Starting /dee2/code/volunteer_pipeline.sh SRR10380964 current disk space = 1542122377216 free memory = 1600742288 SRR10380964 SRAfilesize 7b7a9ede5a9dd9ab08d63e9168ec6c26 SRR10380964.sra SRR10380964.sra file validated SRR10380964 is paired end SRR10380964 is conventional basespace SRR10380964 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380964_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47375 34.0 33.0 34.0 31.0 34.0 2 32.9 34.0 34.0 34.0 31.0 34.0 3 33.2255 34.0 34.0 34.0 31.0 34.0 4 36.53775 37.0 37.0 37.0 35.0 37.0 5 36.44575 37.0 37.0 37.0 35.0 37.0 6 36.472 37.0 37.0 37.0 35.0 37.0 7 36.37025 37.0 37.0 37.0 35.0 37.0 8 36.48025 37.0 37.0 37.0 35.0 37.0 9 38.38625 39.0 39.0 39.0 37.0 39.0 10-11 38.420875 39.0 39.0 39.0 37.0 39.0 12-13 38.437125 39.0 39.0 39.0 37.0 39.0 14-15 40.1225 41.0 40.0 41.0 38.0 41.0 16-17 40.095124999999996 41.0 40.0 41.0 38.0 41.0 18-19 40.08725 41.0 40.0 41.0 38.0 41.0 20-21 40.005875 41.0 40.0 41.0 38.0 41.0 22-23 40.027375 41.0 40.0 41.0 38.0 41.0 24-25 39.99975 41.0 40.0 41.0 38.0 41.0 26-27 39.92725 41.0 40.0 41.0 38.0 41.0 28-29 39.822 41.0 40.0 41.0 37.0 41.0 30-31 39.689375 41.0 40.0 41.0 37.0 41.0 32-33 39.607749999999996 41.0 40.0 41.0 36.0 41.0 34-35 39.527875 41.0 40.0 41.0 35.5 41.0 36-37 39.358875 41.0 39.0 41.0 35.0 41.0 38-39 39.214749999999995 41.0 39.0 41.0 35.0 41.0 40-41 39.044125 41.0 38.5 41.0 35.0 41.0 42-43 38.873875 41.0 38.0 41.0 35.0 41.0 44-45 38.552375 41.0 37.0 41.0 35.0 41.0 46-47 38.527375 41.0 37.0 41.0 35.0 41.0 48-49 38.370000000000005 40.0 36.0 41.0 35.0 41.0 50-51 38.24275 40.0 35.5 41.0 35.0 41.0 52-53 38.025625 40.0 35.0 41.0 35.0 41.0 54-55 37.79425 39.0 35.0 41.0 35.0 41.0 56-57 37.574375 39.0 35.0 41.0 34.0 41.0 58-59 37.370999999999995 38.5 35.0 41.0 34.0 41.0 60-61 37.151125 37.5 35.0 41.0 34.0 41.0 62-63 36.884 37.0 35.0 41.0 34.0 41.0 64-65 36.56625 36.5 35.0 40.0 33.5 41.0 66-67 36.268249999999995 36.0 35.0 39.0 33.0 41.0 68-69 35.94925 35.0 35.0 39.0 33.0 41.0 70-71 35.703625 35.0 35.0 38.5 33.0 41.0 72-73 35.39675 35.0 35.0 37.0 33.0 39.5 74-75 34.966875 35.0 35.0 37.0 33.0 39.0 76-77 34.443 35.0 35.0 36.0 32.5 39.0 78-79 34.206125 35.0 35.0 36.0 32.0 37.0 80-81 34.025125 35.0 35.0 36.0 32.0 37.0 82-83 33.902375 35.0 35.0 35.0 32.0 37.0 84-85 33.759875 35.0 35.0 35.0 32.0 36.0 86-87 33.646 35.0 35.0 35.0 32.0 36.0 88-89 33.527 35.0 35.0 35.0 32.0 36.0 90-91 33.432625 35.0 35.0 35.0 31.5 35.5 92-93 33.316625 35.0 35.0 35.0 31.5 35.0 94-95 33.25725 35.0 35.0 35.0 31.0 35.0 96-97 33.121375 35.0 35.0 35.0 31.0 35.0 98-99 33.072125 35.0 35.0 35.0 31.0 35.0 100-101 32.090875 34.5 33.0 35.0 28.