Starting /dee2/code/volunteer_pipeline.sh SRR10380968 current disk space = 1542196748288 free memory = 1600970332 SRR10380968 SRAfilesize d5dda40c91c349c01e3ce29777bae216 SRR10380968.sra SRR10380968.sra file validated SRR10380968 is paired end SRR10380968 is conventional basespace SRR10380968 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380968_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62225 34.0 33.0 34.0 31.0 34.0 2 33.05025 34.0 34.0 34.0 31.0 34.0 3 33.31375 34.0 34.0 34.0 31.0 34.0 4 36.57725 37.0 37.0 37.0 35.0 37.0 5 36.5415 37.0 37.0 37.0 35.0 37.0 6 36.5285 37.0 37.0 37.0 35.0 37.0 7 36.47275 37.0 37.0 37.0 35.0 37.0 8 36.56675 37.0 37.0 37.0 35.0 37.0 9 38.4475 39.0 39.0 39.0 37.0 39.0 10-11 38.464375000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.460375 39.0 39.0 39.0 37.0 39.0 14-15 40.145624999999995 41.0 40.0 41.0 38.0 41.0 16-17 40.184 41.0 41.0 41.0 38.0 41.0 18-19 40.180625 41.0 40.5 41.0 38.0 41.0 20-21 40.12225 41.0 40.0 41.0 38.0 41.0 22-23 40.08825 41.0 40.0 41.0 38.0 41.0 24-25 40.07625 41.0 40.0 41.0 38.0 41.0 26-27 39.953125 41.0 40.0 41.0 38.0 41.0 28-29 39.85225 41.0 40.0 41.0 37.5 41.0 30-31 39.802125000000004 41.0 40.0 41.0 37.0 41.0 32-33 39.67725 41.0 40.0 41.0 37.0 41.0 34-35 39.5885 41.0 40.0 41.0 36.0 41.0 36-37 39.4945 41.0 40.0 41.0 35.0 41.0 38-39 39.356875 41.0 39.0 41.0 35.0 41.0 40-41 39.17875 41.0 39.0 41.0 35.0 41.0 42-43 39.0225 41.0 38.5 41.0 35.0 41.0 44-45 38.886624999999995 41.0 38.0 41.0 35.0 41.0 46-47 38.699625 41.0 37.0 41.0 35.0 41.0 48-49 38.519999999999996 41.0 36.5 41.0 35.0 41.0 50-51 38.353750000000005 40.0 36.0 41.0 35.0 41.0 52-53 38.119375000000005 40.0 35.0 41.0 35.0 41.0 54-55 37.884249999999994 40.0 35.0 41.0 35.0 41.0 56-57 37.763999999999996 39.0 35.0 41.0 35.0 41.0 58-59 37.479625 39.0 35.0 41.0 34.5 41.0 60-61 37.243125 38.5 35.0 41.0 34.0 41.0 62-63 37.042125 37.0 35.0 41.0 34.0 41.0 64-65 36.747375000000005 37.0 35.0 40.5 34.0 41.0 66-67 36.473875 36.0 35.0 39.5 34.0 41.0 68-69 36.178 36.0 35.0 39.0 34.0 41.0 70-71 35.914500000000004 35.0 35.0 39.0 34.0 41.0 72-73 35.56075 35.0 35.0 37.0 33.5 39.5 74-75 35.1555 35.0 35.0 37.0 33.0 39.0 76-77 34.926625 35.0 35.0 36.5 33.0 39.0 78-79 34.691500000000005 35.0 35.0 36.0 33.0 37.0 80-81 34.40875 35.0 35.0 36.0 33.0 37.0 82-83 34.256249999999994 35.0 35.0 35.0 33.0 37.0 84-85 34.11925 35.0 35.0 35.0 33.0 36.0 86-87 34.072375 35.0 35.0 35.0 33.0 36.0 88-89 33.9015 35.0 35.0 35.0 33.0 36.0 90-91 33.7765 35.0 35.0 35.0 33.0 36.0 92-93 33.639624999999995 35.0 35.0 35.0 32.0 35.0 94-95 33.582499999999996 35.0 35.0 35.0 32.0 35.0 96-97 33.506249999999994 35.0 35.0 35.0 32.0 35.0 98-99 33.428 35.0 35.0 35.0 32.0 35.0 100-101 32.500625 34.5 33.5 35.0 28.