Starting /dee2/code/volunteer_pipeline.sh SRR10380965 current disk space = 1542117208064 free memory = 1593198572 SRR10380965 SRAfilesize d39290036de399e7bc61367283626cd8 SRR10380965.sra SRR10380965.sra file validated SRR10380965 is paired end SRR10380965 is conventional basespace SRR10380965 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380965_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71425 34.0 33.0 34.0 31.0 34.0 2 33.05675 34.0 34.0 34.0 31.0 34.0 3 33.25675 34.0 34.0 34.0 31.0 34.0 4 36.599 37.0 37.0 37.0 35.0 37.0 5 36.4545 37.0 37.0 37.0 35.0 37.0 6 36.50925 37.0 37.0 37.0 35.0 37.0 7 36.4345 37.0 37.0 37.0 35.0 37.0 8 36.514 37.0 37.0 37.0 35.0 37.0 9 38.426 39.0 39.0 39.0 37.0 39.0 10-11 38.4655 39.0 39.0 39.0 37.0 39.0 12-13 38.451625 39.0 39.0 39.0 37.0 39.0 14-15 40.119875 41.0 40.0 41.0 38.0 41.0 16-17 40.139624999999995 41.0 40.0 41.0 38.0 41.0 18-19 40.153375 41.0 40.0 41.0 38.0 41.0 20-21 40.062875000000005 41.0 40.0 41.0 38.0 41.0 22-23 40.045625 41.0 40.0 41.0 38.0 41.0 24-25 40.041875 41.0 40.0 41.0 38.0 41.0 26-27 39.976375 41.0 40.0 41.0 38.0 41.0 28-29 39.949250000000006 41.0 40.0 41.0 37.5 41.0 30-31 39.834125 41.0 40.0 41.0 37.0 41.0 32-33 39.812124999999995 41.0 40.0 41.0 37.0 41.0 34-35 39.74725 41.0 40.0 41.0 37.0 41.0 36-37 39.586375000000004 41.0 40.0 41.0 35.5 41.0 38-39 39.43575 41.0 39.0 41.0 35.0 41.0 40-41 39.221875 41.0 39.0 41.0 35.0 41.0 42-43 39.085750000000004 41.0 39.0 41.0 35.0 41.0 44-45 38.837125 41.0 38.0 41.0 35.0 41.0 46-47 38.741875 41.0 37.5 41.0 35.0 41.0 48-49 38.61725 41.0 37.0 41.0 35.0 41.0 50-51 38.489374999999995 40.5 36.5 41.0 35.0 41.0 52-53 38.331125 40.0 36.0 41.0 35.0 41.0 54-55 38.153125 40.0 35.0 41.0 35.0 41.0 56-57 37.928875 40.0 35.0 41.0 35.0 41.0 58-59 37.75075 39.0 35.0 41.0 34.5 41.0 60-61 37.49425 39.0 35.0 41.0 34.0 41.0 62-63 37.244875 38.5 35.0 41.0 34.0 41.0 64-65 36.990125 37.0 35.0 41.0 34.0 41.0 66-67 36.611875 37.0 35.0 39.5 33.5 41.0 68-69 36.32525 36.0 35.0 39.0 33.5 41.0 70-71 35.9955 35.5 35.0 39.0 33.0 41.0 72-73 35.571124999999995 35.0 35.0 37.5 33.0 40.5 74-75 35.0715 35.0 35.0 37.0 33.0 39.0 76-77 34.438874999999996 35.0 35.0 36.5 32.5 39.0 78-79 34.15375 35.0 35.0 36.0 32.0 37.5 80-81 33.964124999999996 35.0 35.0 36.0 32.0 37.0 82-83 33.75975 35.0 35.0 35.5 32.0 37.0 84-85 33.60850000000001 35.0 35.0 35.0 32.0 36.0 86-87 33.470625 35.0 35.0 35.0 32.0 36.0 88-89 33.371875 35.0 35.0 35.0 31.5 36.0 90-91 33.2715 35.0 35.0 35.0 31.5 35.5 92-93 33.131249999999994 35.0 35.0 35.0 31.0 35.0 94-95 33.05375 35.0 35.0 35.0 31.0 35.0 96-97 32.956374999999994 35.0 35.0 35.0 31.0 35.0 98-99 32.935125 35.0 35.0 35.0 31.0 35.0 100-101 31.915999999999997 34.5 33.0 35.0 27.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 2.0 13 3.0 14 0.0 15 2.0 16 4.0 17 1.0 18 4.0 19 1.0 20 3.0 21 7.0 22 3.0 23 4.0 24 3.0 25 14.0 26 13.0 27 20.0 28 33.0 29 80.0 30 30.0 31 43.0 32 57.0 33 60.0 34 90.0 35 196.0 36 560.0 37 901.0 38 1492.0 39 371.