Starting /dee2/code/volunteer_pipeline.sh SRR10380967 current disk space = 1542197604352 free memory = 1602122956 SRR10380967 SRAfilesize 27f6a4dd08b70de98098063ae36bce9a SRR10380967.sra SRR10380967.sra file validated SRR10380967 is paired end SRR10380967 is conventional basespace SRR10380967 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380967_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6535 34.0 33.0 34.0 31.0 34.0 2 33.06025 34.0 34.0 34.0 31.0 34.0 3 33.3075 34.0 34.0 34.0 31.0 34.0 4 36.6325 37.0 37.0 37.0 35.0 37.0 5 36.50725 37.0 37.0 37.0 35.0 37.0 6 36.566 37.0 37.0 37.0 35.0 37.0 7 36.49375 37.0 37.0 37.0 35.0 37.0 8 36.5705 37.0 37.0 37.0 35.0 37.0 9 38.467 39.0 39.0 39.0 37.0 39.0 10-11 38.509249999999994 39.0 39.0 39.0 37.5 39.0 12-13 38.497375 39.0 39.0 39.0 37.0 39.0 14-15 40.217625 41.0 40.0 41.0 38.0 41.0 16-17 40.191874999999996 41.0 40.0 41.0 38.0 41.0 18-19 40.205125 41.0 40.0 41.0 38.0 41.0 20-21 40.12 41.0 40.0 41.0 38.0 41.0 22-23 40.106 41.0 40.0 41.0 38.0 41.0 24-25 40.053375 41.0 40.0 41.0 38.0 41.0 26-27 39.9835 41.0 40.0 41.0 38.0 41.0 28-29 39.918625 41.0 40.0 41.0 38.0 41.0 30-31 39.851749999999996 41.0 40.0 41.0 37.0 41.0 32-33 39.769499999999994 41.0 40.0 41.0 37.0 41.0 34-35 39.662625000000006 41.0 40.0 41.0 36.5 41.0 36-37 39.490625 41.0 39.5 41.0 35.0 41.0 38-39 39.388000000000005 41.0 39.0 41.0 35.0 41.0 40-41 39.230375 41.0 39.0 41.0 35.0 41.0 42-43 39.062375 41.0 38.5 41.0 35.0 41.0 44-45 38.776250000000005 41.0 37.0 41.0 35.0 41.0 46-47 38.698 41.0 37.0 41.0 35.0 41.0 48-49 38.504 40.5 36.5 41.0 35.0 41.0 50-51 38.38225 40.0 35.5 41.0 35.0 41.0 52-53 38.190375 40.0 35.0 41.0 35.0 41.0 54-55 37.927499999999995 40.0 35.0 41.0 35.0 41.0 56-57 37.69 39.0 35.0 41.0 35.0 41.0 58-59 37.487375 39.0 35.0 41.0 34.5 41.0 60-61 37.309875000000005 38.5 35.0 41.0 34.5 41.0 62-63 37.043 37.0 35.0 41.0 34.0 41.0 64-65 36.733125 37.0 35.0 40.0 34.0 41.0 66-67 36.39175 36.0 35.0 39.0 34.0 41.0 68-69 36.068 36.0 35.0 39.0 34.0 41.0 70-71 35.78275 35.0 35.0 38.0 34.0 41.0 72-73 35.41175 35.0 35.0 37.0 33.0 39.5 74-75 34.87475 35.0 35.0 37.0 33.0 39.0 76-77 34.117125 35.0 35.0 36.0 32.0 39.0 78-79 33.9225 35.0 35.0 36.0 32.0 37.0 80-81 33.753625 35.0 35.0 35.5 32.0 37.0 82-83 33.646875 35.0 35.0 35.0 32.0 36.5 84-85 33.552625 35.0 35.0 35.0 32.0 36.0 86-87 33.427125000000004 35.0 35.0 35.0 32.0 36.0 88-89 33.2845 35.0 35.0 35.0 31.5 36.0 90-91 33.16575 35.0 35.0 35.0 31.0 35.0 92-93 33.067875 35.0 35.0 35.0 31.0 35.0 94-95 33.019000000000005 35.0 35.0 35.0 31.0 35.0 96-97 32.971125 35.0 35.0 35.0 31.0 35.0 98-99 32.810249999999996 35.0 35.0 35.0 31.0 35.0 100-101 31.838875 34.5 33.0 35.0 27.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 2.0 12 1.0 13 2.0 14 1.0 15 1.0 16 3.0 17 5.0 18 1.0 19 4.0 20 3.0 21 4.0 22 4.0 23 4.0 24 8.0 25 7.0 26 17.0 27 17.0 28 34.0 29 79.0 30 22.0 31 41.0 32 50.0 33 59.0 34 117.0 35 224.0 36 607.0 37 935.0 38 1410.0 39 334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.52768563409033 11.686654758867059 12.145955600918603 47.63970400612401 2 23.25 20.925 28.675 27.150000000000002 3 25.3 18.525 22.400000000000002 33.775 4 29.325000000000003 