Starting /dee2/code/volunteer_pipeline.sh SRR10380962 current disk space = 1542196555776 free memory = 1603194696 SRR10380962 SRAfilesize 254f5d25c154fd2bf404f2ae30744769 SRR10380962.sra SRR10380962.sra file validated SRR10380962 is paired end SRR10380962 is conventional basespace SRR10380962 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380962_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63825 34.0 33.0 34.0 31.0 34.0 2 33.0395 34.0 34.0 34.0 31.0 34.0 3 33.29575 34.0 34.0 34.0 31.0 34.0 4 36.5895 37.0 37.0 37.0 35.0 37.0 5 36.491 37.0 37.0 37.0 35.0 37.0 6 36.559 37.0 37.0 37.0 35.0 37.0 7 36.44225 37.0 37.0 37.0 35.0 37.0 8 36.51725 37.0 37.0 37.0 35.0 37.0 9 38.4515 39.0 39.0 39.0 37.0 39.0 10-11 38.477000000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.44825 39.0 39.0 39.0 37.0 39.0 14-15 40.113875 41.0 40.0 41.0 38.0 41.0 16-17 40.157375 41.0 40.0 41.0 38.0 41.0 18-19 40.13125 41.0 40.0 41.0 38.0 41.0 20-21 40.0675 41.0 40.0 41.0 38.0 41.0 22-23 40.072374999999994 41.0 40.0 41.0 38.0 41.0 24-25 40.065749999999994 41.0 40.0 41.0 38.0 41.0 26-27 39.95125 41.0 40.0 41.0 38.0 41.0 28-29 39.885999999999996 41.0 40.0 41.0 37.5 41.0 30-31 39.813874999999996 41.0 40.0 41.0 37.0 41.0 32-33 39.713125 41.0 40.0 41.0 36.0 41.0 34-35 39.608000000000004 41.0 40.0 41.0 35.5 41.0 36-37 39.456374999999994 41.0 39.0 41.0 35.0 41.0 38-39 39.2795 41.0 39.0 41.0 35.0 41.0 40-41 39.146625 41.0 39.0 41.0 35.0 41.0 42-43 38.9815 41.0 38.0 41.0 35.0 41.0 44-45 38.754000000000005 41.0 37.5 41.0 35.0 41.0 46-47 38.596875 41.0 37.0 41.0 35.0 41.0 48-49 38.406875 40.5 36.5 41.0 35.0 41.0 50-51 38.262249999999995 40.0 35.5 41.0 35.0 41.0 52-53 38.091625 40.0 35.0 41.0 35.0 41.0 54-55 37.826499999999996 39.5 35.0 41.0 35.0 41.0 56-57 37.578 39.0 35.0 41.0 34.5 41.0 58-59 37.408625 39.0 35.0 41.0 34.0 41.0 60-61 37.133624999999995 37.5 35.0 41.0 34.0 41.0 62-63 36.87075 37.0 35.0 41.0 34.0 41.0 64-65 36.58 36.5 35.0 40.0 34.0 41.0 66-67 36.282375 36.0 35.0 39.0 33.5 41.0 68-69 36.006875 35.5 35.0 39.0 33.0 41.0 70-71 35.727625 35.0 35.0 38.5 33.0 41.0 72-73 35.392 35.0 35.0 37.0 33.0 39.5 74-75 35.032125 35.0 35.0 37.0 33.0 39.0 76-77 34.5325 35.0 35.0 36.0 33.0 39.0 78-79 34.303875 35.0 35.0 36.0 33.0 37.0 80-81 34.134874999999994 35.0 35.0 36.0 33.0 37.0 82-83 34.032125 35.0 35.0 35.0 33.0 36.5 84-85 33.913125 35.0 35.0 35.0 32.0 36.0 86-87 33.763999999999996 35.0 35.0 35.0 32.0 36.0 88-89 33.657 35.0 35.0 35.0 32.0 36.0 90-91 33.62675 35.0 35.0 35.0 32.0 35.5 92-93 33.428875000000005 35.0 35.0 35.0 31.5 35.0 94-95 33.358999999999995 35.0 35.0 35.0 31.5 35.0 96-97 33.277125 35.0 35.0 35.0 31.0 35.0 98-99 33.15925 35.0 35.0 35.0 31.0 35.0 100-101 32.238875 34.5 33.0 35.0 28.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 2.0 12 2.0 13 1.0 14 0.0 15 5.0 16 4.0 17 2.0 18 2.0 19 4.0 20 0.0 21 5.0 22 4.0 23 7.0 24 5.0 25 10.0 26 16.0 27 12.0 28 18.0 29 70.0 30 33.0 31 33.0 32 49.0 33 63.0 34 107.0 35 204.0 36 614.0 37 1035.0 38 1361.0 39 327.