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 3.0 14 0.0 15 2.0 16 1.0 17 3.0 18 4.0 19 5.0 20 3.0 21 3.0 22 6.0 23 7.0 24 3.0 25 10.0 26 18.0 27 26.0 28 43.0 29 34.0 30 32.0 31 51.0 32 57.0 33 65.0 34 95.0 35 255.0 36 623.0 37 970.0 38 1333.0 39 342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.43543850677576 11.736128867297367 12.861160828432627 47.96727179749425 2 24.975 18.475 28.15 28.4 3 27.150000000000002 18.75 22.275 31.825 4 29.075 22.1 17.125 31.7 5 32.800000000000004 25.525 19.925 21.75 6 28.475 31.374999999999996 18.25 21.9 7 22.95 23.200000000000003 31.8 22.05 8 22.925 23.225 27.175 26.674999999999997 9 25.1 20.5 28.925 25.474999999999998 10-11 25.674999999999997 28.9875 20.5375 24.8 12-13 23.775 23.724999999999998 25.0 27.500000000000004 14-15 24.7375 25.4375 23.825 26.0 16-17 26.575 23.575 22.775000000000002 27.075 18-19 25.7125 23.5375 24.0125 26.737499999999997 20-21 26.700000000000003 23.9125 24.3625 25.025 22-23 25.937500000000004 24.8625 23.150000000000002 26.05 24-25 24.887500000000003 23.05 24.7375 27.325 26-27 25.362499999999997 24.7 22.5125 27.425 28-29 25.7375 24.85 23.0875 26.325 30-31 24.925 23.400000000000002 24.525 27.150000000000002 32-33 25.7 24.95 23.575 25.775 34-35 26.2125 23.2875 22.7375 27.762500000000003 36-37 26.1125 24.175 24.1625 25.55 38-39 25.55319414926866 24.21552694086761 22.727840980122515 27.50343792974122 40-41 26.835063148680753 24.309115918469427 22.308365637113916 26.5474552957359 42-43 25.25328330206379 23.527204502814257 24.978111319574733 26.241400875547217 44-45 25.181386039529645 24.39329497122842 24.468351263447584 25.956967725794343 46-47 26.432324243182386 23.555166374781088 22.491868901676256 27.52064048036027 48-49 24.69660953334167 25.27211309896159 24.19617165019392 25.835105717502817 50-51 25.925925925925924 24.3993993993994 23.998998998999 25.675675675675674 52-53 25.741830474521098 23.413046200075122 22.97483410542131 27.870289219982467 54-55 25.359869821003883 24.320941294279635 23.832770058830892 26.486418825885593 56-57 25.00625782227785 24.330413016270338 24.267834793491865 26.395494367959948 58-59 25.941684394944314 23.601551745713927 23.451382805656362 27.005381053685397 60-61 25.781836377282964 24.718538904178132 24.230673004753562 25.268951713785338 62-63 25.61570196274534 24.065508188523566 24.40305038129766 25.91573946743343 64-65 27.0125 24.1875 23.05 25.75 66-67 25.3125 25.45 23.0875 26.150000000000002 68-69 26.1125 25.8 23.0125 25.074999999999996 70-71 25.7875 25.0375 23.724999999999998 25.45 72-73 24.625 25.55 23.75 26.075 74-75 25.662499999999998 24.575 24.0 25.7625 76-77 25.937500000000004 24.5 23.5625 26.0 78-79 26.075 24.975 23.4875 25.4625 80-81 25.887500000000003 24.462500000000002 24.2875 25.362499999999997 82-83 25.0375 24.2625 23.9875 26.7125 84-85 25.8 24.75 23.65 25.8 86-87 26.700000000000003 23.9 24.2375 25.162499999999998 88-89 26.5875 24.224999999999998 23.5625 25.624999999999996 90-91 26.0 23.7 23.9 26.400000000000002 92-93 26.474999999999998 23.7125 24.125 25.687500000000004 94-95 26.375 24.1375 23.575 25.912499999999998 96-97 26.5625 24.425 23.0875 25.924999999999997 98-99 26.0125 24.474999999999998 23.4875 26.025 100-101 26.35 24.15 23.5 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.0 29 3.0 30 6.5 31 7.0 32 9.5 33 14.0 34 23.5 35 33.5 36 43.5 37 51.5 38 66.0 39 85.0 40 106.5 41 120.0 42 124.5 43 142.0 44 154.0 45 164.0 46 165.0 47 167.0 48 160.5 49 155.5 50 143.0 51 137.5 52 146.0 53 124.5 54 102.5 55 102.0 56 100.5 57 92.5 58 87.0 59 78.5 60 78.0 61 74.5 62 68.0 63 78.5 64 72.0 65 60.0 66 76.0 67 76.5 68 65.5 69 58.5 70 59.5 71 56.5 72 46.0 73 42.5 74 41.5 75 37.5 76 24.0 77 16.5 78 16.5 79 13.5 80 8.0 81 4.0 82 2.