Starting /dee2/code/volunteer_pipeline.sh SRR11216155 current disk space = 1526804013056 free memory = 1531959912 SRR11216155 SRAfilesize 449d375ccafac7a7f7b01dc7c77c26ba SRR11216155.sra SRR11216155.sra file validated SRR11216155 is single end SRR11216155 is conventional basespace SRR11216155 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3385 33.0 33.0 33.0 33.0 33.0 2 32.49875 33.0 33.0 33.0 33.0 33.0 3 32.58125 33.0 33.0 33.0 33.0 33.0 4 32.55525 33.0 33.0 33.0 33.0 33.0 5 32.6105 33.0 33.0 33.0 33.0 33.0 6 35.82025 37.0 37.0 37.0 37.0 37.0 7 36.41325 37.0 37.0 37.0 37.0 37.0 8 36.3995 37.0 37.0 37.0 37.0 37.0 9 36.46525 37.0 37.0 37.0 37.0 37.0 10-11 36.504125 37.0 37.0 37.0 37.0 37.0 12-13 36.52975 37.0 37.0 37.0 37.0 37.0 14-15 36.57425 37.0 37.0 37.0 37.0 37.0 16-17 36.522625000000005 37.0 37.0 37.0 37.0 37.0 18-19 36.5295 37.0 37.0 37.0 37.0 37.0 20-21 36.52325 37.0 37.0 37.0 37.0 37.0 22-23 36.495625 37.0 37.0 37.0 37.0 37.0 24-25 36.501000000000005 37.0 37.0 37.0 37.0 37.0 26-27 36.519 37.0 37.0 37.0 37.0 37.0 28-29 36.438500000000005 37.0 37.0 37.0 37.0 37.0 30-31 36.474625 37.0 37.0 37.0 37.0 37.0 32-33 36.414875 37.0 37.0 37.0 37.0 37.0 34-35 36.428749999999994 37.0 37.0 37.0 37.0 37.0 36-37 36.43175 37.0 37.0 37.0 37.0 37.0 38-39 36.417500000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.487750000000005 37.0 37.0 37.0 37.0 37.0 42-43 36.417 37.0 37.0 37.0 37.0 37.0 44-45 36.369749999999996 37.0 37.0 37.0 37.0 37.0 46-47 36.395875000000004 37.0 37.0 37.0 37.0 37.0 48-49 36.5035 37.0 37.0 37.0 37.0 37.0 50-51 36.43275 37.0 37.0 37.0 37.0 37.0 52-53 36.445625 37.0 37.0 37.0 37.0 37.0 54-55 36.437 37.0 37.0 37.0 37.0 37.0 56-57 36.4685 37.0 37.0 37.0 37.0 37.0 58-59 36.465875 37.0 37.0 37.0 37.0 37.0 60-61 36.4075 37.0 37.0 37.0 37.0 37.0 62-63 36.374125 37.0 37.0 37.0 37.0 37.0 64-65 36.390874999999994 37.0 37.0 37.0 37.0 37.0 66-67 36.38075 37.0 37.0 37.0 37.0 37.0 68-69 36.39175 37.0 37.0 37.0 37.0 37.0 70-71 36.395625 37.0 37.0 37.0 37.0 37.0 72-73 36.37875 37.0 37.0 37.0 37.0 37.0 74-75 36.333375000000004 37.0 37.0 37.0 37.0 37.0 76-77 36.31337499999999 37.0 37.0 37.0 37.0 37.0 78-79 36.327375 37.0 37.0 37.0 37.0 37.0 80-81 36.17575 37.0 37.0 37.0 37.0 37.0 82-83 36.1965 37.0 37.0 37.0 37.0 37.0 84-85 36.218125 37.0 37.0 37.0 37.0 37.0 86-87 36.12525 37.0 37.0 37.0 37.0 37.0 88-89 36.11925 37.0 37.0 37.0 37.0 37.0 90-91 36.016999999999996 37.0 37.0 37.0 37.0 37.0 92-93 36.063625 37.0 37.0 37.0 37.0 37.0 94-95 36.038125 37.0 37.0 37.0 37.0 37.0 96-97 35.902125 37.0 37.0 37.0 37.0 37.0 98-99 35.817750000000004 37.0 37.0 37.0 37.0 37.0 100-101 34.080875 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 0.0 22 1.0 23 2.0 24 6.0 25 3.0 26 9.0 27 15.0 28 14.0 29 27.0 30 35.0 31 27.0 32 58.0 33 67.0 34 115.0 35 236.0 36 3375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.27784762383706 9.404073422177522 9.278350515463918 46.0397284385215 2 21.95 14.725 35.05 28.275 3 21.75 16.375 23.150000000000002 38.725 4 26.875 24.875 20.3 27.950000000000003 5 26.625 28.275 23.1 22.0 6 22.523435520648594 32.04965796807702 23.156827970610593 22.270078540663796 7 19.6 22.225 37.225 20.95 8 20.200000000000003 22.725 30.0 27.075 9 20.4 20.575 33.575 25.45 10-11 23.1125 29.2 22.5875 25.1 12-13 23.974999999999998 22.650000000000002 25.650000000000002 27.725 14-15 23.075000000000003 24.9375 27.1375 24.85 16-17 24.3125 24.8 24.9 25.9875 18-19 24.2875 24.175 24.6125 26.924999999999997 20-21 23.225 25.275 25.6 25.900000000000002 22-23 24.4875 25.525 24.675 25.3125 24-25 23.9 24.5625 24.45 27.0875 26-27 23.9 25.112499999999997 24.637500000000003 26.35 28-29 24.4 24.95 24.9125 25.7375 30-31 23.925 25.137500000000003 24.3875 26.55 32-33 23.9375 24.0375 25.9625 26.0625 34-35 23.674999999999997 24.2875 25.575 26.4625 36-37 24.975 23.849999999999998 24.2375 26.937499999999996 38-39 23.8875 24.675 26.125 25.3125 