Starting /dee2/code/volunteer_pipeline.sh SRR10380963 current disk space = 1542185545728 free memory = 1604285100 SRR10380963 SRAfilesize b1feec7119ceb2a4f664cea69aa00c9e SRR10380963.sra SRR10380963.sra file validated SRR10380963 is paired end SRR10380963 is conventional basespace SRR10380963 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380963_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60925 34.0 33.0 34.0 31.0 34.0 2 32.98725 34.0 34.0 34.0 31.0 34.0 3 33.22625 34.0 34.0 34.0 31.0 34.0 4 36.5705 37.0 37.0 37.0 35.0 37.0 5 36.49025 37.0 37.0 37.0 35.0 37.0 6 36.52525 37.0 37.0 37.0 35.0 37.0 7 36.42875 37.0 37.0 37.0 35.0 37.0 8 36.4995 37.0 37.0 37.0 35.0 37.0 9 38.413 39.0 39.0 39.0 37.0 39.0 10-11 38.4375 39.0 39.0 39.0 37.0 39.0 12-13 38.436875 39.0 39.0 39.0 37.0 39.0 14-15 40.1005 41.0 40.0 41.0 38.0 41.0 16-17 40.146625 41.0 40.0 41.0 38.0 41.0 18-19 40.060874999999996 41.0 40.0 41.0 38.0 41.0 20-21 40.025625000000005 41.0 40.0 41.0 38.0 41.0 22-23 40.026875000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.991749999999996 41.0 40.0 41.0 38.0 41.0 26-27 39.914375 41.0 40.0 41.0 38.0 41.0 28-29 39.817625 41.0 40.0 41.0 37.0 41.0 30-31 39.65975 41.0 40.0 41.0 37.0 41.0 32-33 39.622625 41.0 40.0 41.0 36.0 41.0 34-35 39.4845 41.0 39.5 41.0 35.5 41.0 36-37 39.326 41.0 39.0 41.0 35.0 41.0 38-39 39.24625 41.0 39.0 41.0 35.0 41.0 40-41 39.119625 41.0 38.5 41.0 35.0 41.0 42-43 38.881625 41.0 38.0 41.0 35.0 41.0 44-45 38.508250000000004 41.0 37.0 41.0 35.0 41.0 46-47 38.565124999999995 41.0 37.0 41.0 35.0 41.0 48-49 38.31625 40.0 36.0 41.0 35.0 41.0 50-51 38.237625 40.0 35.5 41.0 35.0 41.0 52-53 37.995625000000004 40.0 35.0 41.0 35.0 41.0 54-55 37.634625 39.0 35.0 41.0 34.5 41.0 56-57 37.484125 39.0 35.0 41.0 34.0 41.0 58-59 37.231625 38.5 35.0 41.0 34.0 41.0 60-61 36.925875000000005 37.0 35.0 41.0 33.0 41.0 62-63 36.7665 37.0 35.0 40.5 34.0 41.0 64-65 36.476124999999996 36.5 35.0 39.5 33.5 41.0 66-67 36.05 36.0 35.0 39.0 33.0 41.0 68-69 35.79025 35.0 35.0 39.0 33.0 41.0 70-71 35.361000000000004 35.0 35.0 37.5 33.0 40.5 72-73 34.958 35.0 35.0 37.0 33.0 39.0 74-75 34.076625 35.0 35.0 36.5 31.5 39.0 76-77 32.873000000000005 35.0 35.0 36.0 29.0 39.0 78-79 32.654875000000004 35.0 35.0 36.0 27.5 37.0 80-81 32.534375 35.0 35.0 35.0 28.5 37.0 82-83 32.40325 35.0 35.0 35.0 29.0 36.5 84-85 32.28375 35.0 35.0 35.0 29.0 36.0 86-87 32.17775 35.0 34.0 35.0 29.0 36.0 88-89 32.0535 35.0 34.0 35.0 27.0 36.0 90-91 32.02275 35.0 34.0 35.0 27.0 35.5 92-93 31.932499999999997 35.0 34.0 35.0 27.0 35.0 94-95 31.791625 35.0 34.0 35.0 26.5 35.0 96-97 31.747625 35.0 34.0 35.0 26.0 35.0 98-99 31.660125 35.0 34.0 35.0 26.0 35.0 100-101 30.722125 34.5 32.5 35.0 21.