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.16374269005848 13.450292397660817 9.000762776506484 45.385202135774215 2 23.150000000000002 19.400000000000002 33.625 23.825 3 25.1 19.15 24.4 31.35 4 29.475 23.175 18.0 29.349999999999998 5 31.58158158158158 27.427427427427425 20.07007007007007 20.92092092092092 6 28.299999999999997 31.55 18.75 21.4 7 21.2 23.275000000000002 34.699999999999996 20.825 8 20.974999999999998 24.95 27.450000000000003 26.625 9 24.9 19.75 29.675 25.674999999999997 10-11 25.900000000000002 29.575000000000003 22.15 22.375 12-13 24.474999999999998 24.05 25.275 26.200000000000003 14-15 24.15 25.474999999999998 24.1875 26.187500000000004 16-17 26.174999999999997 24.125 23.65 26.05 18-19 25.7125 23.75 24.45 26.087500000000002 20-21 25.275 23.9 25.224999999999998 25.6 22-23 25.087500000000002 25.825 23.5875 25.5 24-25 25.3 24.5 24.525 25.674999999999997 26-27 24.1375 24.425 24.099999999999998 27.3375 28-29 26.0375 25.8125 22.650000000000002 25.5 30-31 25.087500000000002 24.7875 24.55 25.575 32-33 24.0 24.925 24.3625 26.7125 34-35 25.087500000000002 25.2375 24.775 24.9 36-37 25.2875 24.3875 24.825 25.5 38-39 24.349999999999998 25.575 23.7875 26.2875 40-41 26.60332541567696 24.928116014501814 23.502937867233403 24.965620702587824 42-43 25.218804701175294 24.831207801950487 24.093523380845213 25.85646411602901 44-45 24.421658121795673 24.359134675503313 25.009378516943855 26.20982868575716 46-47 26.42240840315118 24.08403151181693 23.62135800925347 25.872202075778418 48-49 24.23711855927964 25.100050025012504 25.312656328164078 25.350175087543768 50-51 26.25390869293308 24.11507191994997 25.265791119449656 24.36522826766729 52-53 24.405209115952918 23.541197094916104 24.092161282243925 27.96143250688705 54-55 25.62883243649105 23.814291077462144 25.703916906519837 24.852959579526967 56-57 24.56206206206206 24.14914914914915 25.538038038038035 25.75075075075075 58-59 25.13134851138354 24.36827620715537 23.930447835876908 26.56992744558419 60-61 25.934725522070778 23.49631111666875 25.30949105914718 25.259472302113295 62-63 24.4125 24.1375 25.3 26.150000000000002 64-65 26.650000000000002 24.125 24.65 24.575 66-67 24.55 25.8 24.224999999999998 25.424999999999997 68-69 24.712500000000002 25.974999999999998 23.674999999999997 25.637500000000003 70-71 25.7125 26.437500000000004 23.5625 24.2875 72-73 25.2375 26.974999999999998 23.1875 24.6 74-75 24.2875 27.224999999999998 23.925 24.5625 76-77 25.025 25.8 24.212500000000002 24.962500000000002 78-79 25.8625 25.4375 24.337500000000002 24.3625 80-81 24.4125 25.2375 24.5125 25.837500000000002 82-83 25.2125 25.362499999999997 24.125 25.3 84-85 25.662499999999998 24.825 23.75 25.7625 86-87 24.762500000000003 25.2125 24.6625 25.362499999999997 88-89 25.575 25.137500000000003 23.474999999999998 25.8125 90-91 26.224999999999998 23.724999999999998 24.525 25.525 92-93 26.087500000000002 24.55 24.4125 24.95 94-95 25.2375 25.0125 24.474999999999998 25.275 96-97 25.937500000000004 24.45 24.837500000000002 24.775 98-99 25.724999999999998 25.112499999999997 24.575 24.587500000000002 100-101 26.1125 24.9375 23.775 25.