Starting /dee2/code/volunteer_pipeline.sh SRR10380966 current disk space = 1542191431680 free memory = 1599154260 SRR10380966 SRAfilesize 52695a1e1dd35bbf50fd222bf6f2a2d8 SRR10380966.sra SRR10380966.sra file validated SRR10380966 is paired end SRR10380966 is conventional basespace SRR10380966 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380966_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.804 34.0 33.0 34.0 31.0 34.0 2 33.122 34.0 34.0 34.0 31.0 34.0 3 33.3355 34.0 34.0 34.0 31.0 34.0 4 36.61825 37.0 37.0 37.0 35.0 37.0 5 36.557 37.0 37.0 37.0 35.0 37.0 6 36.5615 37.0 37.0 37.0 35.0 37.0 7 36.45675 37.0 37.0 37.0 35.0 37.0 8 36.556 37.0 37.0 37.0 35.0 37.0 9 38.38 39.0 39.0 39.0 37.0 39.0 10-11 38.447 39.0 39.0 39.0 37.0 39.0 12-13 38.4585 39.0 39.0 39.0 37.0 39.0 14-15 40.172625 41.0 40.0 41.0 38.0 41.0 16-17 40.192 41.0 40.0 41.0 38.0 41.0 18-19 40.149 41.0 40.0 41.0 38.0 41.0 20-21 40.08675 41.0 40.0 41.0 38.0 41.0 22-23 40.077625 41.0 40.0 41.0 38.0 41.0 24-25 40.033375 41.0 40.0 41.0 38.0 41.0 26-27 39.991875 41.0 40.0 41.0 38.0 41.0 28-29 39.914375 41.0 40.0 41.0 37.0 41.0 30-31 39.805625000000006 41.0 40.0 41.0 37.0 41.0 32-33 39.763625 41.0 40.0 41.0 37.0 41.0 34-35 39.626374999999996 41.0 40.0 41.0 36.0 41.0 36-37 39.43 41.0 39.0 41.0 35.0 41.0 38-39 39.302875 41.0 39.0 41.0 35.0 41.0 40-41 39.065124999999995 41.0 38.5 41.0 35.0 41.0 42-43 38.921125 41.0 38.0 41.0 35.0 41.0 44-45 38.629625000000004 41.0 37.0 41.0 35.0 41.0 46-47 38.632999999999996 41.0 37.0 41.0 35.0 41.0 48-49 38.426249999999996 40.0 36.5 41.0 35.0 41.0 50-51 38.272625000000005 40.0 35.5 41.0 35.0 41.0 52-53 38.108125 40.0 35.0 41.0 35.0 41.0 54-55 37.845375000000004 39.5 35.0 41.0 34.5 41.0 56-57 37.669875 39.0 35.0 41.0 34.5 41.0 58-59 37.485375000000005 39.0 35.0 41.0 34.0 41.0 60-61 37.22325 38.5 35.0 41.0 34.0 41.0 62-63 37.0045 37.0 35.0 41.0 34.0 41.0 64-65 36.748 37.0 35.0 40.0 34.0 41.0 66-67 36.335375 36.0 35.0 39.0 33.0 41.0 68-69 36.01525 36.0 35.0 39.0 33.5 41.0 70-71 35.623000000000005 35.0 35.0 38.0 33.0 41.0 72-73 35.170375 35.0 35.0 37.0 33.0 39.5 74-75 34.40325 35.0 35.0 37.0 32.5 39.0 76-77 33.22625 35.0 35.0 36.0 30.0 39.0 78-79 32.973375 35.0 35.0 36.0 29.0 37.0 80-81 32.78875 35.0 35.0 35.5 29.0 37.0 82-83 32.650375 35.0 35.0 35.0 29.0 36.5 84-85 32.527375 35.0 35.0 35.0 29.0 36.0 86-87 32.405375 35.0 35.0 35.0 29.0 36.0 88-89 32.338750000000005 35.0 35.0 35.0 29.0 36.0 90-91 32.21025 35.0 35.0 35.0 29.0 35.5 92-93 32.176874999999995 35.0 34.5 35.0 29.0 35.0 94-95 32.00725 35.0 34.5 35.0 27.0 35.0 96-97 31.9655 35.0 34.0 35.0 29.0 35.0 98-99 31.83 35.0 34.0 35.0 27.0 35.0 100-101 30.8875 34.5 32.5 35.0 22.