21.475 16.875 32.324999999999996 5 33.375 25.775 19.650000000000002 21.2 6 29.45 30.175 18.475 21.9 7 22.825 23.1 31.3 22.775000000000002 8 22.7 24.9 25.8 26.6 9 25.924999999999997 19.7 28.449999999999996 25.924999999999997 10-11 26.950000000000003 29.175 20.1625 23.7125 12-13 24.5125 24.125 24.05 27.3125 14-15 24.825 24.637500000000003 23.799999999999997 26.737499999999997 16-17 26.0625 23.275000000000002 23.400000000000002 27.2625 18-19 24.7375 24.712500000000002 23.2875 27.2625 20-21 26.487500000000004 24.0625 23.962500000000002 25.4875 22-23 25.4 26.375 23.05 25.174999999999997 24-25 25.324999999999996 24.349999999999998 24.175 26.150000000000002 26-27 25.087500000000002 23.5 23.5125 27.900000000000002 28-29 26.825 24.525 23.0 25.650000000000002 30-31 24.7375 23.925 23.974999999999998 27.3625 32-33 24.9375 25.474999999999998 23.849999999999998 25.7375 34-35 25.775 24.349999999999998 22.825 27.05 36-37 25.8 23.4375 24.2875 26.474999999999998 38-39 23.962500000000002 27.1625 23.5125 25.362499999999997 40-41 25.174999999999997 25.15 23.1875 26.487500000000004 42-43 25.1 24.7875 25.162499999999998 24.95 44-45 25.275 23.9875 24.1625 26.575 46-47 26.125 22.25 24.2375 27.3875 48-49 24.593648412103025 25.431357839459867 24.793698424606152 25.18129532383096 50-51 26.113056528264135 23.81190595297649 24.374687343671837 25.700350175087543 52-53 24.784078107397672 23.682563524846664 23.256978345224685 28.27638002253098 54-55 26.004254786634963 23.188587160555624 24.677762482793142 26.129395570016268 56-57 25.58808808808809 23.36086086086086 24.261761761761765 26.789289289289293 58-59 24.871826935100664 23.858947105164436 24.64674252844817 26.62248343128673 60-61 26.1625 24.15 24.3125 25.374999999999996 62-63 25.362499999999997 23.375 24.212500000000002 27.05 64-65 26.437500000000004 23.3375 25.2375 24.9875 66-67 24.95 26.325 23.7125 25.0125 68-69 24.95 26.7125 23.0875 25.25 70-71 25.2375 25.9875 22.912499999999998 25.8625 72-73 25.3125 26.174999999999997 23.1125 25.4 74-75 26.424999999999997 25.637500000000003 23.549999999999997 24.3875 76-77 26.0625 25.2625 23.05 25.624999999999996 78-79 25.474999999999998 24.6125 23.525 26.387500000000003 80-81 25.2 24.725 24.45 25.624999999999996 82-83 25.5 25.087500000000002 23.400000000000002 26.0125 84-85 26.0625 24.8125 23.3625 25.7625 86-87 26.087500000000002 24.837500000000002 23.1125 25.9625 88-89 26.3625 24.1875 23.225 26.224999999999998 90-91 26.3625 24.4375 22.8 26.400000000000002 92-93 26.474999999999998 24.675 23.4875 25.362499999999997 94-95 27.0125 24.2 23.1875 25.6 96-97 25.5125 24.65 24.1375 25.7 98-99 26.137500000000003 24.8 23.3375 25.724999999999998 100-101 27.1125 24.075 24.0375 24.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 1.5 29 6.5 30 8.5 31 6.5 32 9.5 33 12.0 34 16.0 35 21.5 36 30.5 37 45.5 38 62.5 39 92.0 40 118.0 41 130.0 42 144.5 43 150.0 44 145.5 45 159.0 46 173.0 47 175.0 48 167.0 49 169.5 50 171.5 51 154.5 52 136.5 53 124.5 54 103.5 55 88.5 56 95.0 57 85.5 58 78.0 59 86.5 60 79.0 61 67.0 62 68.0 63 68.0 64 78.5 65 75.0 66 69.0 67 70.0 68 69.0 69 62.5 70 41.5 71 44.0 72 50.0 73 41.0 74 32.5 75 26.0 76 24.5 77 20.5 78 16.0 79 12.5 80 7.0 81 3.0 82 1.5 83 0.5 84 1.5 85 2.