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.573904179408764 12.46177370030581 13.404689092762487 46.559633027522935 2 25.775 18.975 27.55 27.700000000000003 3 27.500000000000004 19.2 20.974999999999998 32.324999999999996 4 30.475 21.825 16.975 30.725 5 32.275 26.05 19.125 22.55 6 27.425 31.6 19.0 21.975 7 23.275000000000002 21.575 32.6 22.55 8 23.974999999999998 25.074999999999996 24.4 26.55 9 25.35 21.125 27.825 25.7 10-11 26.525 29.299999999999997 21.0 23.175 12-13 24.9375 23.6125 24.325 27.125 14-15 24.75 25.0 23.9875 26.2625 16-17 26.3125 24.75 23.150000000000002 25.7875 18-19 24.887500000000003 24.8125 23.8125 26.487500000000004 20-21 25.724999999999998 24.95 24.1125 25.2125 22-23 24.462500000000002 25.7875 23.025000000000002 26.724999999999998 24-25 25.053131641455185 24.278034754344294 23.91548943617952 26.753344168021005 26-27 25.653206650831358 24.928116014501814 23.49043630453807 25.928241030128767 28-29 25.968992248062015 24.44361090272568 22.99324831207802 26.59414853713428 30-31 24.54056757094637 24.128016002000248 24.590573821727716 26.740842605325664 32-33 25.243810952738183 24.431107776944234 24.218554638659665 26.106526631657918 34-35 26.244061015253813 23.068267066766694 24.568642160540136 26.11902975743936 36-37 25.678209776222026 23.940492561570196 24.1780222527816 26.20327540942618 38-39 25.997248968363134 24.334125296986368 22.77103913967738 26.897586594973117 40-41 25.52526263131566 24.987493746873437 23.13656828414207 26.350675337668832 42-43 25.7503751875938 23.88694347173587 23.986993496748372 26.375687843921963 44-45 25.900450225112557 24.074537268634316 24.287143571785894 25.737868934467233 46-47 26.43821910955478 24.287143571785894 23.074037018509255 26.20060030015007 48-49 26.182136602451838 24.956217162872154 23.655241431073303 25.2064048036027 50-51 25.472288252220693 24.496434380082572 24.10859502064306 25.922682347053673 52-53 26.145755071374904 23.61632857500626 24.267468069120962 25.97044828449787 54-55 26.305246024790286 23.751095530236636 24.126705897082758 25.81695254789032 56-57 26.064096144216325 24.386579869804706 24.036054081121684 25.51326990485729 58-59 25.325325325325327 24.474474474474476 23.51101101101101 26.68918918918919 60-61 25.15007503751876 24.862431215607803 24.449724862431214 25.53776888444222 62-63 25.347005126922596 25.109416031011627 23.28373139927473 26.259847442791045 64-65 26.174999999999997 24.2 23.65 25.974999999999998 66-67 25.25 25.2125 23.9125 25.624999999999996 68-69 26.087500000000002 25.224999999999998 23.225 25.4625 70-71 25.8 25.275 23.2625 25.662499999999998 72-73 25.374999999999996 25.8 22.45 26.375 74-75 26.2875 25.374999999999996 23.3125 25.025 76-77 25.05 25.374999999999996 23.2875 26.2875 78-79 25.528191023877984 24.440555069383674 24.50306288286036 25.528191023877984 80-81 25.390673834229275 24.878109763720467 23.940492561570196 25.790723840480062 82-83 26.5 24.212500000000002 23.65 25.637500000000003 84-85 25.7875 24.6 24.4125 25.2 86-87 26.25 24.15 24.224999999999998 25.374999999999996 88-89 26.387500000000003 24.9375 22.975 25.7 90-91 25.374999999999996 24.762500000000003 23.175 26.687499999999996 92-93 26.325 24.7875 23.6625 25.224999999999998 94-95 27.3625 23.6625 23.474999999999998 25.5 96-97 26.1625 24.25 23.65 25.937500000000004 98-99 26.75 24.95 23.1875 25.112499999999997 100-101 25.775 24.425 24.0 25.