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 2.0 13 5.0 14 3.0 15 4.0 16 1.0 17 3.0 18 6.0 19 1.0 20 7.0 21 3.0 22 3.0 23 7.0 24 17.0 25 8.0 26 21.0 27 25.0 28 48.0 29 160.0 30 28.0 31 30.0 32 55.0 33 67.0 34 108.0 35 213.0 36 585.0 37 924.0 38 1333.0 39 330.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.89100126742712 10.570342205323193 10.646387832699618 44.89226869455006 2 24.375 22.275 26.55 26.8 3 25.1 18.4 24.4 32.1 4 28.625 22.725 16.525000000000002 32.125 5 36.8 23.075000000000003 19.025 21.099999999999998 6 30.325000000000003 30.5 18.375 20.8 7 22.3 25.25 31.525 20.925 8 22.45 26.875 23.875 26.8 9 29.15 20.625 27.500000000000004 22.725 10-11 27.925 29.262500000000003 20.0 22.8125 12-13 23.825 24.55 23.5 28.125 14-15 23.3 25.25 23.474999999999998 27.975 16-17 26.974999999999998 22.112499999999997 22.3625 28.549999999999997 18-19 24.0125 22.6375 24.9125 28.4375 20-21 27.1625 23.5375 24.775 24.525 22-23 24.9125 28.3375 22.037499999999998 24.712500000000002 24-25 23.5375 22.900000000000002 25.525 28.037499999999998 26-27 24.1375 22.9875 22.400000000000002 30.475 28-29 28.15 25.0625 22.2125 24.575 30-31 24.762500000000003 22.875 24.8125 27.55 32-33 24.875 25.924999999999997 22.2 27.0 34-35 27.325 24.887500000000003 21.575 26.2125 36-37 24.462500000000002 22.525000000000002 27.950000000000003 25.0625 38-39 24.55 22.4875 22.425 30.5375 40-41 26.6125 23.025000000000002 25.0625 25.3 42-43 24.49056132016502 25.065633204150515 26.24078009751219 24.20302537817227 44-45 24.428053506688336 22.490311288911112 25.653206650831358 27.428428553569194 46-47 28.166020752594072 21.965245655706962 21.877734716839605 27.990998874859358 48-49 23.85596399099775 25.381345336334082 25.831457864466117 24.93123280820205 50-51 26.775887943971988 23.19909954977489 25.22511255627814 24.79989994997499 52-53 23.69804707060591 22.47120681021532 22.721582373560338 31.109163745618428 54-55 27.143035915404827 22.500312851958455 25.50369165310975 24.852959579526967 56-57 24.0180135101326 23.617713284963724 24.818613960470355 27.545659244433324 58-59 25.175087543771884 22.39869934967484 25.337668834417208 27.088544272136065 60-61 27.431857964491122 22.80570142535634 25.256314078519633 24.50612653163291 62-63 24.0375 22.375 24.55 29.037499999999998 64-65 28.050000000000004 22.6125 25.587500000000002 23.75 66-67 24.975 28.199999999999996 22.4625 24.3625 68-69 24.0 28.249999999999996 22.162499999999998 25.587500000000002 70-71 24.5625 27.6625 23.225 24.55 72-73 23.6875 29.1125 22.4375 24.762500000000003 74-75 23.9375 28.475 22.8625 24.725 76-77 25.7 26.6625 22.45 25.1875 78-79 24.2875 26.3625 23.525 25.825 80-81 25.324999999999996 25.75 23.0625 25.8625 82-83 25.55 24.925 23.9125 25.6125 84-85 25.55 25.724999999999998 23.225 25.5 86-87 25.687500000000004 25.124999999999996 23.2125 25.974999999999998 88-89 25.8125 24.8125 23.3375 26.0375 90-91 24.337500000000002 24.675 23.549999999999997 27.437499999999996 92-93 25.912499999999998 24.25 23.025000000000002 26.8125 94-95 25.474999999999998 25.162499999999998 22.8625 26.5 96-97 26.8 24.2875 23.7 25.2125 98-99 26.5375 24.075 23.9125 25.474999999999998 100-101 26.450000000000003 23.5375 24.099999999999998 25.