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0375 42-43 0.0625 44-45 0.075 46-47 0.075 48-49 0.08750000000000001 50-51 0.1 52-53 0.1625 54-55 0.13749999999999998 56-57 0.125 58-59 0.11249999999999999 60-61 0.075 62-63 0.0125 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89860583016477 98.52499999999999 2 0.025348542458808618 0.05 3 0.050697084917617236 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025348542458808618 1.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTAT 51 1.275 TruSeq Adapter, Index 16 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR10380964 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380964_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.24375 34.0 31.0 34.0 31.0 34.0 2 32.39925 34.0 33.0 34.0 31.0 34.0 3 32.4505 34.0 33.0 34.0 31.0 34.0 4 35.76825 37.0 37.0 37.0 35.0 37.0 5 35.76925 37.0 37.0 37.0 35.0 37.0 6 35.70875 37.0 37.0 37.0 35.0 37.0 7 35.74675 37.0 37.0 37.0 35.0 37.0 8 35.709 37.0 37.0 37.0 35.0 37.0 9 37.54125 39.0 39.0 39.0 37.0 39.0 10-11 37.523624999999996 39.0 39.0 39.0 37.0 39.0 12-13 37.52175 39.0 39.0 39.0 37.0 39.0 14-15 39.1315 41.0 40.0 41.0 37.0 41.0 16-17 39.138625 41.0 40.0 41.0 37.0 41.0 18-19 39.070125000000004 41.0 40.0 41.0 37.0 41.0 20-21 39.070875 41.0 40.0 41.0 37.0 41.0 22-23 39.0465 41.0 40.0 41.0 37.0 41.0 24-25 38.99787499999999 41.0 40.0 41.0 36.5 41.0 26-27 38.981125000000006 41.0 40.0 41.0 36.5 41.0 28-29 38.8555 41.0 40.0 41.0 36.0 41.0 30-31 38.7765 41.0 40.0 41.0 35.0 41.0 32-33 38.7145 41.0 39.5 41.0 35.0 41.0 34-35 38.59425 41.0 39.5 41.0 35.0 41.0 36-37 38.445875 41.0 39.0 41.0 35.0 41.0 38-39 38.304 41.0 39.0 41.0 35.0 41.0 40-41 38.213125000000005 41.0 38.0 41.0 35.0 41.0 42-43 38.040125 41.0 37.5 41.0 35.0 41.0 44-45 37.83725 41.0 37.0 41.0 34.5 41.0 46-47 37.66875 40.5 36.5 41.0 34.0 41.0 48-49 37.442375 40.0 35.0 41.0 33.0 41.0 50-51 37.28875 40.0 35.0 41.0 33.5 41.0 52-53 37.013 40.0 35.0 41.0 33.0 41.0 54-55 36.898375 39.5 35.0 41.0 33.0 41.0 56-57 36.638999999999996 39.0 35.0 41.0 33.0 41.0 58-59 36.32325 39.0 35.0 41.0 32.5 41.0 60-61 36.116875 37.5 35.0 41.0 32.5 41.0 62-63 35.8435 37.0 35.0 41.0 32.0 41.0 64-65 35.565625 36.5 35.0 40.0 32.0 41.0 66-67 35.287125 36.0 35.0 39.0 31.5 41.0 68-69 34.970375 35.0 35.0 39.0 31.5 41.0 70-71 34.677499999999995 35.0 35.0 38.5 31.0 41.0 72-73 34.3895 35.0 35.0 37.0 31.0 40.0 74-75 34.086375000000004 35.0 35.0 37.0 31.0 39.0 76-77 33.84525 35.0 35.0 36.0 31.0 39.0 78-79 33.6215 35.0 35.0 36.0 31.0 37.5 80-81 33.390875 35.0 35.0 35.5 31.0 37.0 82-83 33.202124999999995 35.0 35.0 35.0 30.5 37.0 84-85 33.03275 35.0 35.0 35.0 30.0 36.0 86-87 32.979875 35.0 35.0 35.0 30.5 36.0 88-89 32.875375000000005 35.0 35.0 35.0 30.0 36.0 90-91 32.75425 35.0 35.0 35.0 30.0 36.0 92-93 32.6 35.0 34.0 35.0 29.5 35.0 94-95 32.610749999999996 35.0 34.5 35.0 29.0 35.0 96-97 32.45175 35.0 34.0 35.0 29.0 35.0 98-99 32.35825 35.0 34.0 35.0 29.0 35.0 100-101 31.16225 34.5 32.5 35.0 24.