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.025 50-51 0.05 52-53 0.13749999999999998 54-55 0.11249999999999999 56-57 0.1 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89733059548254 97.3 2 0.051334702258726904 0.1 3 0.025667351129363452 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.025667351129363452 2.5250000000000004 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTAT 101 2.5250000000000004 TruSeq Adapter, Index 13 (97% over 40bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.037500000000000006 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAAGA 20 1.5503467E-5 94.862495 4 AGAGCAC 20 1.5503467E-5 94.862495 8 GATCGGA 25 4.1253083E-5 77.8359 1 GAAGAGC 25 4.692497E-5 75.89 6 TCGGAAG 25 4.692497E-5 75.89 3 ATCGGAA 25 4.692497E-5 75.89 2 GGAAGAG 25 4.692497E-5 75.89 5 AAGAGCA 30 1.1580734E-4 63.24167 7 GAGCACA 30 1.1580734E-4 63.24167 9 GTATGCC 20 4.797176E-4 48.031643 46-47 TGCCGTC 20 4.797176E-4 48.031643 50-51 TATGCCG 20 4.797176E-4 48.031643 48-49 CCGTCTT 20 4.797176E-4 48.031643 52-53 ATGCCGT 20 4.797176E-4 48.031643 48-49 CGTATGC 20 4.797176E-4 48.031643 46-47 GCCGTCT 20 4.797176E-4 48.031643 50-51 ACAGTCA 20 5.108219E-4 47.431248 32-33 ACACGTC 20 5.108219E-4 47.431248 12-13 AACAATC 20 5.108219E-4 47.431248 38-39 AATCTCG 20 5.108219E-4 47.431248 40-41 >>END_MODULE SRR10380967 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380967_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.033 34.0 31.0 34.0 31.0 34.0 2 32.21525 34.0 33.0 34.0 31.0 34.0 3 32.2335 34.0 33.0 34.0 31.0 34.0 4 35.4385 37.0 37.0 37.0 35.0 37.0 5 35.42175 37.0 37.0 37.0 35.0 37.0 6 35.3925 37.0 37.0 37.0 35.0 37.0 7 35.3635 37.0 37.0 37.0 35.0 37.0 8 35.38575 37.0 37.0 37.0 35.0 37.0 9 37.2195 39.0 39.0 39.0 37.0 39.0 10-11 37.209500000000006 39.0 39.0 39.0 37.0 39.0 12-13 37.183125000000004 39.0 39.0 39.0 37.0 39.0 14-15 38.80925 41.0 40.0 41.0 37.0 41.0 16-17 38.766625 41.0 40.0 41.0 37.0 41.0 18-19 38.716125 41.0 40.0 41.0 36.5 41.0 20-21 38.693125 41.0 40.0 41.0 37.0 41.0 22-23 38.697500000000005 41.0 40.0 41.0 36.5 41.0 24-25 38.640875 41.0 40.0 41.0 36.5 41.0 26-27 38.578125 41.0 40.0 41.0 36.0 41.0 28-29 38.447125 41.0 40.0 41.0 35.0 41.0 30-31 38.38225 41.0 40.0 41.0 35.0 41.0 32-33 38.2805 41.0 40.0 41.0 35.0 41.0 34-35 38.172124999999994 41.0 39.5 41.0 35.0 41.0 36-37 38.027875 41.0 39.0 41.0 35.0 41.0 38-39 37.88275 41.0 39.0 41.0 35.0 41.0 40-41 37.782375 41.0 38.0 41.0 34.5 41.0 42-43 37.621 41.0 37.5 41.0 34.5 41.0 44-45 37.433375 41.0 37.0 41.0 33.5 41.0 46-47 37.249875 41.0 36.0 41.0 33.5 41.0 48-49 37.06375 40.0 35.5 41.0 33.0 41.0 50-51 36.884874999999994 40.0 35.0 41.0 33.0 41.0 52-53 36.650999999999996 40.0 35.0 41.0 33.0 41.0 54-55 36.486625000000004 39.5 35.0 41.0 33.0 41.0 56-57 36.28 39.0 35.0 41.0 33.0 41.0 58-59 36.045375 39.0 35.0 41.0 32.0 41.0 60-61 35.84925 37.5 35.0 41.0 32.0 41.0 62-63 35.556 37.0 35.0 41.0 31.0 41.0 64-65 35.280625 36.5 35.0 40.5 31.0 41.0 66-67 34.987750000000005 36.0 35.0 39.5 31.0 41.0 68-69 34.666875 35.5 35.0 39.0 31.0 41.0 70-71 34.385999999999996 35.0 35.0 39.0 31.0 41.0 72-73 34.05825 35.0 35.0 