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 3.5 29 5.0 30 5.5 31 10.5 32 11.5 33 12.5 34 19.5 35 30.0 36 42.0 37 62.5 38 78.5 39 90.0 40 105.0 41 127.5 42 153.0 43 175.0 44 185.0 45 193.0 46 201.0 47 186.5 48 171.5 49 155.5 50 148.0 51 146.0 52 130.5 53 109.0 54 101.0 55 97.0 56 90.0 57 88.5 58 84.5 59 72.0 60 62.5 61 64.0 62 72.0 63 69.0 64 69.5 65 81.5 66 64.5 67 49.0 68 53.0 69 50.5 70 53.5 71 47.0 72 33.5 73 27.5 74 22.5 75 23.0 76 19.5 77 14.0 78 11.0 79 7.5 80 4.5 81 3.5 82 1.5 83 0.0 84 1.5 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.025 44-45 0.0375 46-47 0.0375 48-49 0.05 50-51 0.0625 52-53 0.17500000000000002 54-55 0.11249999999999999 56-57 0.1 58-59 0.075 60-61 0.0375 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87225344915687 97.725 2 0.07664793050587634 0.15 3 0.02554931016862545 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02554931016862545 2.0500000000000003 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTAT 82 2.0500000000000003 TruSeq Adapter, Index 15 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR10380965 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380965_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95975 34.0 31.0 34.0 31.0 34.0 2 32.1135 34.0 31.0 34.0 31.0 34.0 3 32.1635 34.0 33.0 34.0 31.0 34.0 4 35.398 37.0 37.0 37.0 35.0 37.0 5 35.42525 37.0 37.0 37.0 35.0 37.0 6 35.40475 37.0 37.0 37.0 35.0 37.0 7 35.4075 37.0 37.0 37.0 35.0 37.0 8 35.43825 37.0 37.0 37.0 35.0 37.0 9 37.238 39.0 39.0 39.0 37.0 39.0 10-11 37.220375 39.0 39.0 39.0 36.0 39.0 12-13 37.188 39.0 39.0 39.0 35.0 39.0 14-15 38.789875 41.0 40.0 41.0 36.5 41.0 16-17 38.74025 41.0 40.0 41.0 36.5 41.0 18-19 38.679249999999996 41.0 40.0 41.0 36.0 41.0 20-21 38.70575 41.0 40.0 41.0 36.0 41.0 22-23 38.658625 41.0 40.0 41.0 36.0 41.0 24-25 38.628875 41.0 40.0 41.0 36.0 41.0 26-27 38.61025 41.0 40.0 41.0 36.0 41.0 28-29 38.502875 41.0 40.0 41.0 35.5 41.0 30-31 38.396875 41.0 40.0 41.0 35.0 41.0 32-33 38.313 41.0 39.5 41.0 35.0 41.0 34-35 38.2115 41.0 39.0 41.0 35.0 41.0 36-37 38.05925 41.0 39.0 41.0 35.0 41.0 38-39 37.988625 41.0 39.0 41.0 35.0 41.0 40-41 37.89575 41.0 38.5 41.0 35.0 41.0 42-43 37.801625 41.0 38.0 41.0 34.5 41.0 44-45 37.544250000000005 41.0 37.5 41.0 34.0 41.0 46-47 37.402 41.0 37.0 41.0 33.0 41.0 48-49 37.231875 41.0 36.5 41.0 33.0 41.0 50-51 37.052875 40.0 35.5 41.0 33.0 41.0 52-53 36.8655 40.0 35.0 41.0 33.0 41.0 54-55 36.65375 40.0 35.0 41.0 33.0 41.0 56-57 36.434124999999995 39.0 35.0 41.0 32.0 41.0 58-59 36.136375 39.0 35.0 41.0 31.5 41.0 60-61 35.9825 39.0 35.0 41.0 32.0 41.0 62-63 35.748125 37.5 35.0 41.0 32.0 41.0 64-65 35.429125 37.0 35.0 41.0 31.0 41.0 66-67 35.185125 36.5 35.0 40.0 31.0 41.0 68-69 34.893874999999994 36.0 35.0 39.0 31.0 41.0 70-71 34.5475 35.5 35.0 39.0 31.0 41.0 72-73 34.26625 35.0 35.0 38.0 31.0 40.5 74-75 33.952375 35.0 35.0 37.0 30.5 39.0 76-77 33.63575 35.0 35.0 37.0 30.5 39.0 78-79 33.386875 35.0 35.0 36.0 30.0 38.5 80-81 33.110625 35.0 35.0 36.0 29.5 37.0 82-83 32.974125 35.0 35.0 35.5 30.0 37.0 84-85 32.795249999999996 35.0 35.0 35.0 29.5 36.5 86-87 32.6285 35.0 35.0 