Starting /dee2/code/volunteer_pipeline.sh SRR11216156 current disk space = 1526807281664 free memory = 1602361892 SRR11216156 SRAfilesize 07250a83640932d981f24db483967b82 SRR11216156.sra SRR11216156.sra file validated SRR11216156 is single end SRR11216156 is conventional basespace SRR11216156 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42525 33.0 33.0 33.0 33.0 33.0 2 32.496 33.0 33.0 33.0 33.0 33.0 3 32.516 33.0 33.0 33.0 33.0 33.0 4 32.543 33.0 33.0 33.0 33.0 33.0 5 32.59875 33.0 33.0 33.0 33.0 33.0 6 35.80375 37.0 37.0 37.0 37.0 37.0 7 36.37875 37.0 37.0 37.0 37.0 37.0 8 36.332 37.0 37.0 37.0 37.0 37.0 9 36.4505 37.0 37.0 37.0 37.0 37.0 10-11 36.3965 37.0 37.0 37.0 37.0 37.0 12-13 36.449625 37.0 37.0 37.0 37.0 37.0 14-15 36.502625 37.0 37.0 37.0 37.0 37.0 16-17 36.487 37.0 37.0 37.0 37.0 37.0 18-19 36.481624999999994 37.0 37.0 37.0 37.0 37.0 20-21 36.506125 37.0 37.0 37.0 37.0 37.0 22-23 36.419250000000005 37.0 37.0 37.0 37.0 37.0 24-25 36.392125 37.0 37.0 37.0 37.0 37.0 26-27 36.408375 37.0 37.0 37.0 37.0 37.0 28-29 36.411375 37.0 37.0 37.0 37.0 37.0 30-31 36.376374999999996 37.0 37.0 37.0 37.0 37.0 32-33 36.3925 37.0 37.0 37.0 37.0 37.0 34-35 36.438125 37.0 37.0 37.0 37.0 37.0 36-37 36.382 37.0 37.0 37.0 37.0 37.0 38-39 36.384625 37.0 37.0 37.0 37.0 37.0 40-41 36.38475 37.0 37.0 37.0 37.0 37.0 42-43 36.445 37.0 37.0 37.0 37.0 37.0 44-45 36.305875 37.0 37.0 37.0 37.0 37.0 46-47 36.291250000000005 37.0 37.0 37.0 37.0 37.0 48-49 36.365625 37.0 37.0 37.0 37.0 37.0 50-51 36.36625 37.0 37.0 37.0 37.0 37.0 52-53 36.401125 37.0 37.0 37.0 37.0 37.0 54-55 36.439 37.0 37.0 37.0 37.0 37.0 56-57 36.415375 37.0 37.0 37.0 37.0 37.0 58-59 36.350375 37.0 37.0 37.0 37.0 37.0 60-61 36.299 37.0 37.0 37.0 37.0 37.0 62-63 36.3765 37.0 37.0 37.0 37.0 37.0 64-65 36.31575 37.0 37.0 37.0 37.0 37.0 66-67 36.38275 37.0 37.0 37.0 37.0 37.0 68-69 36.29125 37.0 37.0 37.0 37.0 37.0 70-71 36.291375 37.0 37.0 37.0 37.0 37.0 72-73 36.27975 37.0 37.0 37.0 37.0 37.0 74-75 36.225875 37.0 37.0 37.0 37.0 37.0 76-77 36.231750000000005 37.0 37.0 37.0 37.0 37.0 78-79 36.189125000000004 37.0 37.0 37.0 37.0 37.0 80-81 36.067750000000004 37.0 37.0 37.0 37.0 37.0 82-83 36.192875 37.0 37.0 37.0 37.0 37.0 84-85 36.128375 37.0 37.0 37.0 37.0 37.0 86-87 36.142125 37.0 37.0 37.0 37.0 37.0 88-89 36.074125 37.0 37.0 37.0 37.0 37.0 90-91 35.943625 37.0 37.0 37.0 37.0 37.0 92-93 36.00375 37.0 37.0 37.0 37.0 37.0 94-95 35.98025 37.0 37.0 37.0 37.0 37.0 96-97 35.806124999999994 37.0 37.0 37.0 37.0 37.0 98-99 35.7485 37.0 37.0 37.0 37.0 37.0 100-101 34.127375 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 2.0 22 2.0 23 3.0 24 5.0 25 5.0 26 7.0 27 11.0 28 21.0 29 21.0 30 30.0 31 41.0 32 48.0 33 76.0 34 108.0 35 250.0 36 3354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.63522012578616 9.0062893081761 8.90566037735849 48.45283018867924 2 22.25 14.325 37.8 25.624999999999996 3 22.400000000000002 16.150000000000002 23.75 37.7 4 27.450000000000003 24.625 21.099999999999998 26.825 5 26.700000000000003 27.975 24.325 21.0 6 22.04464738711314 31.075596144089296 24.987316083206494 21.89244038559107 7 17.65 22.2 38.7 21.45 8 20.95 22.675 29.15 27.224999999999998 9 20.5 21.75 32.300000000000004 25.45 10-11 24.65 28.7 22.0875 24.5625 12-13 22.7125 22.6375 27.287499999999998 27.3625 14-15 23.35 23.775 26.4625 26.4125 16-17 24.0 23.875 24.775 27.35 18-19 23.0125 24.375 25.837500000000002 26.775 20-21 23.75 25.6 24.462500000000002 26.187500000000004 22-23 23.825 25.0 