37.0 30.5 39.5 74-75 33.7305 35.0 35.0 37.0 29.5 39.0 76-77 33.474999999999994 35.0 35.0 36.0 30.0 39.0 78-79 33.2705 35.0 35.0 36.0 30.0 37.5 80-81 33.0585 35.0 35.0 35.5 29.5 37.0 82-83 32.852125 35.0 35.0 35.0 29.5 37.0 84-85 32.68275 35.0 35.0 35.0 29.5 36.0 86-87 32.588125000000005 35.0 35.0 35.0 29.0 36.0 88-89 32.489125 35.0 35.0 35.0 29.0 36.0 90-91 32.384125 35.0 35.0 35.0 29.0 36.0 92-93 32.253625 35.0 35.0 35.0 29.0 35.0 94-95 32.211375 35.0 34.0 35.0 29.0 35.0 96-97 32.106750000000005 35.0 34.0 35.0 28.5 35.0 98-99 32.055125000000004 35.0 34.0 35.0 28.0 35.0 100-101 30.961624999999998 34.5 32.5 35.0 23.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 121.0 3 5.0 4 3.0 5 4.0 6 2.0 7 2.0 8 1.0 9 3.0 10 4.0 11 5.0 12 5.0 13 1.0 14 5.0 15 4.0 16 6.0 17 8.0 18 9.0 19 4.0 20 10.0 21 5.0 22 9.0 23 5.0 24 7.0 25 11.0 26 21.0 27 11.0 28 16.0 29 30.0 30 18.0 31 40.0 32 50.0 33 66.0 34 90.0 35 193.0 36 548.0 37 909.0 38 1414.0 39 355.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.95723930982746 11.677919479869967 12.578144536134033 46.786696674168546 2 24.775 19.35 26.85 29.025000000000002 3 24.2 19.525000000000002 22.0 34.275 4 29.049999999999997 21.925 18.275 30.75 5 33.725 25.15 19.525000000000002 21.6 6 27.35 30.975 19.425 22.25 7 25.1 19.875 32.475 22.55 8 21.8 25.474999999999998 24.85 27.875 9 24.725 21.15 27.675 26.450000000000003 10-11 27.237499999999997 28.6625 19.8 24.3 12-13 26.400000000000002 23.6125 24.275 25.7125 14-15 26.075 22.662499999999998 24.587500000000002 26.674999999999997 16-17 27.237499999999997 23.7625 23.05 25.95 18-19 26.6125 23.425 24.0375 25.924999999999997 20-21 26.2625 23.95 24.087500000000002 25.7 22-23 27.150000000000002 23.6125 23.7125 25.525 24-25 26.075 25.025 23.325000000000003 25.575 26-27 25.2875 25.4625 23.4125 25.837500000000002 28-29 26.737499999999997 24.9375 22.85 25.474999999999998 30-31 27.787499999999998 23.5875 23.0125 25.6125 32-33 26.900000000000002 25.025 23.1 24.975 34-35 27.3125 24.2 23.3 25.1875 36-37 24.0625 24.349999999999998 24.349999999999998 27.237499999999997 38-39 24.5625 23.8125 24.8 26.825 40-41 27.9125 22.475 23.275000000000002 26.337500000000002 42-43 26.825 23.75 23.599999999999998 25.825 44-45 26.8125 24.349999999999998 23.425 25.412499999999998 46-47 26.875 23.9375 22.8375 26.35 48-49 25.8125 23.5 22.9625 27.725 50-51 27.0625 23.325000000000003 23.8875 25.724999999999998 52-53 25.4625 23.875 23.9125 26.75 54-55 24.55 24.6875 23.95 26.8125 56-57 25.074999999999996 23.775 26.7625 24.3875 58-59 24.95 25.2875 24.325 25.4375 60-61 25.275 26.8125 22.4875 25.424999999999997 62-63 25.1875 26.375 23.5 24.9375 64-65 24.4125 26.2875 22.8 26.5 66-67 24.349999999999998 26.075 24.2 25.374999999999996 68-69 25.224999999999998 25.4 23.7625 25.6125 70-71 25.687500000000004 26.4625 22.025 25.825 72-73 25.825 25.5625 22.725 25.887500000000003 74-75 24.75 25.35 23.525 26.375 76-77 26.150000000000002 24.4 23.425 26.025 78-79 25.5 24.2875 23.925 26.2875 80-81 26.0625 24.9 23.3 25.7375 82-83 27.0 23.3125 23.5 26.187500000000004 84-85 25.650000000000002 24.15 25.0125 25.1875 86-87 25.7 24.3 24.0 26.0 88-89 25.137500000000003 23.8875 24.2 26.775 90-91 