Starting /dee2/code/volunteer_pipeline.sh SRR11216157 current disk space = 1526833811456 free memory = 1602358428 SRR11216157 SRAfilesize 8310879c41ad92d857aa58a1626913ac SRR11216157.sra SRR11216157.sra file validated SRR11216157 is single end SRR11216157 is conventional basespace SRR11216157 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216157_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4115 33.0 33.0 33.0 33.0 33.0 2 32.53125 33.0 33.0 33.0 33.0 33.0 3 32.47775 33.0 33.0 33.0 33.0 33.0 4 32.5695 33.0 33.0 33.0 33.0 33.0 5 32.57475 33.0 33.0 33.0 33.0 33.0 6 35.86275 37.0 37.0 37.0 37.0 37.0 7 36.293 37.0 37.0 37.0 37.0 37.0 8 36.34925 37.0 37.0 37.0 37.0 37.0 9 36.45225 37.0 37.0 37.0 37.0 37.0 10-11 36.361125 37.0 37.0 37.0 37.0 37.0 12-13 36.453 37.0 37.0 37.0 37.0 37.0 14-15 36.4355 37.0 37.0 37.0 37.0 37.0 16-17 36.39125 37.0 37.0 37.0 37.0 37.0 18-19 36.42775 37.0 37.0 37.0 37.0 37.0 20-21 36.416875 37.0 37.0 37.0 37.0 37.0 22-23 36.393249999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.346875 37.0 37.0 37.0 37.0 37.0 26-27 36.37175 37.0 37.0 37.0 37.0 37.0 28-29 36.361374999999995 37.0 37.0 37.0 37.0 37.0 30-31 36.340875 37.0 37.0 37.0 37.0 37.0 32-33 36.33225 37.0 37.0 37.0 37.0 37.0 34-35 36.399625 37.0 37.0 37.0 37.0 37.0 36-37 36.35275 37.0 37.0 37.0 37.0 37.0 38-39 36.383250000000004 37.0 37.0 37.0 37.0 37.0 40-41 36.341750000000005 37.0 37.0 37.0 37.0 37.0 42-43 36.367875 37.0 37.0 37.0 37.0 37.0 44-45 36.332499999999996 37.0 37.0 37.0 37.0 37.0 46-47 36.334625 37.0 37.0 37.0 37.0 37.0 48-49 36.407 37.0 37.0 37.0 37.0 37.0 50-51 36.35 37.0 37.0 37.0 37.0 37.0 52-53 36.335875 37.0 37.0 37.0 37.0 37.0 54-55 36.351125 37.0 37.0 37.0 37.0 37.0 56-57 36.428875000000005 37.0 37.0 37.0 37.0 37.0 58-59 36.3485 37.0 37.0 37.0 37.0 37.0 60-61 36.312125 37.0 37.0 37.0 37.0 37.0 62-63 36.33625 37.0 37.0 37.0 37.0 37.0 64-65 36.295625 37.0 37.0 37.0 37.0 37.0 66-67 36.28375 37.0 37.0 37.0 37.0 37.0 68-69 36.319500000000005 37.0 37.0 37.0 37.0 37.0 70-71 36.29475 37.0 37.0 37.0 37.0 37.0 72-73 36.292500000000004 37.0 37.0 37.0 37.0 37.0 74-75 36.231125 37.0 37.0 37.0 37.0 37.0 76-77 36.245125 37.0 37.0 37.0 37.0 37.0 78-79 36.258875 37.0 37.0 37.0 37.0 37.0 80-81 36.12325 37.0 37.0 37.0 37.0 37.0 82-83 36.14775 37.0 37.0 37.0 37.0 37.0 84-85 36.156 37.0 37.0 37.0 37.0 37.0 86-87 36.13575 37.0 37.0 37.0 37.0 37.0 88-89 36.1 37.0 37.0 37.0 37.0 37.0 90-91 35.97225 37.0 37.0 37.0 37.0 37.0 92-93 35.95175 37.0 37.0 37.0 37.0 37.0 94-95 35.9255 37.0 37.0 37.0 37.0 37.0 96-97 35.904624999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.77075 37.0 37.0 37.0 37.0 37.0 100-101 34.09925 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 0.0 20 2.0 21 1.0 22 1.0 23 2.0 24 6.0 25 6.0 26 7.0 27 17.0 28 14.0 29 32.0 30 33.0 31 47.0 32 58.0 33 81.0 34 98.0 35 245.0 36 3338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.011046949535526 9.615867436605575 7.5822244539292 50.790861159929705 2 20.474999999999998 13.875000000000002 40.75 24.9 3 20.925 16.150000000000002 23.65 39.275 4 27.6 24.05 20.8 27.55 5 27.325 29.375 23.775 19.525000000000002 6 22.1969696969697 