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 2.0 10 2.0 11 0.0 12 2.0 13 2.0 14 1.0 15 0.0 16 0.0 17 2.0 18 4.0 19 2.0 20 4.0 21 5.0 22 5.0 23 6.0 24 6.0 25 14.0 26 11.0 27 9.0 28 30.0 29 29.0 30 28.0 31 33.0 32 46.0 33 65.0 34 97.0 35 212.0 36 593.0 37 1007.0 38 1438.0 39 341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.083630800611935 11.805201427842938 13.437021927587967 48.67414584395717 2 25.8 18.65 26.700000000000003 28.849999999999998 3 26.6 19.7 21.325 32.375 4 30.8 22.15 18.3 28.749999999999996 5 31.807951987997 26.03150787696924 20.605151287821954 21.555388847211805 6 26.6 31.825 19.05 22.525000000000002 7 23.625 21.425 33.35 21.6 8 23.25 24.45 25.25 27.05 9 23.549999999999997 22.475 27.775 26.200000000000003 10-11 25.2 28.749999999999996 21.8625 24.1875 12-13 25.3 23.275000000000002 24.5375 26.887499999999996 14-15 24.3875 25.162499999999998 23.599999999999998 26.85 16-17 25.337500000000002 25.025 22.95 26.687499999999996 18-19 25.112499999999997 24.4875 23.2125 27.187499999999996 20-21 23.8375 25.25 24.1375 26.775 22-23 24.637500000000003 24.474999999999998 24.212500000000002 26.674999999999997 24-25 25.887500000000003 24.25 24.425 25.4375 26-27 24.803100387548444 25.040630078759847 23.365420677584698 26.790848856107015 28-29 25.54069258657332 24.453056632079008 23.65295661957745 26.35329416177022 30-31 24.95 24.212500000000002 24.325 26.5125 32-33 25.112499999999997 25.4 23.8375 25.650000000000002 34-35 24.978122265283158 24.478059757469683 24.128016002000248 26.415801975246904 36-37 25.7375 24.4875 23.575 26.200000000000003 38-39 25.44386096524131 24.3935983995999 23.143285821455365 27.019254813703427 40-41 25.275275275275277 24.261761761761765 24.93743743743744 25.525525525525527 42-43 24.367959949937422 24.505632040050063 24.593241551939926 26.533166458072593 44-45 24.909250219051195 24.696457629240207 23.50732256853173 26.886969583176867 46-47 25.059456753035427 25.24721492051571 23.6199774690199 26.073350857428967 48-49 25.291098034305747 24.239389007136598 24.126705897082758 26.3428070614749 50-51 25.71678978339802 24.677601101790408 23.988982095905847 25.616627018905724 52-53 25.993232234615864 24.376488281739565 23.724777541045245 25.905501942599322 54-55 25.38847117794486 24.160401002506266 23.62155388471178 26.829573934837093 56-57 25.563909774436087 24.29824561403509 24.19799498746867 25.93984962406015 58-59 26.88791484032561 23.60676268002505 23.481527864746397 26.023794614902947 60-61 25.284766554011767 24.25835523845287 24.421078983602452 26.03579922393291 62-63 25.587793896948476 24.712356178089045 24.16208104052026 25.53776888444222 64-65 26.125 24.925 23.325000000000003 25.624999999999996 66-67 25.4875 24.325 23.95 26.237500000000004 68-69 25.1875 24.775 23.9375 26.1 70-71 25.8 24.925 23.825 25.45 72-73 25.650000000000002 24.25 24.05 26.05 74-75 26.237500000000004 24.587500000000002 23.7 25.474999999999998 76-77 25.1 25.4375 23.8875 25.575 78-79 26.665833229153645 23.002875359419928 23.47793474184273 26.8533566695837 80-81 26.62832854106763 24.05300662582823 23.790473809226153 25.528191023877984 82-83 25.650000000000002 25.025 23.1625 26.1625 84-85 24.8625 24.9 23.3625 26.875 86-87 24.962500000000002 24.4 24.6625 25.974999999999998 88-89 26.0 23.5625 24.8125 25.624999999999996 90-91 25.3125 24.4 24.637500000000003 25.650000000000002 92-93 26.187500000000004 24.925 23.5625 25.324999999999996 94-95 26.875 23.974999999999998 23.3625 25.7875 96-97 25.275 24.1125 24.025 26.5875 98-99 26.150000000000002 23.8375 23.8625 26.150000000000002 100-101 25.775 24.6125 23.5625 26.