25.7125 23.4125 24.3625 26.5125 92-93 26.437500000000004 23.95 23.7875 25.825 94-95 26.637499999999996 24.725 23.549999999999997 25.087500000000002 96-97 25.662499999999998 25.2625 23.2875 25.7875 98-99 25.4625 24.587500000000002 24.6 25.35 100-101 26.950000000000003 23.6125 23.3125 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 3.0 29 4.0 30 4.5 31 7.5 32 11.0 33 14.0 34 21.5 35 26.0 36 35.5 37 50.5 38 62.0 39 85.0 40 108.0 41 123.5 42 139.5 43 158.5 44 161.0 45 148.5 46 149.5 47 156.5 48 158.5 49 164.0 50 166.0 51 151.0 52 141.5 53 131.5 54 119.0 55 118.0 56 93.5 57 76.5 58 80.0 59 81.0 60 80.5 61 66.5 62 65.5 63 73.5 64 71.5 65 64.0 66 61.5 67 65.0 68 72.0 69 70.0 70 55.0 71 46.0 72 43.5 73 41.0 74 39.0 75 32.5 76 25.5 77 20.5 78 14.0 79 11.5 80 9.0 81 7.0 82 4.5 83 3.0 84 2.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGGGG 15 0.009957196 47.5 38-39 AAAAAAA 205 3.7296303E-4 10.426829 60-61 >>END_MODULE Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999320 spots for SRR10380967.sra Written 999320 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra Read 999314 spots for SRR10380967.sra Written 999314 spots for SRR10380967.sra SRR ids: ['SRR10380967.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_chsfevbi SRR10380967.sra spots: 19986286 blocks: [[1, 999314], [999315, 1998628], [1998629, 2997942], [2997943, 3997256], [3997257, 4996570], [4996571, 5995884], [5995885, 6995198], [6995199, 7994512], [7994513, 8993826], [8993827, 9993140], [9993141, 10992454], [10992455, 11991768], [11991769, 12991082], [12991083, 13990396], [13990397, 14989710], [14989711, 15989024], [15989025, 16988338], [16988339, 17987652], [17987653, 18986966], [18986967, 19986286]] SRR10380967 file size 5483272 SRR10380967 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380967 SRR10380967_1.fastq SRR10380967_2.fastq Input file: SRR10380967_1.fastq Paired file: SRR10380967_2.fastq trimmed: SRR10380967-trimmed-pair1.fastq, SRR10380967-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:56:58 2024 >> started Sat Dec 7 15:57:18 2024 >> done (19.776s) 19986286 read pairs processed; of these: 75225 ( 0.38%) short read pairs filtered out after trimming by size control 708964 ( 3.55%) empty read pairs filtered out after trimming by size control 19202097 (96.08%) read pairs available; of these: 1693884 ( 8.82%) trimmed read pairs available after processing 17508213 (91.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 131 0.00% 19 171 0.00% 20 179 0.00% 21 190 0.00% 22 197 0.00% 23 303 0.00% 24 330 0.00% 25 341 0.00% 26 428 0.00% 27 449 0.00% 28 531 0.00% 29 565 0.00% 30 623 0.00% 31 687 0.00% 32 737 0.00% 33 831 0.00% 34 926 0.00% 35 949 0.00% 36 1073 0.01% 37 1136 0.01% 38 1179 0.01% 39 1265 0.01% 40 1320 0.01% 41 1316 0.01% 42 1412 0.01% 43 1471 0.01% 44 1545 0.01% 45 1629 0.01% 46 1725 0.01% 47 1771 0.01% 48 1782 0.01% 49 1944 0.01% 50 2067 0.01% 51 2148 0.01% 52 2324 0.01% 53 2372 0.01% 54 2543 0.01% 55 2800 0.01% 56 2839 0.01% 57 3109 0.02% 58 3596 0.02% 59 7898 0.04% 60 12201 0.06% 61 13266 0.07% 62 14429 0.08% 63 15308 0.08% 64 15838 0.08% 65 16704 0.09% 66 17803 0.09% 67 17940 0.09% 68 18569 0.10% 69 