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 76.0 3 3.0 4 5.0 5 3.0 6 2.0 7 1.0 8 2.0 9 1.0 10 4.0 11 1.0 12 3.0 13 4.0 14 9.0 15 4.0 16 4.0 17 3.0 18 5.0 19 8.0 20 3.0 21 11.0 22 3.0 23 4.0 24 11.0 25 12.0 26 12.0 27 21.0 28 22.0 29 33.0 30 31.0 31 47.0 32 50.0 33 72.0 34 96.0 35 223.0 36 568.0 37 949.0 38 1332.0 39 362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.87090317738304 12.084063047285463 11.95896922692019 48.08606454841131 2 24.975 18.425 29.325000000000003 27.275 3 25.674999999999997 21.099999999999998 20.925 32.300000000000004 4 30.475 20.9 17.75 30.875000000000004 5 30.8 26.950000000000003 20.599999999999998 21.65 6 27.675 31.4 18.675 22.25 7 24.45 20.200000000000003 33.300000000000004 22.05 8 22.900000000000002 24.474999999999998 25.424999999999997 27.200000000000003 9 24.975 19.950000000000003 27.275 27.800000000000004 10-11 25.85 28.775000000000002 21.099999999999998 24.275 12-13 26.2125 22.5625 24.1125 27.1125 14-15 25.974999999999998 24.887500000000003 23.7625 25.374999999999996 16-17 26.6125 24.887500000000003 22.0875 26.4125 18-19 26.1625 24.2875 23.525 26.025 20-21 26.437500000000004 24.8625 23.6125 25.087500000000002 22-23 26.1 24.337500000000002 24.0125 25.55 24-25 26.637499999999996 24.525 22.412499999999998 26.424999999999997 26-27 26.387500000000003 25.575 22.6 25.4375 28-29 26.137500000000003 24.55 23.4625 25.85 30-31 26.6125 23.5625 23.45 26.375 32-33 25.3 24.587500000000002 24.2875 25.825 34-35 26.5875 24.6625 22.9875 25.7625 36-37 25.4875 24.474999999999998 24.212500000000002 25.825 38-39 25.0375 24.675 23.7375 26.55 40-41 26.825 24.0375 22.425 26.7125 42-43 26.575 24.05 23.474999999999998 25.900000000000002 44-45 26.6625 24.75 23.3125 25.275 46-47 27.0 24.725 22.975 25.3 48-49 25.7125 24.55 23.375 26.3625 50-51 26.650000000000002 23.875 23.6375 25.837500000000002 52-53 26.025 24.0 24.4875 25.4875 54-55 24.762500000000003 24.637500000000003 23.3 27.3 56-57 25.0625 24.0125 24.875 26.05 58-59 25.5375 24.837500000000002 22.6 27.025 60-61 24.9375 26.737499999999997 22.7625 25.5625 62-63 25.3125 26.0 23.325000000000003 25.362499999999997 64-65 26.150000000000002 24.1875 23.95 25.7125 66-67 26.4625 24.0375 24.3 25.2 68-69 25.6125 25.55 23.35 25.4875 70-71 26.5375 24.4875 23.125 25.85 72-73 25.837500000000002 25.2625 23.6125 25.2875 74-75 25.15 25.025 23.1375 26.687499999999996 76-77 26.0625 24.025 23.1375 26.775 78-79 25.5625 24.4875 24.349999999999998 25.6 80-81 25.45 24.6125 24.25 25.687500000000004 82-83 26.937499999999996 22.875 23.4375 26.75 84-85 25.362499999999997 23.8625 24.675 26.1 86-87 26.625 25.337500000000002 22.787499999999998 25.25 88-89 26.687499999999996 24.4375 23.575 25.3 90-91 26.4125 24.45 23.5625 25.575 92-93 26.5375 24.375 23.7625 