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 2.0 29 5.0 30 8.0 31 8.5 32 8.0 33 9.0 34 16.5 35 27.5 36 45.0 37 59.0 38 69.0 39 85.0 40 102.5 41 122.0 42 134.5 43 145.5 44 175.5 45 177.0 46 154.5 47 150.0 48 153.5 49 161.0 50 156.0 51 138.5 52 120.0 53 116.5 54 117.0 55 114.0 56 112.0 57 109.0 58 99.0 59 86.5 60 83.5 61 76.5 62 69.5 63 70.0 64 71.5 65 64.0 66 60.0 67 65.0 68 64.5 69 54.5 70 51.5 71 49.5 72 39.0 73 38.0 74 31.0 75 22.0 76 21.0 77 20.5 78 15.5 79 14.5 80 11.0 81 4.0 82 4.5 83 4.0 84 3.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0125 28-29 0.025 30-31 0.0125 32-33 0.025 34-35 0.025 36-37 0.0125 38-39 0.0375 40-41 0.05 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.075 50-51 0.08750000000000001 52-53 0.17500000000000002 54-55 0.1625 56-57 0.15 58-59 0.1 60-61 0.05 62-63 0.0375 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77197871801367 98.45 2 0.20268558398783887 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02533569799847986 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGGAATCTCGTAT 46 1.15 TruSeq Adapter, Index 21 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR10380962 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380962_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37325 34.0 31.0 34.0 31.0 34.0 2 32.526 34.0 33.0 34.0 31.0 34.0 3 32.54325 34.0 33.0 34.0 31.0 34.0 4 35.8255 37.0 37.0 37.0 35.0 37.0 5 35.806 37.0 37.0 37.0 35.0 37.0 6 35.771 37.0 37.0 37.0 35.0 37.0 7 35.74025 37.0 37.0 37.0 35.0 37.0 8 35.75825 37.0 37.0 37.0 35.0 37.0 9 37.627 39.0 39.0 39.0 37.0 39.0 10-11 37.64275 39.0 39.0 39.0 37.0 39.0 12-13 37.603375 39.0 39.0 39.0 37.0 39.0 14-15 39.193 41.0 40.0 41.0 37.5 41.0 16-17 39.232124999999996 41.0 40.0 41.0 37.5 41.0 18-19 39.172375 41.0 40.0 41.0 37.5 41.0 20-21 39.136250000000004 41.0 40.0 41.0 37.5 41.0 22-23 39.15075 41.0 40.0 41.0 37.5 41.0 24-25 39.042375 41.0 40.0 41.0 37.0 41.0 26-27 39.026375 41.0 40.0 41.0 37.0 41.0 28-29 38.904624999999996 41.0 40.0 41.0 36.0 41.0 30-31 38.764875 41.0 40.0 41.0 35.0 41.0 32-33 38.716 41.0 40.0 41.0 35.0 41.0 34-35 38.59975 41.0 39.5 41.0 35.0 41.0 36-37 38.467375 41.0 39.0 41.0 35.0 41.0 38-39 38.3105 41.0 39.0 41.0 35.0 41.0 40-41 38.177375 41.0 38.5 41.0 35.0 41.0 42-43 38.011125 41.0 38.0 41.0 34.5 41.0 44-45 37.850625 41.0 37.0 41.0 34.5 41.0 46-47 37.6525 41.0 37.0 41.0 34.0 41.0 48-49 37.514624999999995 40.0 36.0 41.0 34.0 41.0 50-51 37.324625 40.0 35.0 41.0 34.0 41.0 52-53 37.079625 40.0 35.0 41.0 33.0 41.0 54-55 36.864375 39.5 35.0 41.0 33.0 41.0 56-57 36.619375 39.0 35.0 41.0 33.0 41.0 58-59 36.31725 38.5 35.0 41.0 32.5 41.0 60-61 36.077124999999995 37.5 35.0 41.0 33.0 41.0 62-63 35.828374999999994 37.0 35.0 41.0 33.0 41.0 64-65 35.464125 36.0 35.0 40.0 32.0 41.0 66-67 35.198125 36.0 35.0 39.0 32.0 41.0 68-69 34.851875 35.0 35.0 39.0 32.0 41.0 70-71 34.509125 35.0 35.0 38.0 31.5 40.5 72-73 34.2575 35.0 35.0 37.0 31.0 39.5 74-75 33.938 35.0 35.0 36.5 31.0 39.0 76-77 33.6795 35.0 35.0 36.0 31.0 38.5 78-79 33.474875 35.0 35.0 36.0 31.0 37.0 80-81 