25.2875 25.887500000000003 24-25 23.974999999999998 24.349999999999998 25.35 26.325 26-27 23.5625 24.5375 26.187500000000004 25.7125 28-29 24.349999999999998 25.087500000000002 23.549999999999997 27.0125 30-31 23.4625 25.324999999999996 25.5125 25.7 32-33 23.825 24.6125 25.674999999999997 25.887500000000003 34-35 24.087500000000002 24.4375 25.5375 25.937500000000004 36-37 24.15 23.7625 25.162499999999998 26.924999999999997 38-39 23.525 24.625 24.9 26.950000000000003 40-41 23.95 24.6625 24.474999999999998 26.9125 42-43 23.875 24.425 24.4125 27.287499999999998 44-45 24.05 24.55 25.5625 25.837500000000002 46-47 24.6625 25.275 24.3125 25.75 48-49 23.825 24.212500000000002 24.4875 27.474999999999998 50-51 24.5375 24.3625 24.125 26.974999999999998 52-53 23.47793474184273 24.753094136767096 25.14064258032254 26.62832854106763 54-55 23.81547693461683 24.24053006625828 24.640580072509064 27.303412926615827 56-57 24.099999999999998 24.4375 24.5 26.9625 58-59 24.7 24.4 24.212500000000002 26.687499999999996 60-61 24.3125 24.212500000000002 25.0 26.474999999999998 62-63 24.575 23.65 25.4875 26.2875 64-65 24.5375 23.7875 23.799999999999997 27.875 66-67 24.2625 24.775 24.7 26.2625 68-69 24.7 24.474999999999998 25.05 25.775 70-71 25.412499999999998 23.775 24.2 26.6125 72-73 24.9 23.7125 24.45 26.937499999999996 74-75 25.587500000000002 24.0125 24.349999999999998 26.05 76-77 24.978122265283158 24.128016002000248 24.190523815476936 26.703337917239654 78-79 23.775 24.65 24.625 26.950000000000003 80-81 24.778097262157768 24.428053506688336 24.290536317039628 26.503312914114264 82-83 24.8625 24.3 24.5625 26.275 84-85 24.36554569321165 24.04050506313289 24.54056757094637 27.053381672709087 86-87 24.793698424606152 23.918479619904975 24.781195298824706 26.506626656664167 88-89 24.92184569213455 24.27160185069401 24.109040890333873 26.697511566837562 90-91 25.78466925096911 24.421658121795673 24.071526822558457 25.722145804676757 92-93 24.84681755658372 24.221583093660122 24.446667500312618 26.484931849443544 94-95 25.543885971492873 24.406101525381345 23.93098274568642 26.11902975743936 96-97 24.918729682420604 24.218554638659665 24.668667166791696 26.19404851212803 98-99 24.874937468734366 23.66183091545773 25.200100050025014 26.263131565782892 100-101 25.89721145429536 24.559209703638864 22.696011004126547 26.84756783793923 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 0.0 29 0.5 30 4.0 31 4.5 32 3.0 33 4.5 34 11.5 35 24.5 36 32.0 37 43.5 38 63.5 39 77.5 40 94.5 41 122.5 42 160.5 43 172.0 44 158.5 45 169.0 46 178.5 47 169.5 48 159.5 49 165.0 50 165.0 51 150.5 52 149.5 53 145.5 54 132.0 55 128.5 56 137.5 57 130.5 58 121.0 59 121.0 60 120.0 61 108.0 62 90.5 63 80.5 64 76.5 65 64.5 66 52.0 67 49.0 68 43.5 69 33.0 70 22.0 71 21.0 72 15.0 73 9.5 74 5.5 75 3.0 76 3.5 77 2.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 1.4500000000000002 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.025 88-89 0.0375 90-91 0.0375 92-93 0.0375 94-95 0.025 96-97 0.025 98-99 0.05 100-101 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.20930232558139 94.05 2 2.4031007751937983 4.65 3 0.2842377260981912 0.8250000000000001 4 0.05167958656330749 0.2 5 0.025839793281653745 0.125 6 0.025839793281653745 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 6 0.15 No Hit CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.38749999999999996 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.8375 0.0 0.0 0.0 0.0 82-83 1.075 0.0 0.0 0.0 0.0 84-85 1.375 0.0 0.0 0.0 0.0 86-87 1.7625 0.0 0.0 0.0 0.0 88-89 2.