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 3.0 11 1.0 12 1.0 13 2.0 14 3.0 15 3.0 16 5.0 17 1.0 18 4.0 19 3.0 20 4.0 21 9.0 22 10.0 23 10.0 24 10.0 25 18.0 26 21.0 27 34.0 28 49.0 29 149.0 30 44.0 31 47.0 32 50.0 33 73.0 34 105.0 35 211.0 36 592.0 37 991.0 38 1241.0 39 304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.58883507519755 12.796329339790976 11.929645679327045 44.685189905684425 2 25.124999999999996 22.8 25.1 26.974999999999998 3 25.025 17.7 26.375 30.9 4 27.875 20.7 16.6 34.825 5 37.5 23.5 18.224999999999998 20.775 6 31.324999999999996 28.749999999999996 18.825 21.099999999999998 7 22.6 26.275 31.1 20.025000000000002 8 22.45 28.375 24.075 25.1 9 28.749999999999996 20.549999999999997 25.85 24.85 10-11 27.8625 29.1875 19.35 23.599999999999998 12-13 23.9125 25.324999999999996 22.2 28.5625 14-15 24.3 26.8125 21.6125 27.275 16-17 27.487499999999997 23.3625 20.674999999999997 28.475 18-19 25.1875 22.6875 24.587500000000002 27.537499999999998 20-21 27.737499999999997 23.075000000000003 25.362499999999997 23.825 22-23 24.3125 29.1375 21.8125 24.7375 24-25 24.315539442430303 22.552819102387797 25.29066133266658 27.84098012251531 26-27 23.627953494186773 24.20302537817227 21.865233154144267 30.30378797349669 28-29 27.33183295823956 25.756439109777446 21.66791697924481 25.243810952738183 30-31 24.090511313914238 23.32791598949869 24.715589448681087 27.86598324790599 32-33 24.5311327831958 26.63165791447862 21.880470117529384 26.9567391847962 34-35 27.969492373093274 23.055763940985248 24.456114028507127 24.518629657414355 36-37 30.141267658457306 22.677834729341168 22.015251906488313 25.165645705713214 38-39 24.168542135533883 24.18104526131533 22.20555138784696 29.444861215303824 40-41 24.293573393348336 22.980745186296573 27.506876719179797 25.218804701175294 42-43 24.474737368684345 26.21310655327664 24.6248124062031 24.68734367183592 44-45 24.574787393696848 21.635817908954476 27.213606803401703 26.575787893946973 46-47 27.060147555333252 22.858571964486682 22.145804676753784 27.935475803426286 48-49 24.159059647367762 25.1219207202701 25.62210829060898 25.09691134175316 50-51 27.43650694357563 23.282872513449266 25.522332040535467 23.758288502439633 52-53 25.269221136989735 21.92587027297771 22.163786626596544 30.641121963436014 54-55 27.98848416572788 22.430842408311428 25.059456753035427 24.521216672925274 56-57 23.44180225281602 23.11639549436796 26.107634543178975 27.334167709637047 58-59 25.03751875937969 22.461230615307652 25.312656328164078 27.188594297148573 60-61 27.788894447223612 22.736368184092047 25.100050025012504 24.374687343671837 62-63 23.068267066766694 23.218304576144035 25.51887971992998 28.19454863715929 64-65 27.537499999999998 22.675 25.5625 24.224999999999998 66-67 25.087500000000002 28.7375 21.825 24.349999999999998 68-69 24.3875 29.45 21.425 24.7375 70-71 25.374999999999996 27.8125 21.6625 25.15 72-73 24.425 28.6625 22.8625 24.05 74-75 23.5875 28.875 23.3 24.2375 76-77 25.85 26.9625 21.987499999999997 25.2 78-79 23.97799724965621 27.128391048881113 23.265408176022003 25.62820352544068 80-81 25.9407425928241 26.090761345168147 22.715339417427177 25.25315664458057 82-83 25.95 25.9625 22.7125 25.374999999999996 84-85 26.6 25.5625 22.2125 25.624999999999996 86-87 26.674999999999997 26.325 22.075 24.925 88-89 26.275 25.687500000000004 23.0125 25.025 90-91 26.450000000000003 24.9125 23.525 25.112499999999997 92-93 26.387500000000003 24.275 23.9 25.4375 94-95 25.9625 26.375 22.725 24.9375 96-97 26.3625 24.875 23.2125 25.55 98-99 25.7625 25.8125 22.925 25.5 100-101 26.950000000000003 24.7375 23.025000000000002 25.