40-41 24.6625 25.0375 24.337500000000002 25.9625 42-43 23.9125 25.087500000000002 24.3 26.700000000000003 44-45 24.375 23.8625 25.162499999999998 26.6 46-47 24.025 24.2375 25.362499999999997 26.375 48-49 23.775 24.5125 24.3875 27.325 50-51 23.5875 25.1 25.2375 26.075 52-53 24.95 24.15 24.6625 26.237500000000004 54-55 24.05 23.724999999999998 24.212500000000002 28.012500000000003 56-57 23.6625 24.0125 25.8125 26.5125 58-59 24.925 23.962500000000002 24.7875 26.325 60-61 25.05 24.462500000000002 24.3625 26.125 62-63 24.7 23.7625 24.3 27.237499999999997 64-65 24.0375 24.6 24.6875 26.674999999999997 66-67 24.6625 24.125 24.712500000000002 26.5 68-69 24.625 24.4875 25.0 25.887500000000003 70-71 24.712500000000002 23.549999999999997 23.799999999999997 27.9375 72-73 24.075 24.474999999999998 24.05 27.400000000000002 74-75 24.087500000000002 24.0375 24.6875 27.187499999999996 76-77 24.6125 24.325 24.887500000000003 26.174999999999997 78-79 25.224999999999998 23.6375 24.1375 27.0 80-81 24.6125 24.2625 24.65 26.474999999999998 82-83 24.775 23.175 25.2375 26.8125 84-85 25.5625 24.0625 23.6125 26.7625 86-87 25.090636329541194 24.715589448681087 24.46555819477435 25.728216027003377 88-89 25.57528764382191 23.149074537268636 24.499749874937468 26.775887943971988 90-91 25.062531265632813 24.312156078039017 24.187093546773387 26.43821910955478 92-93 25.400200100050025 23.836918459229615 23.949474737368686 26.813406703351678 94-95 25.431357839459867 25.11877969492373 23.830957739434858 25.618904726181547 96-97 24.381095273818453 24.60615153788447 24.381095273818453 26.63165791447862 98-99 25.100050025012504 23.949474737368686 25.03751875937969 25.912956478239117 100-101 25.09691134175316 24.134050268850817 23.62135800925347 27.147680380142553 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 1.0 29 2.5 30 4.0 31 6.0 32 10.0 33 14.0 34 16.5 35 24.0 36 37.0 37 41.0 38 45.0 39 69.5 40 104.5 41 122.0 42 125.0 43 145.5 44 158.0 45 160.5 46 161.0 47 169.5 48 184.0 49 186.5 50 169.5 51 154.0 52 159.5 53 143.0 54 128.0 55 139.0 56 143.0 57 135.0 58 124.5 59 118.0 60 118.5 61 100.0 62 82.0 63 79.5 64 70.5 65 67.0 66 65.5 67 58.5 68 48.0 69 33.0 70 22.5 71 17.5 72 14.5 73 10.5 74 7.0 75 3.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 1.325 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.05 90-91 0.05 92-93 0.05 94-95 0.025 96-97 0.025 98-99 0.05 100-101 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 97.87451984635082 95.55 2 1.8693982074263764 3.65 3 0.23047375160051217 0.675 4 0.0 0.0 5 0.02560819462227913 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.8374999999999999 0.0 0.0 0.0 0.0 80-81 1.05 0.0 0.0 0.0 0.0 82-83 1.25 0.0 0.0 0.0 0.0 84-85 1.5 0.0 0.0 0.0 0.0 86-87 1.85 0.0 0.0 0.0 0.0 88-89 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427718 READS because READLEN < 1 Read 1427718 spots for SRR11216155.sra Written 1427718 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra Rejected 1427699 READS because READLEN < 1 Read 1427699 spots for SRR11216155.sra Written 1427699 spots for SRR11216155.sra SRR ids: ['SRR11216155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kxxaod70 SRR11216155.sra spots: 28553999 blocks: [[1, 1427699], [1427700, 2855398], [2855399, 4283097], [4283098, 5710796], [5710797, 7138495], [7138496, 8566194], [8566195, 9993893], [9993894, 11421592], [11421593, 12849291], [12849292, 14276990], [14276991, 15704689], [15704690, 17132388], [17132389, 18560087], [18560088, 19987786], [19987787, 21415485], [21415486, 22843184], [22843185, 24270883], [24270884, 25698582], [25698583, 27126281], [27126282, 28553999]] SRR11216155 file size 6893721 SRR11216155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216155 SRR11216155_1.fastq Input file: SRR11216155_1.fastq trimmed: SRR11216155-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:25:03 2024 >> started Tue Dec 10 08:25:18 2024 >> done (14.965s) 28553999 reads processed; of these: 12385 ( 0.04%) short reads filtered out after trimming by size control 43730 ( 0.15%) empty reads filtered out after trimming by size control 28497884 (99.80%) reads available; of these: 2911086 (10.22%) trimmed reads available after processing 25586798 (89.