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.0 27 0.5 28 1.0 29 1.0 30 2.0 31 7.0 32 9.5 33 9.0 34 14.0 35 23.5 36 35.5 37 49.5 38 65.0 39 87.0 40 102.5 41 119.5 42 148.0 43 158.5 44 174.0 45 176.5 46 172.0 47 195.0 48 178.0 49 147.0 50 142.5 51 133.0 52 130.0 53 130.5 54 124.5 55 108.0 56 86.5 57 80.5 58 81.0 59 80.5 60 78.0 61 78.5 62 71.5 63 62.0 64 65.0 65 64.0 66 63.5 67 70.0 68 66.5 69 60.0 70 61.0 71 51.0 72 38.0 73 33.0 74 34.5 75 30.0 76 22.5 77 22.0 78 17.5 79 12.0 80 10.0 81 6.5 82 2.5 83 1.5 84 1.0 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0125 46-47 0.0125 48-49 0.025 50-51 0.05 52-53 0.15 54-55 0.11249999999999999 56-57 0.075 58-59 0.05 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.86796936889358 94.55 2 0.10562450488513335 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026406126221283337 5.25 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCGTATCTCGTAT 210 5.25 TruSeq Adapter, Index 14 (97% over 44bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 30 9.458745E-9 95.0 6 AGAGCAC 30 9.458745E-9 95.0 8 GGAAGAG 30 9.458745E-9 95.0 5 AAGAGCA 35 2.7595888E-8 81.428566 7 GATCGGA 35 2.7595888E-8 81.428566 1 TCGGAAG 35 2.7595888E-8 81.428566 3 GAGCACA 35 2.7595888E-8 81.428566 9 CGGAAGA 35 2.7595888E-8 81.428566 4 ATCGGAA 35 2.7595888E-8 81.428566 2 ACACGTC 30 1.3137887E-6 47.5 12-13 GTATGCC 30 1.3137887E-6 47.5 46-47 CAGTTCC 30 1.3137887E-6 47.5 32-33 CAGTCAC 30 1.3137887E-6 47.5 26-27 GTCACAG 30 1.3137887E-6 47.5 28-29 CACACGT 30 1.3137887E-6 47.5 12-13 ACGTCTG 30 1.3137887E-6 47.5 14-15 TTCCGTA 30 1.3137887E-6 47.5 36-37 CACGTCT 30 1.3137887E-6 47.5 14-15 GTTCCGT 30 1.3137887E-6 47.5 34-35 TATGCCG 30 1.3137887E-6 47.5 48-49 >>END_MODULE SRR10380966 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380966_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0595 34.0 31.0 34.0 30.0 34.0 2 31.19 34.0 31.0 34.0 30.0 34.0 3 31.303 34.0 33.0 34.0 30.0 34.0 4 34.397 37.0 37.0 37.0 33.0 37.0 5 34.4205 37.0 37.0 37.0 35.0 37.0 6 34.354 37.0 37.0 37.0 33.0 37.0 7 34.3625 37.0 37.0 37.0 33.0 37.0 8 34.38725 37.0 37.0 37.0 35.0 37.0 9 36.1115 39.0 39.0 39.0 34.0 39.0 10-11 36.173875 39.0 39.0 39.0 35.0 39.0 12-13 36.10525 39.0 39.0 39.0 34.0 39.0 14-15 37.67675 41.0 40.0 41.0 34.5 41.0 16-17 37.6335 41.0 40.0 41.0 34.5 41.0 18-19 37.59375 41.0 40.0 41.0 33.5 41.0 20-21 37.607625 41.0 40.0 41.0 34.0 41.0 22-23 37.541375 41.0 40.0 41.0 33.5 41.0 24-25 37.46875 41.0 40.0 41.0 34.0 41.0 26-27 37.4805 41.0 