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 3.5 30 3.5 31 3.5 32 8.0 33 15.0 34 28.0 35 40.0 36 39.5 37 48.5 38 65.5 39 77.0 40 93.5 41 116.0 42 132.0 43 141.0 44 168.0 45 179.0 46 185.0 47 185.0 48 163.5 49 157.5 50 158.5 51 149.5 52 140.0 53 134.0 54 119.0 55 103.5 56 94.5 57 87.0 58 82.5 59 75.5 60 67.5 61 70.0 62 69.5 63 64.0 64 64.5 65 71.5 66 70.5 67 68.0 68 71.0 69 61.5 70 49.5 71 48.0 72 39.5 73 41.0 74 40.0 75 29.5 76 20.0 77 13.0 78 14.5 79 10.5 80 7.0 81 5.5 82 3.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0 38-39 0.025 40-41 0.1 42-43 0.125 44-45 0.13749999999999998 46-47 0.13749999999999998 48-49 0.1625 50-51 0.1625 52-53 0.2625 54-55 0.25 56-57 0.25 58-59 0.1875 60-61 0.13749999999999998 62-63 0.05 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94977398292315 99.5 2 0.025113008538422906 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025113008538422906 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 18 0.44999999999999996 TruSeq Adapter, Index 12 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 15 0.009957196 47.5 94-95 >>END_MODULE SRR10380968 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR10380968_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70375 34.0 33.0 34.0 31.0 34.0 2 32.87375 34.0 33.0 34.0 31.0 34.0 3 32.89075 34.0 34.0 34.0 31.0 34.0 4 36.143 37.0 37.0 37.0 35.0 37.0 5 36.13175 37.0 37.0 37.0 35.0 37.0 6 36.09525 37.0 37.0 37.0 35.0 37.0 7 36.118 37.0 37.0 37.0 35.0 37.0 8 36.12425 37.0 37.0 37.0 35.0 37.0 9 37.98125 39.0 39.0 39.0 37.0 39.0 10-11 37.9835 39.0 39.0 39.0 37.0 39.0 12-13 37.974125 39.0 39.0 39.0 37.0 39.0 14-15 39.615624999999994 41.0 40.0 41.0 38.0 41.0 16-17 39.65075 41.0 40.0 41.0 38.0 41.0 18-19 39.650625000000005 41.0 40.0 41.0 38.0 41.0 20-21 39.575874999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.508624999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.485375 41.0 40.0 41.0 38.0 41.0 26-27 39.459625 41.0 40.0 41.0 37.5 41.0 28-29 39.335375 41.0 40.0 41.0 37.0 41.0 30-31 39.293125 41.0 40.0 41.0 36.5 41.0 32-33 39.204499999999996 41.0 40.0 41.0 36.0 41.0 34-35 39.0845 41.0 40.0 41.0 35.5 41.0 36-37 38.939 41.0 39.5 41.0 35.0 41.0 38-39 38.819874999999996 41.0 39.0 41.0 35.0 41.0 40-41 38.714125 41.0 39.0 41.0 35.0 41.0 42-43 38.522375 41.0 38.5 41.0 35.0 41.0 44-45 38.3095 41.0 37.5 41.0 35.0 41.0 46-47 38.142375 41.0 37.0 41.0 35.0 41.0 48-49 38.0075 41.0 36.5 41.0 35.0 41.0 50-51 37.814375 40.5 36.0 41.0 35.0 41.0 52-53 37.635999999999996 40.0 35.0 41.0 35.0 41.0 54-55 37.47925 40.0 35.0 41.0 34.0 41.0 56-57 37.180875 39.0 35.0 41.0 34.0 41.0 58-59 36.941625 39.0 35.0 41.0 34.0 41.0 60-61 36.709875 38.5 35.0 41.0 33.5 41.0 62-63 36.471374999999995 37.5 35.0 41.0 33.5 41.0 64-65 36.138625 37.0 35.0 40.5 33.0 41.0 66-67 35.8155 36.5 35.0 39.5 33.0 41.0 68-69 35.53575 36.0 35.0 39.0 33.0 41.0 70-71 35.215625 35.0 35.0 39.0 33.0 41.0 72-73 34.889 35.0 35.0 37.0 33.0 39.5 74-75 34.564125000000004 35.0 35.0 37.0 33.0 39.0 76-77 34.254625000000004 35.0 35.0 36.5 33.0 39.0 78-79 34.075 35.0 35.0 36.0 33.0 37.0 80-81 33.857 35.0 