33.251625000000004 35.0 35.0 35.5 30.5 37.0 82-83 33.131875 35.0 35.0 35.0 31.0 36.5 84-85 33.038250000000005 35.0 35.0 35.0 30.5 36.0 86-87 32.858125 35.0 35.0 35.0 30.0 36.0 88-89 32.757625000000004 35.0 35.0 35.0 30.0 36.0 90-91 32.663 35.0 34.5 35.0 30.0 35.5 92-93 32.562875 35.0 34.0 35.0 29.5 35.0 94-95 32.503125 35.0 35.0 35.0 29.5 35.0 96-97 32.399375 35.0 34.0 35.0 29.0 35.0 98-99 32.271875 35.0 34.0 35.0 29.0 35.0 100-101 31.261250000000004 34.5 32.5 35.0 24.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 74.0 3 4.0 4 2.0 5 4.0 6 4.0 7 4.0 8 2.0 9 3.0 10 5.0 11 3.0 12 5.0 13 4.0 14 7.0 15 2.0 16 7.0 17 5.0 18 4.0 19 5.0 20 4.0 21 7.0 22 4.0 23 9.0 24 13.0 25 12.0 26 17.0 27 18.0 28 19.0 29 23.0 30 30.0 31 27.0 32 45.0 33 62.0 34 124.0 35 218.0 36 550.0 37 1001.0 38 1363.0 39 310.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.275 12.6 12.675 46.45 2 25.624999999999996 19.400000000000002 26.650000000000002 28.325 3 26.150000000000002 18.65 21.525 33.675 4 29.775000000000002 21.775 17.825 30.625000000000004 5 30.775000000000002 25.775 20.125 23.325000000000003 6 28.15 31.05 19.325 21.475 7 23.150000000000002 21.675 32.1 23.075000000000003 8 22.45 25.25 25.650000000000002 26.650000000000002 9 24.575 21.825 28.625 24.975 10-11 26.825 28.125 21.1875 23.8625 12-13 26.325 23.6875 24.2375 25.75 14-15 25.0125 24.3125 24.087500000000002 26.5875 16-17 26.200000000000003 24.5125 23.1375 26.150000000000002 18-19 25.8625 24.1125 23.45 26.575 20-21 25.9875 24.675 23.8125 25.525 22-23 26.5125 24.3875 23.025000000000002 26.075 24-25 26.2875 25.55 22.6875 25.474999999999998 26-27 26.1 25.174999999999997 23.5 25.224999999999998 28-29 26.237500000000004 25.4375 22.2125 26.1125 30-31 25.5625 23.75 23.325000000000003 27.3625 32-33 25.674999999999997 25.724999999999998 23.1625 25.4375 34-35 26.3625 24.3625 23.150000000000002 26.125 36-37 25.4375 24.712500000000002 23.400000000000002 26.450000000000003 38-39 25.525 24.45 23.6875 26.337500000000002 40-41 26.6625 24.025 22.8 26.5125 42-43 26.825 24.6125 23.025000000000002 25.5375 44-45 26.875 24.65 23.425 25.05 46-47 26.387500000000003 22.675 24.349999999999998 26.5875 48-49 25.45 23.7625 22.7 28.0875 50-51 25.7 24.637500000000003 23.0 26.6625 52-53 25.112499999999997 24.65 24.1875 26.05 54-55 24.462500000000002 25.1875 23.6125 26.737499999999997 56-57 24.962500000000002 24.3125 24.675 26.05 58-59 25.575 24.2625 23.7625 26.400000000000002 60-61 24.025 25.7375 23.0375 27.200000000000003 62-63 26.137500000000003 25.124999999999996 22.775000000000002 25.9625 64-65 25.9625 24.7875 23.175 26.075 66-67 24.925 24.837500000000002 23.1375 27.1 68-69 25.724999999999998 25.3125 23.525 25.4375 70-71 25.937500000000004 24.425 23.674999999999997 25.9625 72-73 25.15 24.462500000000002 23.674999999999997 26.7125 74-75 26.337500000000002 24.0375 23.474999999999998 26.150000000000002 76-77 25.7125 24.837500000000002 24.1875 25.2625 78-79 26.075 24.5375 23.8375 25.55 80-81 25.575 24.325 24.275 25.825 82-83 26.087500000000002 24.6625 23.075000000000003 26.174999999999997 84-85 25.624999999999996 23.925 24.575 25.874999999999996 86-87 25.7125 25.5 23.6125 25.174999999999997 88-89 26.5625 23.5 24.075 25.8625 90-91 26.5375 24.1375 23.775 25.55 92-93 27.187499999999996 24.462500000000002 23.4875 24.8625 94-95 26.700000000000003 24.6 23.175 25.525 96-97 26.35 24.4125 23.4375 25.8 98-99 25.8125 23.8125 25.224999999999998 25.15 100-101 26.35 24.2875 22.3875 26.