40.0 41.0 34.0 41.0 28-29 37.334 41.0 39.0 41.0 33.0 41.0 30-31 37.223625 41.0 39.0 41.0 33.0 41.0 32-33 37.150125 41.0 39.0 41.0 33.0 41.0 34-35 37.096999999999994 41.0 39.0 41.0 32.5 41.0 36-37 36.931875000000005 41.0 38.0 41.0 32.5 41.0 38-39 36.78425 41.0 38.0 41.0 32.0 41.0 40-41 36.682625 41.0 37.0 41.0 31.0 41.0 42-43 36.551625 41.0 37.0 41.0 31.5 41.0 44-45 36.347875 40.5 35.5 41.0 31.0 41.0 46-47 36.177499999999995 40.0 35.0 41.0 30.5 41.0 48-49 36.0185 40.0 35.0 41.0 30.0 41.0 50-51 35.8225 40.0 35.0 41.0 30.0 41.0 52-53 35.57625 39.5 35.0 41.0 29.0 41.0 54-55 35.372 39.0 35.0 41.0 28.5 41.0 56-57 35.154875000000004 39.0 35.0 41.0 27.5 41.0 58-59 34.911375 38.0 35.0 41.0 27.0 41.0 60-61 34.691625 37.0 35.0 41.0 27.0 41.0 62-63 34.448750000000004 36.5 35.0 41.0 26.5 41.0 64-65 34.130875 36.0 35.0 40.0 27.0 41.0 66-67 33.832375 35.5 35.0 39.0 26.0 41.0 68-69 33.543125 35.0 35.0 39.0 26.0 41.0 70-71 33.306625 35.0 35.0 38.0 26.0 41.0 72-73 32.925250000000005 35.0 35.0 37.0 25.5 39.0 74-75 32.715500000000006 35.0 35.0 37.0 25.5 39.0 76-77 32.426 35.0 35.0 36.0 25.0 39.0 78-79 32.19925 35.0 35.0 36.0 24.5 37.0 80-81 32.025125 35.0 34.5 35.5 24.0 37.0 82-83 31.895375 35.0 34.0 35.0 24.5 36.5 84-85 31.655625 35.0 34.0 35.0 23.0 36.0 86-87 31.592 35.0 34.0 35.0 23.5 36.0 88-89 31.426499999999997 35.0 34.0 35.0 21.5 36.0 90-91 31.318375 35.0 34.0 35.0 21.0 35.0 92-93 31.190375 35.0 34.0 35.0 19.0 35.0 94-95 31.129125000000002 35.0 34.0 35.0 13.5 35.0 96-97 31.031875 35.0 34.0 35.0 5.0 35.0 98-99 30.915875 35.0 34.0 35.0 2.0 35.0 100-101 29.870625 34.5 31.5 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 234.0 3 3.0 4 3.0 5 1.0 6 4.0 7 3.0 8 3.0 9 4.0 10 5.0 11 1.0 12 3.0 13 1.0 14 3.0 15 9.0 16 5.0 17 3.0 18 6.0 19 5.0 20 7.0 21 12.0 22 5.0 23 11.0 24 12.0 25 10.0 26 14.0 27 11.0 28 15.0 29 44.0 30 30.0 31 37.0 32 61.0 33 49.0 34 104.0 35 238.0 36 536.0 37 866.0 38 1321.0 39 320.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.825 10.4 11.65 44.125 2 25.05 22.35 25.575 27.025 3 24.45 19.325 24.725 31.5 4 30.2 21.925 17.025000000000002 30.85 5 33.975 25.874999999999996 18.175 21.975 6 31.05 30.375000000000004 17.625 20.95 7 25.4 21.4 30.95 22.25 8 21.825 28.299999999999997 24.45 25.424999999999997 9 26.775 21.325 26.575 25.324999999999996 10-11 27.150000000000002 29.599999999999998 19.85 23.400000000000002 12-13 28.275 22.075 23.4625 26.187500000000004 14-15 26.4125 23.5 23.45 26.637499999999996 16-17 29.65 22.875 22.6125 24.8625 18-19 28.237499999999997 22.3375 23.9875 25.4375 20-21 27.187499999999996 25.887500000000003 23.05 23.875 22-23 30.7 22.912499999999998 21.65 24.7375 24-25 26.900000000000002 25.912499999999998 22.0875 25.1 26-27 25.9875 26.987499999999997 21.975 25.05 28-29 27.224999999999998 24.95 22.112499999999997 