35.0 36.0 32.5 37.0 82-83 33.685249999999996 35.0 35.0 35.0 32.0 37.0 84-85 33.500875 35.0 35.0 35.0 32.0 36.0 86-87 33.359625 35.0 35.0 35.0 32.0 36.0 88-89 33.312124999999995 35.0 35.0 35.0 32.0 36.0 90-91 33.185125 35.0 35.0 35.0 31.5 36.0 92-93 33.0895 35.0 35.0 35.0 31.5 35.5 94-95 33.061499999999995 35.0 35.0 35.0 31.0 35.0 96-97 32.905 35.0 35.0 35.0 31.0 35.0 98-99 32.85075 35.0 35.0 35.0 31.0 35.0 100-101 31.816875000000003 34.5 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 3.0 4 3.0 5 3.0 6 2.0 7 4.0 8 4.0 9 4.0 10 4.0 11 3.0 12 6.0 13 3.0 14 3.0 15 2.0 16 5.0 17 3.0 18 3.0 19 4.0 20 7.0 21 7.0 22 4.0 23 3.0 24 9.0 25 11.0 26 15.0 27 15.0 28 13.0 29 19.0 30 25.0 31 36.0 32 37.0 33 67.0 34 101.0 35 182.0 36 566.0 37 957.0 38 1456.0 39 371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.563281640820406 12.106053026513257 13.156578289144571 48.174087043521766 2 25.25 18.45 27.950000000000003 28.349999999999998 3 25.324999999999996 20.575 21.7 32.4 4 29.125 21.5 18.075 31.3 5 30.125 25.4 21.875 22.6 6 27.0 32.2 18.65 22.15 7 23.400000000000002 20.75 33.975 21.875 8 21.85 23.474999999999998 27.474999999999998 27.200000000000003 9 25.674999999999997 20.525 27.650000000000002 26.150000000000002 10-11 25.525 28.299999999999997 21.4125 24.762500000000003 12-13 25.2625 23.5875 24.775 26.375 14-15 24.6 25.025 24.349999999999998 26.025 16-17 25.25 24.0625 24.2375 26.450000000000003 18-19 25.15 24.5 23.7125 26.637499999999996 20-21 26.087500000000002 23.9375 24.4375 25.5375 22-23 25.662499999999998 24.0 23.95 26.387500000000003 24-25 25.5625 24.4 23.3375 26.700000000000003 26-27 25.2875 24.525 24.7875 25.4 28-29 25.4375 24.5 24.099999999999998 25.9625 30-31 25.4 24.462500000000002 23.849999999999998 26.2875 32-33 25.650000000000002 25.2875 24.05 25.0125 34-35 25.5 24.4375 24.175 25.887500000000003 36-37 25.5625 24.1375 23.25 27.05 38-39 24.825 25.387500000000003 23.5625 26.224999999999998 40-41 25.2375 25.0125 23.7 26.05 42-43 25.7875 24.25 24.3875 25.575 44-45 26.2875 24.1125 24.25 25.35 46-47 26.3125 24.0375 24.0375 25.6125 48-49 25.674999999999997 24.3125 23.575 26.437500000000004 50-51 25.2375 24.625 23.8625 26.275 52-53 25.387500000000003 23.8125 24.75 26.05 54-55 25.35 24.45 23.175 27.025 56-57 25.162499999999998 25.0125 24.95 24.875 58-59 26.1125 24.425 23.5 25.9625 60-61 25.662499999999998 24.65 23.799999999999997 25.887500000000003 62-63 25.687500000000004 25.2 23.275000000000002 25.837500000000002 64-65 25.650000000000002 23.7375 24.9125 25.7 66-67 25.825 23.525 24.3625 26.2875 68-69 25.7875 24.349999999999998 24.4 25.4625 70-71 25.9875 24.3125 23.4875 26.2125 72-73 25.3 24.462500000000002 24.05 26.187500000000004 74-75 26.700000000000003 24.1625 23.825 25.3125 76-77 26.2625 23.8375 23.5125 26.387500000000003 78-79 24.962500000000002 24.0 24.4125 26.625 80-81 26.200000000000003 24.275 24.1625 25.362499999999997 82-83 26.3625 22.625 25.174999999999997 25.837500000000002 84-85 25.9875 25.3 22.7625 25.95 86-87 25.624999999999996 24.474999999999998 24.25 25.650000000000002 88-89 25.474999999999998 23.674999999999997 24.3125 26.5375 90-91 25.974999999999998 24.25 