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.0 28 2.0 29 3.5 30 4.0 31 6.0 32 10.5 33 18.0 34 22.0 35 28.0 36 37.5 37 51.0 38 63.5 39 79.5 40 106.5 41 122.5 42 131.0 43 146.5 44 152.0 45 166.5 46 177.5 47 173.0 48 177.5 49 170.5 50 153.0 51 132.0 52 133.5 53 125.0 54 98.5 55 106.0 56 101.0 57 93.5 58 101.5 59 96.0 60 93.5 61 82.5 62 65.0 63 57.0 64 62.0 65 72.5 66 78.5 67 73.5 68 58.5 69 51.0 70 56.0 71 55.0 72 45.0 73 37.0 74 31.0 75 22.5 76 18.0 77 16.0 78 12.5 79 9.5 80 3.5 81 2.0 82 2.5 83 3.0 84 1.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0125 28-29 0.025 30-31 0.0125 32-33 0.025 34-35 0.025 36-37 0.0125 38-39 0.025 40-41 0.025 42-43 0.05 44-45 0.05 46-47 0.0375 48-49 0.0375 50-51 0.08750000000000001 52-53 0.17500000000000002 54-55 0.13749999999999998 56-57 0.125 58-59 0.05 60-61 0.05 62-63 0.025 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 99.81353223228557 93.675 2 0.13319126265316997 0.25 3 0.0 0.0 4 0.0 0.0 5 0.02663825253063399 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.02663825253063399 5.949999999999999 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTAT 238 5.949999999999999 TruSeq Adapter, Index 20 (97% over 44bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTA 5 0.125 TruSeq Adapter, Index 20 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.16249999999999998 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.1875 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.2375 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.3 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3125 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.3625 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.3875 0.0 0.0 0.0 0.0 66-67 0.42500000000000004 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.625 0.0 0.0 0.0 0.0 74-75 0.8625 0.0 0.0 0.0 0.0 76-77 1.15 0.0 0.0 0.0 0.0 78-79 1.425 0.0 0.0 0.0 0.0 80-81 1.7875 0.0 0.0 0.0 0.0 82-83 2.25 0.0 0.0 0.0 0.0 84-85 2.7 0.0 0.0 0.0 0.0 86-87 3.25 0.0 0.0 0.0 0.0 88-89 3.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCTCG 15 0.00997274 47.481247 40-41 >>END_MODULE SRR10380963 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380963_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.82625 34.0 31.0 34.0 30.0 34.0 2 30.9675 34.0 31.0 34.0 30.0 34.0 3 31.09425 34.0 33.0 34.0 30.0 34.0 4 34.122 37.0 37.0 37.0 33.0 37.0 5 34.1355 37.0 37.0 37.0 33.0 37.0 6 34.10775 37.0 37.0 37.0 33.0 37.0 7 34.09425 37.0 37.0 37.0 33.0 37.0 8 34.114 37.0 37.0 37.0 33.0 37.0 9 35.89 39.0 39.0 39.0 34.0 39.0 10-11 