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 482 0.00% 19 561 0.00% 20 519 0.00% 21 510 0.00% 22 608 0.00% 23 725 0.00% 24 869 0.00% 25 966 0.00% 26 911 0.00% 27 890 0.00% 28 892 0.00% 29 816 0.00% 30 802 0.00% 31 833 0.00% 32 896 0.00% 33 850 0.00% 34 898 0.00% 35 988 0.00% 36 970 0.00% 37 962 0.00% 38 1048 0.00% 39 1154 0.00% 40 1209 0.00% 41 1242 0.00% 42 1303 0.00% 43 1389 0.00% 44 1481 0.01% 45 1456 0.01% 46 1567 0.01% 47 1738 0.01% 48 2004 0.01% 49 2118 0.01% 50 2426 0.01% 51 2647 0.01% 52 2713 0.01% 53 2740 0.01% 54 2870 0.01% 55 3057 0.01% 56 3326 0.01% 57 3635 0.01% 58 3959 0.01% 59 4389 0.02% 60 4801 0.02% 61 5427 0.02% 62 5948 0.02% 63 6303 0.02% 64 6842 0.02% 65 7487 0.03% 66 8458 0.03% 67 9208 0.03% 68 10068 0.04% 69 10967 0.04% 70 2404 0.01% 71 3092 0.01% 72 3804 0.01% 73 4989 0.02% 74 3304 0.01% 75 3485 0.01% 76 3674 0.01% 77 3714 0.01% 78 3984 0.01% 79 4962 0.02% 80 4943 0.02% 81 5209 0.02% 82 5542 0.02% 83 7230 0.03% 84 7290 0.03% 85 8052 0.03% 86 10063 0.04% 87 9991 0.04% 88 10335 0.04% 89 12403 0.04% 90 13999 0.05% 91 15730 0.06% 92 18811 0.07% 93 22683 0.08% 94 29658 0.10% 95 38231 0.13% 96 52650 0.18% 97 78852 0.28% 98 129765 0.46% 99 422639 1.48% 100 1828670 6.42% 101 25586798 89.78% 28497884 reads passed initial QC criterion=sequence-density sequence-density=1.98 sequence-density-rank=1 fanout-score=61.31 fanout-score-rank=1 prefix-density=2.71 prefix-fanout=44.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=1.98 sequence-density-rank=1 fanout-score=61.31 fanout-score-rank=1 prefix-density=2.71 prefix-fanout=44.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Started job on | Dec 10 08:25:39 Started mapping on | Dec 10 08:25:39 Finished on | Dec 10 08:26:38 Mapping speed, Million of reads per hour | 1738.85 Number of input reads | 28497884 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 25588396 Uniquely mapped reads % | 89.79% Average mapped length | 99.80 Number of splices: Total | 7222571 Number of splices: Annotated (sjdb) | 6800887 Number of splices: GT/AG | 7114056 Number of splices: GC/AG | 90970 Number of splices: AT/AC | 2055 Number of splices: Non-canonical | 15490 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2026793 % of reads mapped to multiple loci | 7.11% Number of reads mapped to too many loci | 694815 % of reads mapped to too many loci | 2.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 882695 882695 882695 N_multimapping 2026793 2026793 2026793 N_noFeature 842777 24883601 1009836 N_ambiguous 590730 1290 56602 UnstrandedReadsAssigned:24154889 PositiveStrandReadsAssigned:703505 NegativeStrandReadsAssigned:24521958 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216155 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216155-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,497,884 reads, 24,706,391 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR11216155.ke.tsv 35125 SRR11216155.se.tsv 88098 total ==> SRR11216155.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 117.988 8.56957 PNS24247 1044 945 35.7024 2.29674 PNS24249 1928 1829 48.1677 1.60099 PNS24246 1044 945 35.7024 2.29674 PNS24248 1044 945 35.7024 2.29674 PNS24244 1471 1372 224.737 9.95788 PNS24243 293 194 0 0 KQK14069 1603 1504 20997.6 848.726 KQK14071 474 375 1539.13 249.511 ==> SRR11216155.se.tsv <== BRADI_1g14170v3 25611 BRADI_1g53295v3 10 BRADI_1g59795v3 355 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 243 BRADI_1g74790v3 153 BRADI_1g09890v3 0 BRADI_1g77505v3 525 BRADI_1g48960v3 0 SRR11216155 completed mapping pipeline successfully