25.324999999999996 94-95 26.85 23.2375 23.075000000000003 26.8375 96-97 26.187500000000004 23.575 23.4625 26.775 98-99 25.95 24.3125 24.075 25.662499999999998 100-101 25.8625 23.9125 23.7125 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.0 28 1.5 29 1.5 30 4.5 31 7.0 32 9.0 33 14.0 34 25.0 35 38.0 36 43.5 37 48.5 38 65.0 39 84.0 40 102.0 41 123.0 42 134.0 43 140.5 44 152.0 45 164.0 46 159.0 47 160.0 48 161.0 49 159.0 50 162.0 51 152.5 52 132.0 53 108.0 54 97.0 55 94.0 56 88.0 57 93.0 58 97.0 59 89.5 60 79.5 61 73.5 62 73.5 63 70.0 64 74.5 65 80.0 66 80.0 67 73.0 68 65.0 69 62.5 70 60.5 71 52.5 72 44.5 73 38.0 74 30.0 75 28.0 76 27.0 77 21.5 78 17.0 79 15.0 80 11.0 81 6.0 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931647 spots for SRR10380964.sra Written 931647 spots for SRR10380964.sra Read 931649 spots for SRR10380964.sra Written 931649 spots for SRR10380964.sra SRR ids: ['SRR10380964.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mjh_8j66 SRR10380964.sra spots: 18632942 blocks: [[1, 931647], [931648, 1863294], [1863295, 2794941], [2794942, 3726588], [3726589, 4658235], [4658236, 5589882], [5589883, 6521529], [6521530, 7453176], [7453177, 8384823], [8384824, 9316470], [9316471, 10248117], [10248118, 11179764], [11179765, 12111411], [12111412, 13043058], [13043059, 13974705], [13974706, 14906352], [14906353, 15837999], [15838000, 16769646], [16769647, 17701293], [17701294, 18632942]] SRR10380964 file size 5111236 SRR10380964 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380964 SRR10380964_1.fastq SRR10380964_2.fastq Input file: SRR10380964_1.fastq Paired file: SRR10380964_2.fastq trimmed: SRR10380964-trimmed-pair1.fastq, SRR10380964-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:52:11 2024 >> started Sat Dec 7 15:52:28 2024 >> done (17.447s) 18632942 read pairs processed; of these: 75282 ( 0.40%) short read pairs filtered out after trimming by size control 388330 ( 2.08%) empty read pairs filtered out after trimming by size control 18169330 (97.51%) read pairs available; of these: 1705587 ( 9.39%) trimmed read pairs available after processing 16463743 (90.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 174 0.00% 19 188 0.00% 20 189 0.00% 21 223 0.00% 22 271 0.00% 23 338 0.00% 24 350 0.00% 25 392 0.00% 26 422 0.00% 27 513 0.00% 28 553 0.00% 29 645 0.00% 30 681 0.00% 31 731 0.00% 32 801 0.00% 33 824 0.00% 34 960 0.01% 35 993 0.01% 36 1061 0.01% 37 1164 0.01% 38 1288 0.01% 39 1290 0.01% 40 1330 0.01% 41 1415 0.01% 42 1474 0.01% 43 1554 0.01% 44 1587 0.01% 45 1715 0.01% 46 1698 0.01% 47 1741 0.01% 48 1940 0.01% 49 2022 0.01% 50 2120 0.01% 51 2194 0.01% 52 2322 0.01% 53 2468 0.01% 54 2618 0.01% 55 2807 0.02% 56 3027 0.02% 57 3404 0.02% 58 3677 0.02% 59 7866 0.04% 60 12219 0.07% 61 13092 0.07% 62 14291 0.08% 63 15180 0.08% 64 15956 0.09% 65 16699 0.09% 66 17520 0.10% 67 17885 0.10% 68 18912 0.10% 69 19136 0.11% 70 19779 0.11% 71 19910 0.11% 72 20505 0.11% 73 21376 0.12% 74 21452 0.12% 75 21824 0.12% 76 22200 0.12% 77 22385 0.12% 