30.732323232323232 24.873737373737374 22.1969696969697 7 19.3 22.35 37.675 20.674999999999997 8 20.3 23.200000000000003 30.375000000000004 26.125 9 19.975 21.2 33.25 25.575 10-11 23.3125 28.0625 23.9125 24.712500000000002 12-13 23.1875 22.6 26.2625 27.950000000000003 14-15 22.3875 25.3 25.912499999999998 26.400000000000002 16-17 23.599999999999998 25.324999999999996 24.6 26.474999999999998 18-19 23.3125 24.962500000000002 25.775 25.95 20-21 23.45 24.837500000000002 25.5 26.2125 22-23 23.974999999999998 24.5 25.874999999999996 25.650000000000002 24-25 23.990498812351543 23.56544568071009 25.740717589698715 26.703337917239654 26-27 23.8875 23.7375 25.95 26.424999999999997 28-29 22.6875 24.8625 25.1875 27.2625 30-31 23.625 24.1875 25.724999999999998 26.4625 32-33 23.3125 25.2375 25.25 26.200000000000003 34-35 23.6625 25.074999999999996 25.85 25.412499999999998 36-37 23.075000000000003 24.7375 25.025 27.1625 38-39 23.1375 24.4375 26.0 26.424999999999997 40-41 23.9 24.5625 24.7875 26.75 42-43 23.225 24.65 25.0125 27.1125 44-45 23.2625 24.175 25.7875 26.775 46-47 24.9375 24.0 25.162499999999998 25.900000000000002 48-49 22.537499999999998 24.212500000000002 25.5125 27.737499999999997 50-51 23.8375 24.3875 25.95 25.825 52-53 24.30303787973497 24.46555819477435 25.965745718214777 25.26565820727591 54-55 23.31541442680335 24.05300662582823 24.815601950243778 27.815976997124643 56-57 22.7 24.425 25.7125 27.1625 58-59 23.375 25.137500000000003 25.7 25.7875 60-61 24.15 24.625 25.224999999999998 26.0 62-63 24.15 24.0125 24.975 26.8625 64-65 24.375 23.925 24.6625 27.037499999999998 66-67 23.7875 24.474999999999998 25.2375 26.5 68-69 23.4375 24.825 25.7125 26.025 70-71 24.1375 24.4875 25.525 25.85 72-73 24.587500000000002 24.224999999999998 24.8625 26.325 74-75 24.1125 25.074999999999996 24.85 25.9625 76-77 24.128016002000248 25.778222277784725 24.928116014501814 25.165645705713214 78-79 24.5 24.7 24.625 26.174999999999997 80-81 24.00300037504688 24.028003500437556 25.565695711963997 26.403300412551566 82-83 25.5125 24.1875 24.2 26.1 84-85 24.103012876609576 24.74059257407176 24.515564445555693 26.64083010376297 86-87 23.980995248812203 24.55613903475869 25.481370342585645 25.98149537384346 88-89 23.980995248812203 24.706176544136035 24.781195298824706 26.531632908227053 90-91 24.593648412103025 24.243560890222557 24.681170292573142 26.481620405101275 92-93 24.15603900975244 24.343585896474117 25.168792198049513 26.331582895723933 94-95 24.643660915228807 24.20605151287822 24.218554638659665 26.93173293323331 96-97 24.20605151287822 24.056014003500874 25.618904726181547 26.11902975743936 98-99 24.831207801950487 24.118529632408105 24.668667166791696 26.38159539884971 100-101 25.30632658164541 25.331332833208304 24.218554638659665 25.143785946486624 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 1.0 29 3.5 30 3.0 31 3.0 32 6.0 33 6.0 34 12.0 35 23.0 36 30.5 37 46.0 38 67.0 39 88.5 40 103.0 41 121.5 42 153.0 43 176.5 44 186.5 45 186.0 46 200.5 47 196.5 48 177.0 49 172.5 50 162.5 51 146.5 52 140.0 53 137.0 54 119.0 55 121.5 56 128.5 57 120.0 58 120.0 59 115.5 60 110.5 61 104.5 62 86.0 63 77.0 64 68.0 65 58.5 66 54.0 67 45.5 68 35.0 69 30.5 70 27.0 71 14.5 72 5.5 73 3.5 74 2.5 75 2.