35.87325 39.0 39.0 39.0 33.0 39.0 12-13 35.826875 39.0 39.0 39.0 33.0 39.0 14-15 37.44199999999999 41.0 40.0 41.0 33.5 41.0 16-17 37.399625 41.0 40.0 41.0 33.0 41.0 18-19 37.34775 41.0 40.0 41.0 33.0 41.0 20-21 37.357 41.0 40.0 41.0 33.5 41.0 22-23 37.27875 41.0 40.0 41.0 32.5 41.0 24-25 37.286249999999995 41.0 40.0 41.0 33.0 41.0 26-27 37.192625 41.0 40.0 41.0 32.5 41.0 28-29 37.086375000000004 41.0 39.0 41.0 32.0 41.0 30-31 36.958125 41.0 39.0 41.0 31.5 41.0 32-33 36.8685 41.0 39.0 41.0 31.0 41.0 34-35 36.766375 41.0 38.5 41.0 31.5 41.0 36-37 36.613125 41.0 38.0 41.0 30.5 41.0 38-39 36.44625 41.0 38.0 41.0 30.0 41.0 40-41 36.315375 41.0 37.0 41.0 30.0 41.0 42-43 36.2085 41.0 36.5 41.0 30.0 41.0 44-45 36.03125 40.5 35.5 41.0 30.0 41.0 46-47 35.921375 40.0 35.0 41.0 30.0 41.0 48-49 35.691 40.0 35.0 41.0 29.5 41.0 50-51 35.4845 40.0 35.0 41.0 28.0 41.0 52-53 35.2955 39.0 35.0 41.0 27.5 41.0 54-55 35.067375 39.0 35.0 41.0 27.0 41.0 56-57 34.845375000000004 38.5 35.0 41.0 26.0 41.0 58-59 34.562625 37.0 35.0 41.0 25.5 41.0 60-61 34.41675 37.0 35.0 41.0 26.0 41.0 62-63 34.134 36.5 35.0 40.5 26.0 41.0 64-65 33.888875 36.0 35.0 39.5 25.5 41.0 66-67 33.600625 35.0 35.0 39.0 25.5 41.0 68-69 33.268 35.0 35.0 39.0 23.5 41.0 70-71 32.955875 35.0 35.0 37.0 24.0 40.5 72-73 32.685249999999996 35.0 35.0 37.0 23.0 39.0 74-75 32.419875 35.0 35.0 36.5 23.5 39.0 76-77 32.216375 35.0 35.0 36.0 23.5 38.5 78-79 31.982124999999996 35.0 35.0 36.0 23.0 37.0 80-81 31.761625000000002 35.0 34.0 35.0 20.0 37.0 82-83 31.626375 35.0 34.0 35.0 21.0 36.5 84-85 31.488125 35.0 34.0 35.0 20.0 36.0 86-87 31.37825 35.0 34.0 35.0 19.5 36.0 88-89 31.265375 35.0 34.0 35.0 18.0 36.0 90-91 31.19625 35.0 34.0 35.0 18.0 35.0 92-93 31.006125 35.0 34.0 35.0 13.5 35.0 94-95 31.0105 35.0 34.0 35.0 6.0 35.0 96-97 30.886499999999998 35.0 34.0 35.0 2.0 35.0 98-99 30.793 35.0 34.0 35.0 2.0 35.0 100-101 29.704 34.5 31.5 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 271.0 3 2.0 4 0.0 5 2.0 6 0.0 7 3.0 8 3.0 9 3.0 10 5.0 11 4.0 12 3.0 13 7.0 14 5.0 15 2.0 16 3.0 17 9.0 18 4.0 19 1.0 20 2.0 21 11.0 22 6.0 23 12.0 24 5.0 25 7.0 26 18.0 27 15.0 28 23.0 29 23.0 30 32.0 31 41.0 32 48.0 33 64.0 34 99.0 35 230.0 36 541.0 37 936.0 38 1251.0 39 309.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.307576894223555 12.253063265816454 13.253313328332084 44.18604651162791 2 25.924999999999997 22.45 24.375 27.250000000000004 3 25.1 19.55 23.150000000000002 32.2 4 27.675 20.424999999999997 18.525 33.375 5 34.225 24.75 19.475 21.55 6 33.074999999999996 28.050000000000004 17.2 21.675 7 25.275 21.525 30.45 22.75 8 22.475 28.050000000000004 23.5 25.974999999999998 9 27.750000000000004 21.6 26.05 24.6 10-11 28.499999999999996 29.1875 19.662499999999998 22.650000000000002 12-13 27.825 23.6125 22.3875 26.174999999999997 14-15 26.6 23.674999999999997 23.0625 26.6625 16-17 29.25 22.9625 23.3375 24.45 18-19 28.599999999999998 22.7 24.087500000000002 24.6125 20-21 27.8375 25.575 