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.0 27 2.0 28 3.0 29 4.5 30 3.5 31 2.5 32 4.0 33 14.5 34 22.5 35 28.0 36 39.5 37 44.5 38 64.5 39 82.5 40 97.0 41 108.0 42 124.0 43 142.0 44 150.0 45 167.0 46 167.0 47 159.5 48 150.5 49 152.5 50 164.0 51 153.0 52 140.5 53 131.0 54 122.0 55 121.5 56 114.5 57 96.5 58 94.0 59 103.5 60 93.5 61 84.0 62 78.5 63 65.5 64 59.0 65 65.0 66 68.5 67 68.0 68 69.5 69 61.5 70 52.0 71 49.0 72 40.0 73 31.0 74 27.0 75 24.0 76 20.0 77 15.0 78 12.5 79 8.0 80 6.5 81 8.0 82 3.5 83 3.0 84 3.5 85 1.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884042 spots for SRR10380962.sra Written 884042 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra Read 884035 spots for SRR10380962.sra Written 884035 spots for SRR10380962.sra SRR ids: ['SRR10380962.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_no_dmezx SRR10380962.sra spots: 17680707 blocks: [[1, 884035], [884036, 1768070], [1768071, 2652105], [2652106, 3536140], [3536141, 4420175], [4420176, 5304210], [5304211, 6188245], [6188246, 7072280], [7072281, 7956315], [7956316, 8840350], [8840351, 9724385], [9724386, 10608420], [10608421, 11492455], [11492456, 12376490], [12376491, 13260525], [13260526, 14144560], [14144561, 15028595], [15028596, 15912630], [15912631, 16796665], [16796666, 17680707]] SRR10380962 file size 4849480 SRR10380962 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380962 SRR10380962_1.fastq SRR10380962_2.fastq Input file: SRR10380962_1.fastq Paired file: SRR10380962_2.fastq trimmed: SRR10380962-trimmed-pair1.fastq, SRR10380962-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:46:11 2024 >> started Sat Dec 7 15:46:35 2024 >> done (24.640s) 17680707 read pairs processed; of these: 70308 ( 0.40%) short read pairs filtered out after trimming by size control 314058 ( 1.78%) empty read pairs filtered out after trimming by size control 17296341 (97.83%) read pairs available; of these: 1741135 (10.07%) trimmed read pairs available after processing 15555206 (89.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 130 0.00% 19 163 0.00% 20 163 0.00% 21 186 0.00% 22 213 0.00% 23 236 0.00% 24 271 0.00% 25 305 0.00% 26 338 0.00% 27 409 0.00% 28 440 0.00% 29 497 0.00% 30 538 0.00% 31 663 0.00% 32 676 0.00% 33 735 0.00% 34 782 0.00% 35 850 0.00% 36 925 0.01% 37 970 0.01% 38 1056 0.01% 39 1097 0.01% 40 1198 0.01% 41 1269 0.01% 42 1343 0.01% 43 1354 0.01% 44 1402 0.01% 45 1503 0.01% 46 1510 0.01% 47 1623 0.01% 48 1707 0.01% 49 1765 0.01% 50 1819 0.01% 51 1971 0.01% 52 2015 0.01% 53 2337 0.01% 54 2368 0.01% 55 2596 0.02% 56 2835 0.02% 57 3114 0.02% 58 3385 0.02% 59 7451 0.04% 60 11397 0.07% 61 12291 0.07% 62 13033 0.08% 63 14440 0.08% 64 14727 0.09% 65 15761 0.09% 66 16826 0.10% 67 16812 0.10% 68 17624 0.10% 69 18206 0.11% 70 18985 0.11% 71 18645 0.11% 72 19455 0.11% 73 20772 0.12% 