25.7125 30-31 30.2125 22.9375 21.175 25.674999999999997 32-33 26.4625 25.587500000000002 23.35 24.6 34-35 26.55 26.400000000000002 21.8875 25.162499999999998 36-37 24.525 24.2625 24.975 26.237500000000004 38-39 24.0625 23.05 24.925 27.962500000000002 40-41 29.512500000000003 23.2375 22.825 24.425 42-43 28.849999999999998 22.6875 22.925 25.5375 44-45 29.5875 22.9625 22.1875 25.2625 46-47 27.9125 22.975 22.35 26.7625 48-49 25.4625 23.0625 21.9 29.575000000000003 50-51 28.3875 23.35 22.6375 25.624999999999996 52-53 25.8625 24.125 25.1875 24.825 54-55 25.124999999999996 23.7 23.974999999999998 27.200000000000003 56-57 24.4875 23.6625 26.637499999999996 25.2125 58-59 24.625 26.0125 24.125 25.2375 60-61 24.4875 27.925 22.650000000000002 24.9375 62-63 25.2 28.6875 21.85 24.2625 64-65 25.1 28.3125 22.1375 24.45 66-67 23.7625 28.237499999999997 23.075000000000003 24.925 68-69 26.2125 27.9375 21.825 24.025 70-71 25.7625 26.2875 22.6875 25.2625 72-73 24.5 26.450000000000003 23.0625 25.9875 74-75 26.3 25.85 23.375 24.474999999999998 76-77 26.474999999999998 25.7125 22.7125 25.1 78-79 25.337500000000002 25.362499999999997 23.425 25.874999999999996 80-81 26.7125 25.1 22.875 25.3125 82-83 26.5875 25.2375 22.5125 25.662499999999998 84-85 25.874999999999996 25.275 23.375 25.474999999999998 86-87 26.7125 24.675 23.0625 25.55 88-89 26.5125 24.837500000000002 23.0875 25.5625 90-91 26.337500000000002 23.5125 23.549999999999997 26.6 92-93 26.0375 24.099999999999998 23.5625 26.3 94-95 26.174999999999997 24.7875 22.975 26.0625 96-97 26.787499999999998 24.962500000000002 22.4875 25.7625 98-99 26.5625 24.0375 23.1125 26.2875 100-101 28.15 24.525 22.4625 24.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.0 29 3.5 30 4.5 31 5.0 32 8.0 33 12.0 34 13.0 35 19.5 36 35.0 37 45.0 38 58.0 39 78.0 40 89.0 41 111.0 42 134.5 43 136.0 44 154.0 45 173.0 46 174.5 47 174.0 48 173.0 49 170.0 50 166.0 51 160.5 52 146.0 53 134.5 54 117.5 55 102.5 56 97.5 57 86.5 58 80.0 59 77.0 60 66.5 61 72.0 62 79.0 63 71.0 64 73.0 65 75.0 66 66.5 67 61.5 68 59.5 69 59.5 70 60.0 71 52.5 72 44.5 73 45.5 74 41.0 75 31.5 76 28.5 77 27.0 78 19.0 79 10.5 80 7.0 81 3.5 82 1.5 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79944848332916 99.52499999999999 2 0.12534469791927802 0.25 3 0.0752068187515668 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGG 15 6.142176E-4 95.0 1 ATCGGGA 15 6.142176E-4 95.0 2 CGGGAGA 15 6.142176E-4 95.0 4 TCGGGAG 15 6.142176E-4 95.0 3 GAGAGGG 20 0.0019257745 71.25 7 GAGGGGC 20 0.0019257745 71.25 9 GGAGAGG 25 0.0046641747 57.0 6 GGGAGAG 35 2.4648316E-4 54.28571 5 AGGGGAG 20 5.0718547E-4 47.500004 28-29 CGGGGGG 20 5.0718547E-4 47.500004 38-39 CATTTAA 20 5.0718547E-4 47.500004 54-55 GCCGGAT 20 5.0718547E-4 47.500004 46-47 CTCGGGG 20 5.0718547E-4 