35.0 29.0 36.0 88-89 32.521249999999995 35.0 34.5 35.0 29.0 36.0 90-91 32.437375 35.0 34.5 35.0 29.0 36.0 92-93 32.26649999999999 35.0 34.0 35.0 29.0 35.5 94-95 32.276875000000004 35.0 34.0 35.0 29.0 35.0 96-97 32.135374999999996 35.0 34.0 35.0 29.0 35.0 98-99 32.015875 35.0 34.0 35.0 28.5 35.0 100-101 30.996499999999997 34.5 32.5 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 111.0 3 4.0 4 6.0 5 4.0 6 2.0 7 2.0 8 3.0 9 4.0 10 4.0 11 7.0 12 4.0 13 5.0 14 4.0 15 6.0 16 8.0 17 7.0 18 3.0 19 3.0 20 6.0 21 4.0 22 5.0 23 7.0 24 8.0 25 10.0 26 8.0 27 14.0 28 27.0 29 23.0 30 43.0 31 33.0 32 52.0 33 68.0 34 95.0 35 214.0 36 474.0 37 895.0 38 1414.0 39 413.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.232232232232235 12.987987987987987 9.034034034034034 45.74574574574575 2 23.375 18.575 33.75 24.3 3 23.724999999999998 18.875 25.074999999999996 32.324999999999996 4 27.425 23.825 20.0 28.749999999999996 5 31.2 26.724999999999998 20.9 21.175 6 27.450000000000003 32.300000000000004 19.725 20.525 7 22.400000000000002 21.15 34.175 22.275 8 20.7 25.15 27.05 27.1 9 23.95 20.875 30.825000000000003 24.349999999999998 10-11 26.5625 27.6625 22.2625 23.5125 12-13 24.587500000000002 23.8625 25.5 26.05 14-15 25.337500000000002 23.962500000000002 24.8125 25.887500000000003 16-17 25.825 24.2 24.6875 25.2875 18-19 26.237500000000004 24.6125 24.474999999999998 24.675 20-21 25.75 24.349999999999998 24.2 25.7 22-23 26.6625 24.15 24.15 25.0375 24-25 25.4625 25.775 23.2125 25.55 26-27 25.2125 26.5625 24.0125 24.212500000000002 28-29 25.337500000000002 25.4625 23.799999999999997 25.4 30-31 27.05 24.7 23.25 25.0 32-33 25.174999999999997 26.187500000000004 23.2375 25.4 34-35 25.424999999999997 26.0 23.575 25.0 36-37 25.112499999999997 24.75 24.8125 25.324999999999996 38-39 25.05 24.6125 24.6625 25.674999999999997 40-41 26.2875 24.087500000000002 24.125 25.5 42-43 26.674999999999997 23.65 24.3875 25.2875 44-45 26.637499999999996 23.6875 24.337500000000002 25.337500000000002 46-47 25.362499999999997 24.2 24.3125 26.125 48-49 25.775 24.0125 23.4875 26.724999999999998 50-51 27.037499999999998 24.65 23.3875 24.925 52-53 25.0125 24.7375 24.9 25.35 54-55 24.4 25.2875 23.925 26.387500000000003 56-57 24.1375 24.3125 26.424999999999997 25.124999999999996 58-59 24.637500000000003 25.937500000000004 24.1125 25.3125 60-61 23.9875 26.1 24.099999999999998 25.8125 62-63 25.2125 26.0625 24.3875 24.337500000000002 64-65 24.4 27.1625 24.075 24.3625 66-67 23.8375 26.3125 24.224999999999998 25.624999999999996 68-69 25.224999999999998 26.3625 23.1375 25.275 70-71 24.587500000000002 26.2125 23.9875 25.2125 72-73 24.7875 25.3 24.2 25.7125 74-75 24.887500000000003 25.4 24.637500000000003 25.074999999999996 76-77 25.674999999999997 25.324999999999996 24.0 25.0 78-79 25.937500000000004 24.8125 24.1125 25.137500000000003 80-81 24.9125 25.1 23.974999999999998 26.0125 82-83 26.05 24.3125 24.525 25.112499999999997 84-85 24.95 25.124999999999996 23.425 26.5 86-87 25.3 24.675 24.075 25.95 88-89 26.2625 25.087500000000002 23.75 24.9 90-91 26.224999999999998 24.3625 