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498676 READS because READLEN < 1 Read 1498676 spots for SRR11216156.sra Written 1498676 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra Rejected 1498663 READS because READLEN < 1 Read 1498663 spots for SRR11216156.sra Written 1498663 spots for SRR11216156.sra SRR ids: ['SRR11216156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_18vrtzcw SRR11216156.sra spots: 29973273 blocks: [[1, 1498663], [1498664, 2997326], [2997327, 4495989], [4495990, 5994652], [5994653, 7493315], [7493316, 8991978], [8991979, 10490641], [10490642, 11989304], [11989305, 13487967], [13487968, 14986630], [14986631, 16485293], [16485294, 17983956], [17983957, 19482619], [19482620, 20981282], [20981283, 22479945], [22479946, 23978608], [23978609, 25477271], [25477272, 26975934], [26975935, 28474597], [28474598, 29973273]] SRR11216156 file size 7237451 SRR11216156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216156 SRR11216156_1.fastq Input file: SRR11216156_1.fastq trimmed: SRR11216156-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:26:49 2024 >> started Tue Dec 10 08:27:04 2024 >> done (14.339s) 29973273 reads processed; of these: 12478 ( 0.04%) short reads filtered out after trimming by size control 40198 ( 0.13%) empty reads filtered out after trimming by size control 29920597 (99.82%) reads available; of these: 3096256 (10.35%) trimmed reads available after processing 26824341 (89.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 440 0.00% 19 490 0.00% 20 532 0.00% 21 624 0.00% 22 661 0.00% 23 776 0.00% 24 863 0.00% 25 1050 0.00% 26 943 0.00% 27 918 0.00% 28 932 0.00% 29 862 0.00% 30 849 0.00% 31 865 0.00% 32 894 0.00% 33 895 0.00% 34 832 0.00% 35 953 0.00% 36 954 0.00% 37 996 0.00% 38 1026 0.00% 39 1066 0.00% 40 1147 0.00% 41 1268 0.00% 42 1317 0.00% 43 1387 0.00% 44 1404 0.00% 45 1483 0.00% 46 1607 0.01% 47 1718 0.01% 48 1762 0.01% 49 2011 0.01% 50 2281 0.01% 51 2586 0.01% 52 2679 0.01% 53 2731 0.01% 54 2870 0.01% 55 3123 0.01% 56 3305 0.01% 57 3476 0.01% 58 3923 0.01% 59 4268 0.01% 60 4899 0.02% 61 5419 0.02% 62 5843 0.02% 63 6608 0.02% 64 7366 0.02% 65 8028 0.03% 66 8608 0.03% 67 9766 0.03% 68 10636 0.04% 69 11666 0.04% 70 2479 0.01% 71 3087 0.01% 72 3748 0.01% 73 4867 0.02% 74 3452 0.01% 75 3784 0.01% 76 3991 0.01% 77 4043 0.01% 78 4405 0.01% 79 5130 0.02% 80 5255 0.02% 81 5624 0.02% 82 6167 0.02% 83 7904 0.03% 84 7771 0.03% 85 8556 0.03% 86 10896 0.04% 87 10750 0.04% 88 11039 0.04% 89 13436 0.04% 90 14966 0.05% 91 17018 0.06% 92 20138 0.07% 93 24648 0.08% 94 31909 0.11% 95 41010 0.14% 96 57058 0.19% 97 84824 0.28% 98 139882 0.47% 99 450249 1.50% 100 1944564 6.50% 101 26824341 89.65% 29920597 reads passed initial QC criterion=sequence-density sequence-density=2.08 sequence-density-rank=1 fanout-score=59.66 fanout-score-rank=1 prefix-density=2.86 prefix-fanout=43.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=2.08 sequence-density-rank=1 fanout-score=59.66 fanout-score-rank=1 prefix-density=2.86 prefix-fanout=43.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR11216156 - Input file: STDIN trimmed: SRR11216156-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 08:28:02 2024 >> started Tue Dec 10 08:28:16 2024 >> done (13.605s) 9973532 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 10 ( 0.00%) empty reads filtered out after trimming by size control 9973515 (100.00%) reads available; of these: 760467 ( 7.62%) trimmed reads available after processing 9213048 (92.