47.500004 36-37 TCATTTA 20 5.0718547E-4 47.500004 52-53 AGGGGCG 15 0.009957196 47.5 10-11 CCGGATC 15 0.009957196 47.5 48-49 TAAAAAA 25 2.5814552E-5 47.5 58-59 CGGATCA 15 0.009957196 47.5 48-49 TGGGGAA 15 0.009957196 47.5 20-21 GGGGGGC 25 2.5814552E-5 47.5 40-41 >>END_MODULE Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848703 spots for SRR10380966.sra Written 848703 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra Read 848686 spots for SRR10380966.sra Written 848686 spots for SRR10380966.sra SRR ids: ['SRR10380966.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_grcs1d75 SRR10380966.sra spots: 16973737 blocks: [[1, 848686], [848687, 1697372], [1697373, 2546058], [2546059, 3394744], [3394745, 4243430], [4243431, 5092116], [5092117, 5940802], [5940803, 6789488], [6789489, 7638174], [7638175, 8486860], [8486861, 9335546], [9335547, 10184232], [10184233, 11032918], [11032919, 11881604], [11881605, 12730290], [12730291, 13578976], [13578977, 14427662], [14427663, 15276348], [15276349, 16125034], [16125035, 16973737]] SRR10380966 file size 4655134 SRR10380966 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380966 SRR10380966_1.fastq SRR10380966_2.fastq Input file: SRR10380966_1.fastq Paired file: SRR10380966_2.fastq trimmed: SRR10380966-trimmed-pair1.fastq, SRR10380966-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:55:46 2024 >> started Sat Dec 7 15:56:03 2024 >> done (16.752s) 16973737 read pairs processed; of these: 70568 ( 0.42%) short read pairs filtered out after trimming by size control 1024450 ( 6.04%) empty read pairs filtered out after trimming by size control 15878719 (93.55%) read pairs available; of these: 1461471 ( 9.20%) trimmed read pairs available after processing 14417248 (90.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 146 0.00% 19 151 0.00% 20 155 0.00% 21 184 0.00% 22 195 0.00% 23 263 0.00% 24 293 0.00% 25 313 0.00% 26 355 0.00% 27 432 0.00% 28 457 0.00% 29 530 0.00% 30 509 0.00% 31 594 0.00% 32 634 0.00% 33 727 0.00% 34 802 0.01% 35 826 0.01% 36 923 0.01% 37 1013 0.01% 38 1031 0.01% 39 1082 0.01% 40 1135 0.01% 41 1263 0.01% 42 1282 0.01% 43 1301 0.01% 44 1328 0.01% 45 1438 0.01% 46 1544 0.01% 47 1631 0.01% 48 1696 0.01% 49 1717 0.01% 50 1823 0.01% 51 1933 0.01% 52 2001 0.01% 53 2050 0.01% 54 2214 0.01% 55 2407 0.02% 56 2675 0.02% 57 2884 0.02% 58 3152 0.02% 59 6948 0.04% 60 10971 0.07% 61 12017 0.08% 62 12988 0.08% 63 13867 0.09% 64 14315 0.09% 65 15086 0.10% 66 16124 0.10% 67 16182 0.10% 68 17104 0.11% 69 17284 0.11% 70 18128 0.11% 71 17772 0.11% 72 18510 0.12% 73 19234 0.12% 74 19104 0.12% 75 19534 0.12% 76 19991 0.13% 77 19892 0.13% 78 20593 0.13% 79 21064 0.13% 80 21453 0.14% 81 21752 0.14% 82 22619 0.14% 83 22891 0.14% 84 24016 0.15% 85 24235 0.15% 86 25497 0.16% 87 26846 0.17% 