24.4 25.0125 92-93 24.3875 24.875 24.1875 26.55 94-95 26.1625 24.175 24.025 25.637500000000003 96-97 25.8 24.075 24.2375 25.887500000000003 98-99 26.3 24.474999999999998 24.625 24.6 100-101 25.75 25.112499999999997 24.0 25.137500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 0.5 27 2.0 28 2.5 29 4.5 30 6.5 31 6.5 32 10.0 33 16.5 34 23.5 35 30.5 36 46.5 37 58.5 38 67.5 39 89.0 40 113.0 41 126.5 42 138.0 43 161.0 44 184.0 45 199.0 46 194.5 47 182.0 48 177.0 49 163.5 50 146.5 51 142.5 52 134.0 53 127.0 54 121.0 55 104.0 56 89.5 57 78.5 58 73.5 59 74.0 60 73.0 61 70.0 62 62.5 63 59.0 64 63.5 65 66.0 66 69.0 67 60.0 68 51.5 69 49.0 70 46.0 71 44.0 72 37.0 73 33.0 74 29.5 75 21.0 76 15.5 77 17.5 78 13.5 79 5.5 80 6.5 81 6.0 82 1.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCGGC 15 0.009957196 47.5 90-91 >>END_MODULE Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965067 spots for SRR10380965.sra Written 965067 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra Read 965061 spots for SRR10380965.sra Written 965061 spots for SRR10380965.sra SRR ids: ['SRR10380965.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xkwfym5t SRR10380965.sra spots: 19301226 blocks: [[1, 965061], [965062, 1930122], [1930123, 2895183], [2895184, 3860244], [3860245, 4825305], [4825306, 5790366], [5790367, 6755427], [6755428, 7720488], [7720489, 8685549], [8685550, 9650610], [9650611, 10615671], [10615672, 11580732], [11580733, 12545793], [12545794, 13510854], [13510855, 14475915], [14475916, 15440976], [15440977, 16406037], [16406038, 17371098], [17371099, 18336159], [18336160, 19301226]] SRR10380965 file size 5294953 SRR10380965 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380965 SRR10380965_1.fastq SRR10380965_2.fastq Input file: SRR10380965_1.fastq Paired file: SRR10380965_2.fastq trimmed: SRR10380965-trimmed-pair1.fastq, SRR10380965-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:52:15 2024 >> started Sat Dec 7 15:52:36 2024 >> done (20.915s) 19301226 read pairs processed; of these: 79724 ( 0.41%) short read pairs filtered out after trimming by size control 563690 ( 2.92%) empty read pairs filtered out after trimming by size control 18657812 (96.67%) read pairs available; of these: 1622944 ( 8.70%) trimmed read pairs available after processing 17034868 (91.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 263 0.00% 19 279 0.00% 20 318 0.00% 21 299 0.00% 22 330 0.00% 23 368 0.00% 24 362 0.00% 25 406 0.00% 26 472 0.00% 27 530 0.00% 28 511 0.00% 29 601 0.00% 30 637 0.00% 31 699 0.00% 32 752 0.00% 33 860 0.00% 34 881 0.00% 35 960 0.01% 36 1023 0.01% 37 1042 0.01% 38 1144 0.01% 39 1186 0.01% 40 1232 0.01% 41 1328 0.01% 42 1417 0.01% 43 1424 0.01% 44 1537 0.01% 45 1610 0.01% 46 1621 0.01% 47 1761 0.01% 48 1813 0.01% 49 1957 0.01% 50 2007 0.01% 51 2200 0.01% 52 2237 0.01% 53 2281 0.01% 54 2496 0.01% 55 2739 0.01% 56 2878 0.02% 57 3251 0.02% 58 3506 0.02% 59 7609 0.04% 60 11662 0.06% 61 12548 0.07% 62 13631 0.07% 63 14967 0.08% 64 15426 0.08% 65 16167 0.09% 66 17015 0.09% 67 17372 0.09% 68 17931 0.10% 69 