78 23345 0.13% 79 23658 0.13% 80 24478 0.13% 81 25189 0.14% 82 25974 0.14% 83 26830 0.15% 84 28111 0.15% 85 28578 0.16% 86 29755 0.16% 87 31098 0.17% 88 33106 0.18% 89 35227 0.19% 90 38307 0.21% 91 41138 0.23% 92 45391 0.25% 93 50535 0.28% 94 56490 0.31% 95 64714 0.36% 96 80351 0.44% 97 88845 0.49% 98 112630 0.62% 99 148467 0.82% 100 250019 1.38% 101 16463743 90.61% 18169330 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=173.82 fanout-score-rank=16 prefix-density=1.05 prefix-fanout=22.6 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=390.31 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=23.5 sequence=CCGCCGCCGCCTCC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=165.73 fanout-score-rank=16 prefix-density=1.03 prefix-fanout=22.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=420.49 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=25.8 sequence=GCCGCCGCCGCT SRR10380964 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:53:12 Started mapping on | Dec 07 15:53:12 Finished on | Dec 07 15:54:08 Mapping speed, Million of reads per hour | 1168.03 Number of input reads | 18169330 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 17402990 Uniquely mapped reads % | 95.78% Average mapped length | 198.54 Number of splices: Total | 9708718 Number of splices: Annotated (sjdb) | 9093070 Number of splices: GT/AG | 9571328 Number of splices: GC/AG | 119136 Number of splices: AT/AC | 6823 Number of splices: Non-canonical | 11431 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.01% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192795 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 32008 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 587460 587460 587460 N_multimapping 192795 192795 192795 N_noFeature 551047 8784265 8820715 N_ambiguous 388171 20530 20518 UnstrandedReadsAssigned:16463772 PositiveStrandReadsAssigned:8598195 NegativeStrandReadsAssigned:8561757 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380964 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380964-trimmed-pair1.fastq SRR10380964-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,169,330 reads, 17,115,466 reads pseudoaligned [quant] estimated average fragment length: 199.729 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR10380964.ke.tsv 35125 SRR10380964.se.tsv 88098 total ==> SRR10380964.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 737.564 0.394912 0.0429573 PNS24247 1044 845.271 60.7493 5.76609 PNS24249 1928 1729.27 215.801 10.0121 PNS24246 1044 845.271 60.7493 5.76609 PNS24248 1044 845.271 60.7493 5.76609 PNS24244 1471 1272.27 79.5566 5.01687 PNS24243 293 118.673 20 13.5212 KQK14069 1603 1404.27 9333.84 533.268 KQK14071 474 281.525 710.328 202.432 ==> SRR10380964.se.tsv <== BRADI_1g14170v3 10702 BRADI_1g53295v3 68 BRADI_1g59795v3 334 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 863 BRADI_1g74790v3 1160 BRADI_1g09890v3 4 BRADI_1g77505v3 199 BRADI_1g48960v3 1 SRR10380964 completed mapping pipeline successfully