19117 0.10% 70 19835 0.10% 71 19759 0.10% 72 20379 0.11% 73 21340 0.11% 74 21737 0.11% 75 21909 0.11% 76 22297 0.12% 77 22268 0.12% 78 22848 0.12% 79 23416 0.12% 80 24054 0.13% 81 25048 0.13% 82 25503 0.13% 83 26270 0.14% 84 27207 0.14% 85 28124 0.15% 86 29666 0.15% 87 31218 0.16% 88 32615 0.17% 89 34965 0.18% 90 38041 0.20% 91 40509 0.21% 92 44573 0.23% 93 50044 0.26% 94 55819 0.29% 95 64509 0.34% 96 80292 0.42% 97 88819 0.46% 98 112580 0.59% 99 147321 0.77% 100 248912 1.30% 101 17508213 91.18% 19202097 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=170.96 fanout-score-rank=18 prefix-density=1.01 prefix-fanout=22.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=421.23 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=24.1 sequence=CCGCCGCCGCCTCC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=175.07 fanout-score-rank=16 prefix-density=1.03 prefix-fanout=23.0 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=425.77 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=23.0 sequence=CGCCGCCGCCACC SRR10380967 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:57:47 Started mapping on | Dec 07 15:57:47 Finished on | Dec 07 15:58:34 Mapping speed, Million of reads per hour | 1470.80 Number of input reads | 19202097 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 18506144 Uniquely mapped reads % | 96.38% Average mapped length | 198.70 Number of splices: Total | 10712024 Number of splices: Annotated (sjdb) | 10037574 Number of splices: GT/AG | 10563672 Number of splices: GC/AG | 129024 Number of splices: AT/AC | 7557 Number of splices: Non-canonical | 11771 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 189800 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 46617 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.96% % of reads unmapped: other | 1.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 519697 519697 519697 N_multimapping 189800 189800 189800 N_noFeature 657110 9363532 9446821 N_ambiguous 392284 20773 20650 UnstrandedReadsAssigned:17456750 PositiveStrandReadsAssigned:9121839 NegativeStrandReadsAssigned:9038673 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380967 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380967-trimmed-pair1.fastq SRR10380967-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,202,097 reads, 18,117,873 reads pseudoaligned [quant] estimated average fragment length: 198.556 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR10380967.ke.tsv 35125 SRR10380967.se.tsv 88098 total ==> SRR10380967.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 738.877 0 0 PNS24247 1044 846.444 59.367 5.53485 PNS24249 1928 1730.44 243.916 11.1235 PNS24246 1044 846.444 59.367 5.53485 PNS24248 1044 846.444 59.367 5.53485 PNS24244 1471 1273.44 107.983 6.6917 PNS24243 293 118.216 14 9.34565 KQK14069 1603 1405.44 4830.89 271.252 KQK14071 474 282.123 246.255 68.8822 ==> SRR10380967.se.tsv <== BRADI_1g14170v3 5270 BRADI_1g53295v3 113 BRADI_1g59795v3 379 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 1003 BRADI_1g74790v3 1362 BRADI_1g09890v3 2 BRADI_1g77505v3 225 BRADI_1g48960v3 0 SRR10380967 completed mapping pipeline successfully