18776 0.10% 70 19197 0.10% 71 19435 0.10% 72 20148 0.11% 73 20621 0.11% 74 21357 0.11% 75 21278 0.11% 76 21818 0.12% 77 21921 0.12% 78 22605 0.12% 79 22556 0.12% 80 23213 0.12% 81 24152 0.13% 82 25039 0.13% 83 25355 0.14% 84 26670 0.14% 85 27050 0.14% 86 28717 0.15% 87 30197 0.16% 88 31518 0.17% 89 33847 0.18% 90 36432 0.20% 91 39342 0.21% 92 42883 0.23% 93 47778 0.26% 94 53471 0.29% 95 60625 0.32% 96 76032 0.41% 97 84277 0.45% 98 106427 0.57% 99 139476 0.75% 100 233185 1.25% 101 17034868 91.30% 18657812 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=185.53 fanout-score-rank=14 prefix-density=0.85 prefix-fanout=23.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=387.83 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=26.5 sequence=GCGGCGGCGGCC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=188.22 fanout-score-rank=16 prefix-density=0.87 prefix-fanout=23.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=397.89 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=23.4 sequence=CCGCCGCCGCCTCC SRR10380965 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:53:16 Started mapping on | Dec 07 15:53:16 Finished on | Dec 07 15:54:03 Mapping speed, Million of reads per hour | 1429.11 Number of input reads | 18657812 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 18111891 Uniquely mapped reads % | 97.07% Average mapped length | 198.63 Number of splices: Total | 11061041 Number of splices: Annotated (sjdb) | 10401690 Number of splices: GT/AG | 10910898 Number of splices: GC/AG | 130543 Number of splices: AT/AC | 7737 Number of splices: Non-canonical | 11863 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 187119 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 22752 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 373407 373407 373407 N_multimapping 187119 187119 187119 N_noFeature 699543 9178074 9292340 N_ambiguous 381649 21520 21332 UnstrandedReadsAssigned:17030699 PositiveStrandReadsAssigned:8912297 NegativeStrandReadsAssigned:8798219 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380965 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380965-trimmed-pair1.fastq SRR10380965-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,657,812 reads, 17,652,396 reads pseudoaligned [quant] estimated average fragment length: 205.48 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR10380965.ke.tsv 35125 SRR10380965.se.tsv 88098 total ==> SRR10380965.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 731.839 0 0 PNS24247 1044 839.52 71.1498 7.14349 PNS24249 1928 1723.52 213.935 10.4624 PNS24246 1044 839.52 71.1498 7.14349 PNS24248 1044 839.52 71.1498 7.14349 PNS24244 1471 1266.52 115.616 7.69439 PNS24243 293 116.586 21 15.1824 KQK14069 1603 1398.52 5646.22 340.296 KQK14071 474 278.078 400.177 121.298 ==> SRR10380965.se.tsv <== BRADI_1g14170v3 6450 BRADI_1g53295v3 126 BRADI_1g59795v3 353 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 874 BRADI_1g74790v3 1521 BRADI_1g09890v3 5 BRADI_1g77505v3 203 BRADI_1g48960v3 0 SRR10380965 completed mapping pipeline successfully