22.475 24.1125 22-23 31.0 22.9875 21.8 24.212500000000002 24-25 26.55 25.424999999999997 22.4875 25.5375 26-27 26.387500000000003 27.1125 22.05 24.45 28-29 27.537499999999998 25.124999999999996 22.7375 24.6 30-31 29.2375 22.7375 22.775000000000002 25.25 32-33 27.525 25.4625 22.9625 24.05 34-35 27.737499999999997 25.2 22.125 24.9375 36-37 25.112499999999997 24.2 24.575 26.1125 38-39 24.6625 23.1 25.7 26.5375 40-41 29.512500000000003 22.4625 22.3625 25.662499999999998 42-43 29.1375 23.0125 22.287499999999998 25.5625 44-45 30.625000000000004 22.6 22.3875 24.3875 46-47 27.462500000000002 22.625 23.3375 26.575 48-49 25.0625 22.45 21.987499999999997 30.5 50-51 29.812499999999996 22.75 22.1 25.337500000000002 52-53 23.775 25.2125 25.412499999999998 25.6 54-55 23.425 25.2125 23.925 27.437499999999996 56-57 24.349999999999998 23.2375 28.1875 24.224999999999998 58-59 24.474999999999998 25.825 24.975 24.725 60-61 24.5 28.7375 21.8625 24.9 62-63 25.5 29.512500000000003 21.45 23.5375 64-65 23.95 28.775000000000002 22.400000000000002 24.875 66-67 24.474999999999998 27.962500000000002 22.537499999999998 25.025 68-69 23.875 28.962500000000002 22.3 24.8625 70-71 24.875 27.750000000000004 23.3 24.075 72-73 24.474999999999998 25.575 23.775 26.174999999999997 74-75 25.9625 26.2875 22.825 24.925 76-77 25.7375 25.2375 22.7 26.325 78-79 26.5125 24.887500000000003 22.787499999999998 25.8125 80-81 26.5375 24.8 23.175 25.4875 82-83 26.9625 24.15 22.8625 26.025 84-85 25.9625 23.799999999999997 24.6625 25.575 86-87 27.025 24.837500000000002 22.7375 25.4 88-89 26.0125 24.4875 23.8125 25.687500000000004 90-91 25.9875 24.0625 23.1 26.85 92-93 28.012500000000003 24.65 23.0875 24.25 94-95 27.3625 24.9125 22.4625 25.2625 96-97 27.5125 24.4 22.35 25.7375 98-99 28.237499999999997 24.45 22.650000000000002 24.6625 100-101 27.474999999999998 24.462500000000002 22.4625 25.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 2.0 29 3.0 30 3.0 31 5.5 32 10.0 33 13.5 34 19.5 35 26.5 36 39.0 37 57.5 38 67.5 39 74.5 40 92.0 41 100.0 42 101.5 43 123.5 44 143.5 45 149.5 46 171.0 47 182.5 48 172.5 49 161.5 50 154.0 51 147.5 52 155.5 53 148.0 54 129.0 55 120.5 56 105.5 57 102.5 58 97.5 59 90.5 60 78.5 61 76.5 62 77.5 63 68.5 64 65.5 65 70.0 66 66.5 67 60.5 68 74.0 69 69.5 70 50.5 71 38.5 72 37.0 73 40.5 74 31.5 75 27.0 76 24.5 77 22.0 78 18.0 79 9.5 80 7.5 81 6.5 82 2.5 83 1.0 84 0.5 85 2.0 86 2.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84947315604616 99.5 2 0.10035122930255895 0.2 3 0.0 0.0 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.025087807325639738 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGGAGAGGGGCGGGGAGGGGAAGAGGGGAGATCTCGGGGGGCGCCG 7 0.17500000000000002 No Hit AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.16249999999999998 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.1875 0.0 0.0 0.0 0.0 22-23 0.2 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.21250000000000002 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.275 