88 28016 0.18% 89 30182 0.19% 90 32804 0.21% 91 34413 0.22% 92 37518 0.24% 93 42016 0.26% 94 46462 0.29% 95 53091 0.33% 96 67171 0.42% 97 73319 0.46% 98 94124 0.59% 99 124718 0.79% 100 214531 1.35% 101 14417248 90.80% 15878719 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=187.44 fanout-score-rank=18 prefix-density=1.06 prefix-fanout=23.5 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=423.80 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=23.5 sequence=CGCCGCCGCCAT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=180.68 fanout-score-rank=18 prefix-density=1.09 prefix-fanout=23.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=35 fanout-score=439.52 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=24.1 sequence=CCGCCGCCGCAGC SRR10380966 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:56:41 Started mapping on | Dec 07 15:56:42 Finished on | Dec 07 15:57:13 Mapping speed, Million of reads per hour | 1843.98 Number of input reads | 15878719 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 15420286 Uniquely mapped reads % | 97.11% Average mapped length | 198.41 Number of splices: Total | 9155243 Number of splices: Annotated (sjdb) | 8595910 Number of splices: GT/AG | 9028920 Number of splices: GC/AG | 109156 Number of splices: AT/AC | 6611 Number of splices: Non-canonical | 10556 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 164979 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 19568 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 306419 306419 306419 N_multimapping 164979 164979 164979 N_noFeature 515663 7816173 7845282 N_ambiguous 309388 18454 18275 UnstrandedReadsAssigned:14595235 PositiveStrandReadsAssigned:7585659 NegativeStrandReadsAssigned:7556729 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380966 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380966-trimmed-pair1.fastq SRR10380966-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,878,719 reads, 15,115,701 reads pseudoaligned [quant] estimated average fragment length: 213.691 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR10380966.ke.tsv 35125 SRR10380966.se.tsv 88098 total ==> SRR10380966.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.642 0 0 PNS24247 1044 831.309 42.6945 4.84939 PNS24249 1928 1715.31 233.81 12.8706 PNS24246 1044 831.309 42.6945 4.84939 PNS24248 1044 831.309 42.6945 4.84939 PNS24244 1471 1258.31 84.1064 6.31131 PNS24243 293 111.319 22 18.6609 KQK14069 1603 1390.31 4794.25 325.602 KQK14071 474 270.607 372.173 129.863 ==> SRR10380966.se.tsv <== BRADI_1g14170v3 5489 BRADI_1g53295v3 103 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 853 BRADI_1g74790v3 1035 BRADI_1g09890v3 3 BRADI_1g77505v3 173 BRADI_1g48960v3 0 SRR10380966 completed mapping pipeline successfully