24.337500000000002 25.4375 92-93 25.324999999999996 24.025 25.087500000000002 25.5625 94-95 26.174999999999997 23.549999999999997 23.325000000000003 26.950000000000003 96-97 24.8625 24.375 25.687500000000004 25.074999999999996 98-99 26.974999999999998 23.7625 24.025 25.2375 100-101 26.650000000000002 24.337500000000002 24.224999999999998 24.7875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 2.0 29 3.0 30 4.5 31 8.0 32 14.5 33 16.5 34 16.5 35 27.0 36 36.0 37 52.5 38 70.5 39 88.0 40 110.0 41 128.0 42 148.5 43 154.5 44 148.5 45 166.5 46 168.5 47 159.5 48 172.5 49 173.0 50 161.5 51 150.0 52 136.0 53 112.0 54 104.5 55 108.5 56 101.5 57 93.0 58 91.0 59 79.5 60 66.5 61 66.0 62 72.0 63 71.0 64 64.0 65 59.0 66 58.5 67 62.5 68 54.5 69 52.0 70 58.0 71 51.5 72 48.0 73 42.5 74 33.0 75 30.0 76 23.5 77 19.5 78 15.0 79 12.5 80 10.5 81 9.0 82 7.5 83 2.5 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842279 spots for SRR10380968.sra Written 842279 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra Read 842275 spots for SRR10380968.sra Written 842275 spots for SRR10380968.sra SRR ids: ['SRR10380968.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9wmh0l68 SRR10380968.sra spots: 16845504 blocks: [[1, 842275], [842276, 1684550], [1684551, 2526825], [2526826, 3369100], [3369101, 4211375], [4211376, 5053650], [5053651, 5895925], [5895926, 6738200], [6738201, 7580475], [7580476, 8422750], [8422751, 9265025], [9265026, 10107300], [10107301, 10949575], [10949576, 11791850], [11791851, 12634125], [12634126, 13476400], [13476401, 14318675], [14318676, 15160950], [15160951, 16003225], [16003226, 16845504]] SRR10380968 file size 4619879 SRR10380968 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR10380968 SRR10380968_1.fastq SRR10380968_2.fastq Input file: SRR10380968_1.fastq Paired file: SRR10380968_2.fastq trimmed: SRR10380968-trimmed-pair1.fastq, SRR10380968-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 16:03:26 2024 >> started Sat Dec 7 16:03:40 2024 >> done (14.743s) 16845504 read pairs processed; of these: 64451 ( 0.38%) short read pairs filtered out after trimming by size control 185650 ( 1.10%) empty read pairs filtered out after trimming by size control 16595403 (98.52%) read pairs available; of these: 1434537 ( 8.64%) trimmed read pairs available after processing 15160866 (91.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 132 0.00% 19 126 0.00% 20 144 0.00% 21 161 0.00% 22 191 0.00% 23 226 0.00% 24 269 0.00% 25 286 0.00% 26 339 0.00% 27 356 0.00% 28 392 0.00% 29 461 0.00% 30 519 0.00% 31 569 0.00% 32 626 0.00% 33 625 0.00% 34 764 0.00% 35 814 0.00% 36 826 0.00% 37 930 0.01% 38 990 0.01% 39 1005 0.01% 40 1046 0.01% 41 1066 0.01% 42 1128 0.01% 43 1236 0.01% 44 1273 0.01% 45 1286 0.01% 46 1354 0.01% 47 1463 0.01% 48 1461 0.01% 49 1638 0.01% 50 1605 0.01% 51 1758 0.01% 52 1859 0.01% 53 1973 0.01% 54 2061 0.01% 55 2225 0.01% 56 2503 0.02% 57 2715 0.02% 58 2861 0.02% 59 6660 0.04% 60 10245 0.06% 61 11248 0.07% 62 11931 0.07% 63 13446 0.08% 64 13667 0.08% 65 14246 0.09% 66 15274 0.09% 67 15634 0.09% 68 16273 0.10% 69 16668 0.10% 70 17214 0.10% 71 17145 0.10% 72 