0.0 0.0 0.0 0.0 54-55 0.275 0.0 0.0 0.0 0.0 56-57 0.2875 0.0 0.0 0.0 0.0 58-59 0.3 0.0 0.0 0.0 0.0 60-61 0.3375 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.3625 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.6 0.0 0.0 0.0 0.0 74-75 0.8375 0.0 0.0 0.0 0.0 76-77 1.15 0.0 0.0 0.0 0.0 78-79 1.425 0.0 0.0 0.0 0.0 80-81 1.7875 0.0 0.0 0.0 0.0 82-83 2.225 0.0 0.0 0.0 0.0 84-85 2.675 0.0 0.0 0.0 0.0 86-87 3.225 0.0 0.0 0.0 0.0 88-89 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037964 spots for SRR10380963.sra Written 1037964 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra Read 1037948 spots for SRR10380963.sra Written 1037948 spots for SRR10380963.sra SRR ids: ['SRR10380963.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d218vnr9 SRR10380963.sra spots: 20758976 blocks: [[1, 1037948], [1037949, 2075896], [2075897, 3113844], [3113845, 4151792], [4151793, 5189740], [5189741, 6227688], [6227689, 7265636], [7265637, 8303584], [8303585, 9341532], [9341533, 10379480], [10379481, 11417428], [11417429, 12455376], [12455377, 13493324], [13493325, 14531272], [14531273, 15569220], [15569221, 16607168], [16607169, 17645116], [17645117, 18683064], [18683065, 19721012], [19721013, 20758976]] SRR10380963 file size 5695674 SRR10380963 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380963 SRR10380963_1.fastq SRR10380963_2.fastq Input file: SRR10380963_1.fastq Paired file: SRR10380963_2.fastq trimmed: SRR10380963-trimmed-pair1.fastq, SRR10380963-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:49:17 2024 >> started Sat Dec 7 15:49:37 2024 >> done (20.327s) 20758976 read pairs processed; of these: 84826 ( 0.41%) short read pairs filtered out after trimming by size control 1470962 ( 7.09%) empty read pairs filtered out after trimming by size control 19203188 (92.51%) read pairs available; of these: 3324046 (17.31%) trimmed read pairs available after processing 15879142 (82.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 811 0.00% 19 819 0.00% 20 893 0.00% 21 808 0.00% 22 833 0.00% 23 975 0.01% 24 891 0.00% 25 894 0.00% 26 883 0.00% 27 971 0.01% 28 982 0.01% 29 1017 0.01% 30 1126 0.01% 31 1100 0.01% 32 1125 0.01% 33 1211 0.01% 34 1261 0.01% 35 1359 0.01% 36 1437 0.01% 37 1444 0.01% 38 1540 0.01% 39 1601 0.01% 40 1756 0.01% 41 1755 0.01% 42 1850 0.01% 43 1900 0.01% 44 2051 0.01% 45 2078 0.01% 46 2188 0.01% 47 2529 0.01% 48 2568 0.01% 49 2707 0.01% 50 2994 0.02% 51 3194 0.02% 52 3526 0.02% 53 3764 0.02% 54 3982 0.02% 55 4319 0.02% 56 4826 0.03% 57 5395 0.03% 58 6243 0.03% 59 10808 0.06% 60 15486 0.08% 61 16758 0.09% 62 18844 0.10% 63 20784 0.11% 64 21786 0.11% 65 22700 0.12% 66 24383 0.13% 67 25076 0.13% 68 27575 0.14% 69 29326 0.15% 70 32430 0.17% 71 34151 0.18% 72 37821 0.20% 73 42318 0.22% 74 44183 0.23% 75 45114 0.23% 76 46756 0.24% 77 47861 0.25% 78 50260 0.26% 79 54036 0.28% 80 58571 0.31% 81 64221 0.33% 82 71565 0.37% 83 78751 0.41% 84 83550 0.44% 85 85711 0.45% 86 86767 0.45% 87 86871 0.45% 88 88654 0.46% 89 93193 0.49% 90 99716 0.52% 91 107067 0.56% 92 117857 0.61% 93 128870 0.67% 94 139968 0.73% 95 147992 0.77% 96 160466 0.84% 97 164460 0.86% 98 183414 0.96% 99 214457 1.12% 100 309863 1.61% 101 15879142 82.69% 19203188 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=149.35 fanout-score-rank=15 prefix-density=0.96 prefix-fanout=21.