74 20668 0.12% 75 21028 0.12% 76 21137 0.12% 77 21570 0.12% 78 22972 0.13% 79 23220 0.13% 80 24035 0.14% 81 25224 0.15% 82 26551 0.15% 83 27812 0.16% 84 28978 0.17% 85 30180 0.17% 86 31677 0.18% 87 33744 0.20% 88 35446 0.20% 89 38515 0.22% 90 41971 0.24% 91 45190 0.26% 92 50121 0.29% 93 56964 0.33% 94 63806 0.37% 95 72369 0.42% 96 87296 0.50% 97 95320 0.55% 98 117639 0.68% 99 149961 0.87% 100 242559 1.40% 101 15555206 89.93% 17296341 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=160.16 fanout-score-rank=14 prefix-density=0.91 prefix-fanout=22.0 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=337.30 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=22.0 sequence=CGCCGCCGCCGTC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=160.87 fanout-score-rank=14 prefix-density=0.91 prefix-fanout=22.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=359.07 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=23.0 sequence=CCGCCGCCGCCTCC SRR10380962 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:47:13 Started mapping on | Dec 07 15:47:13 Finished on | Dec 07 15:49:09 Mapping speed, Million of reads per hour | 536.78 Number of input reads | 17296341 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 15751022 Uniquely mapped reads % | 91.07% Average mapped length | 198.39 Number of splices: Total | 8326081 Number of splices: Annotated (sjdb) | 7774067 Number of splices: GT/AG | 8204834 Number of splices: GC/AG | 104841 Number of splices: AT/AC | 5776 Number of splices: Non-canonical | 10630 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.01% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181451 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 123810 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 3.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1376475 1376475 1376475 N_multimapping 181451 181451 181451 N_noFeature 516969 7942640 7984421 N_ambiguous 379022 19882 19879 UnstrandedReadsAssigned:14855031 PositiveStrandReadsAssigned:7788500 NegativeStrandReadsAssigned:7746722 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380962 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380962-trimmed-pair1.fastq SRR10380962-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,296,341 reads, 15,593,517 reads pseudoaligned [quant] estimated average fragment length: 193.842 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 SRR10380962.ke.tsv 35125 SRR10380962.se.tsv 88098 total ==> SRR10380962.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 743.37 1.03612e-08 1.19678e-09 PNS24247 1044 851.158 51.9245 5.2381 PNS24249 1928 1735.16 147.515 7.29975 PNS24246 1044 851.158 51.9245 5.2381 PNS24248 1044 851.158 51.9245 5.2381 PNS24244 1471 1278.16 226.712 15.23 PNS24243 293 121.978 13 9.15109 KQK14069 1603 1410.16 11532.3 702.201 KQK14071 474 286.239 756.513 226.934 ==> SRR10380962.se.tsv <== BRADI_1g14170v3 13098 BRADI_1g53295v3 77 BRADI_1g59795v3 332 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 678 BRADI_1g74790v3 962 BRADI_1g09890v3 1 BRADI_1g77505v3 254 BRADI_1g48960v3 0 SRR10380962 completed mapping pipeline successfully