17407 0.10% 73 18186 0.11% 74 18674 0.11% 75 18740 0.11% 76 19242 0.12% 77 19260 0.12% 78 19784 0.12% 79 19996 0.12% 80 20306 0.12% 81 20903 0.13% 82 21761 0.13% 83 22623 0.14% 84 23196 0.14% 85 23821 0.14% 86 24665 0.15% 87 26417 0.16% 88 27378 0.16% 89 29632 0.18% 90 31971 0.19% 91 33870 0.20% 92 37209 0.22% 93 41624 0.25% 94 46426 0.28% 95 53696 0.32% 96 67303 0.41% 97 74228 0.45% 98 95193 0.57% 99 125118 0.75% 100 212995 1.28% 101 15160866 91.36% 16595403 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=161.69 fanout-score-rank=17 prefix-density=1.01 prefix-fanout=22.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=393.56 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=25.4 sequence=GCCGCCGCCGTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=167.85 fanout-score-rank=17 prefix-density=1.00 prefix-fanout=22.5 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=420.66 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=25.3 sequence=GCCGCCGCCGCT SRR10380968 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 16:04:12 Started mapping on | Dec 07 16:04:12 Finished on | Dec 07 16:04:44 Mapping speed, Million of reads per hour | 1866.98 Number of input reads | 16595403 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 15935959 Uniquely mapped reads % | 96.03% Average mapped length | 198.76 Number of splices: Total | 8954541 Number of splices: Annotated (sjdb) | 8393294 Number of splices: GT/AG | 8830989 Number of splices: GC/AG | 107286 Number of splices: AT/AC | 6405 Number of splices: Non-canonical | 9861 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.01% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167686 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 48877 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 1.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 503821 503821 503821 N_multimapping 167686 167686 167686 N_noFeature 536068 8056901 8112271 N_ambiguous 336352 17632 17712 UnstrandedReadsAssigned:15063539 PositiveStrandReadsAssigned:7861426 NegativeStrandReadsAssigned:7805976 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR10380968 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR10380968-trimmed-pair1.fastq SRR10380968-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,595,403 reads, 15,648,842 reads pseudoaligned [quant] estimated average fragment length: 205.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR10380968.ke.tsv 35125 SRR10380968.se.tsv 88098 total ==> SRR10380968.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 731.905 0 0 PNS24247 1044 839.596 56.4398 6.03522 PNS24249 1928 1723.6 181.364 9.44699 PNS24246 1044 839.596 56.4398 6.03522 PNS24248 1044 839.596 56.4398 6.03522 PNS24244 1471 1266.6 80.3169 5.69308 PNS24243 293 114.836 10 7.81809 KQK14069 1603 1398.6 2819.92 181.019 KQK14071 474 276.628 122.797 39.8538 ==> SRR10380968.se.tsv <== BRADI_1g14170v3 3037 BRADI_1g53295v3 94 BRADI_1g59795v3 248 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 720 BRADI_1g74790v3 1065 BRADI_1g09890v3 2 BRADI_1g77505v3 183 BRADI_1g48960v3 0 SRR10380968 completed mapping pipeline successfully