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=377.93 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=22.8 sequence=CCGCCGCCGCCTCC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=165.82 fanout-score-rank=14 prefix-density=0.98 prefix-fanout=22.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=380.97 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=23.4 sequence=CCGCCGCCGCCTCC SRR10380963 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:50:38 Started mapping on | Dec 07 15:50:38 Finished on | Dec 07 15:52:07 Mapping speed, Million of reads per hour | 776.76 Number of input reads | 19203188 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 17902294 Uniquely mapped reads % | 93.23% Average mapped length | 196.35 Number of splices: Total | 9087471 Number of splices: Annotated (sjdb) | 8460070 Number of splices: GT/AG | 8954158 Number of splices: GC/AG | 114224 Number of splices: AT/AC | 6161 Number of splices: Non-canonical | 12928 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.01% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 204726 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 80478 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 2.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1110613 1110613 1110613 N_multimapping 204726 204726 204726 N_noFeature 614532 9028625 9092531 N_ambiguous 437135 21707 21736 UnstrandedReadsAssigned:16850627 PositiveStrandReadsAssigned:8851962 NegativeStrandReadsAssigned:8788027 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380963 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380963-trimmed-pair1.fastq SRR10380963-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,203,188 reads, 17,607,337 reads pseudoaligned [quant] estimated average fragment length: 186.514 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR10380963.ke.tsv 35125 SRR10380963.se.tsv 88098 total ==> SRR10380963.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.672 2.13407e-08 2.19306e-09 PNS24247 1044 858.486 49.1542 4.41692 PNS24249 1928 1742.49 191.71 8.48726 PNS24246 1044 858.486 49.1542 4.41692 PNS24248 1044 858.486 49.1542 4.41692 PNS24244 1471 1285.49 219.828 13.1919 PNS24243 293 132.818 9 5.22732 KQK14069 1603 1417.49 13812.3 751.692 KQK14071 474 294.363 1012.4 265.315 ==> SRR10380963.se.tsv <== BRADI_1g14170v3 15681 BRADI_1g53295v3 97 BRADI_1g59795v3 422 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 890 BRADI_1g74790v3 1355 BRADI_1g09890v3 2 BRADI_1g77505v3 276 BRADI_1g48960v3 1 SRR10380963 completed mapping pipeline successfully