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 157 0.00% 19 152 0.00% 20 159 0.00% 21 217 0.00% 22 245 0.00% 23 260 0.00% 24 264 0.00% 25 342 0.00% 26 300 0.00% 27 309 0.00% 28 297 0.00% 29 275 0.00% 30 287 0.00% 31 316 0.00% 32 289 0.00% 33 303 0.00% 34 282 0.00% 35 308 0.00% 36 314 0.00% 37 333 0.00% 38 358 0.00% 39 335 0.00% 40 371 0.00% 41 423 0.00% 42 445 0.00% 43 453 0.00% 44 440 0.00% 45 474 0.00% 46 493 0.00% 47 564 0.01% 48 591 0.01% 49 704 0.01% 50 745 0.01% 51 845 0.01% 52 869 0.01% 53 910 0.01% 54 961 0.01% 55 1042 0.01% 56 1088 0.01% 57 1132 0.01% 58 1343 0.01% 59 1420 0.01% 60 1644 0.02% 61 1837 0.02% 62 1930 0.02% 63 2205 0.02% 64 2477 0.02% 65 2722 0.03% 66 2830 0.03% 67 3212 0.03% 68 3478 0.03% 69 3905 0.04% 70 4545 0.05% 71 4995 0.05% 72 5845 0.06% 73 7120 0.07% 74 7079 0.07% 75 7735 0.08% 76 8559 0.09% 77 9289 0.09% 78 10350 0.10% 79 11745 0.12% 80 12851 0.13% 81 13980 0.14% 82 15665 0.16% 83 17810 0.18% 84 18906 0.19% 85 21147 0.21% 86 23404 0.23% 87 24729 0.25% 88 26715 0.27% 89 28902 0.29% 90 31611 0.32% 91 34991 0.35% 92 38523 0.39% 93 41729 0.42% 94 47725 0.48% 95 55366 0.56% 96 72080 0.72% 97 106035 1.06% 98 228450 2.29% 99 140950 1.41% 100 611755 6.13% 101 8235274 82.57% criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=15 prefix-density=0.94 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=13.55 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=CAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGC Started job on | Dec 10 08:28:44 Started mapping on | Dec 10 08:28:44 Finished on | Dec 10 08:29:14 Mapping speed, Million of reads per hour | 3590.47 Number of input reads | 29920580 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 26385495 Uniquely mapped reads % | 88.19% Average mapped length | 99.72 Number of splices: Total | 7585722 Number of splices: Annotated (sjdb) | 7150212 Number of splices: GT/AG | 7470948 Number of splices: GC/AG | 98903 Number of splices: AT/AC | 2011 Number of splices: Non-canonical | 13860 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2479657 % of reads mapped to multiple loci | 8.29% Number of reads mapped to too many loci | 874108 % of reads mapped to too many loci | 2.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1055428 1055428 1055428 N_multimapping 2479657 2479657 2479657 N_noFeature 917481 25673193 1083418 N_ambiguous 601885 1253 57730 UnstrandedReadsAssigned:24866129 PositiveStrandReadsAssigned:711049 NegativeStrandReadsAssigned:25244347 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216156 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216156-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,920,580 reads, 25,474,071 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR11216156.ke.tsv 35125 SRR11216156.se.tsv 88098 total ==> SRR11216156.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 99.0661 6.88244 PNS24247 1044 945 7.5179 0.462602 PNS24249 1928 1829 26.6295 0.846626 PNS24246 1044 945 7.5179 0.462602 PNS24248 1044 945 7.5179 0.462602 PNS24244 1471 1372 230.751 9.77984 PNS24243 293 194 0 0 KQK14069 1603 1504 7783.42 300.93 KQK14071 474 375 483.754 75.013 ==> SRR11216156.se.tsv <== BRADI_1g14170v3 9260 BRADI_1g53295v3 17 BRADI_1g59795v3 635 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 245 BRADI_1g74790v3 169 BRADI_1g09890v3 0 BRADI_1g77505v3 425 BRADI_1g48960v3 0 SRR11216156 completed mapping pipeline successfully