADI_1g74790v3 1135 BRADI_1g09890v3 2 BRADI_1g77505v3 247 BRADI_1g48960v3 0 SRR10380961 completed mapping pipeline successfully