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.025 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.025 96-97 0.025 98-99 0.025 100-101 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16044966785897 96.05 2 1.6096065406234032 3.15 3 0.1532958610117527 0.44999999999999996 4 0.0510986203372509 0.2 5 0.0 0.0 6 0.02554931016862545 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.4375 0.0 0.0 0.0 0.0 74-75 0.5375000000000001 0.0 0.0 0.0 0.0 76-77 0.75 0.0 0.0 0.0 0.0 78-79 0.9625 0.0 0.0 0.0 0.0 80-81 1.1625 0.0 0.0 0.0 0.0 82-83 1.325 0.0 0.0 0.0 0.0 84-85 1.5875 0.0 0.0 0.0 0.0 86-87 1.8875000000000002 0.0 0.0 0.0 0.0 88-89 2.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432507 READS because READLEN < 1 Read 1432507 spots for SRR11216157.sra Written 1432507 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra Rejected 1432498 READS because READLEN < 1 Read 1432498 spots for SRR11216157.sra Written 1432498 spots for SRR11216157.sra SRR ids: ['SRR11216157.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s2ubm_iu SRR11216157.sra spots: 28649969 blocks: [[1, 1432498], [1432499, 2864996], [2864997, 4297494], [4297495, 5729992], [5729993, 7162490], [7162491, 8594988], [8594989, 10027486], [10027487, 11459984], [11459985, 12892482], [12892483, 14324980], [14324981, 15757478], [15757479, 17189976], [17189977, 18622474], [18622475, 20054972], [20054973, 21487470], [21487471, 22919968], [22919969, 24352466], [24352467, 25784964], [25784965, 27217462], [27217463, 28649969]] SRR11216157 file size 6916963 SRR11216157 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216157 SRR11216157_1.fastq Input file: SRR11216157_1.fastq trimmed: SRR11216157-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:27:38 2024 >> started Tue Dec 10 08:27:52 2024 >> done (13.887s) 28649969 reads processed; of these: 10534 ( 0.04%) short reads filtered out after trimming by size control 27209 ( 0.09%) empty reads filtered out after trimming by size control 28612226 (99.87%) reads available; of these: 2943238 (10.29%) trimmed reads available after processing 25668988 (89.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 446 0.00% 19 513 0.00% 20 463 0.00% 21 529 0.00% 22 601 0.00% 23 707 0.00% 24 798 0.00% 25 961 0.00% 26 957 0.00% 27 820 0.00% 28 803 0.00% 29 808 0.00% 30 812 0.00% 31 769 0.00% 32 797 0.00% 33 836 0.00% 34 847 0.00% 35 854 0.00% 36 926 0.00% 37 987 0.00% 38 933 0.00% 39 1079 0.00% 40 1075 0.00% 41 1205 0.00% 42 1240 0.00% 43 1330 0.00% 44 1405 0.00% 45 1470 0.01% 46 1530 0.01% 47 1695 0.01% 48 1841 0.01% 49 2017 0.01% 50 2220 0.01% 51 2537 0.01% 52 2694 0.01% 53 2828 0.01% 54 2851 0.01% 55 3144 0.01% 56 3390 0.01% 57 3608 0.01% 58 4019 0.01% 59 4393 0.02% 60 4933 0.02% 61 5547 0.02% 62 6173 0.02% 63 6537 0.02% 64 7447 0.03% 65 8252 0.03% 66 8942 0.03% 67 9886 0.03% 68 10901 0.04% 69 11799 0.04% 70 2377 0.01% 71 2828 0.01% 72 3036 0.01% 73 4343 0.02% 74 3132 0.01% 75 3421 0.01% 76 3772 0.01% 77 3825 0.01% 78 4110 0.01% 79 4931 0.02% 80 5003 0.02% 81 5151 0.02% 82 5651 0.02% 83 7449 0.03% 84 7223 0.03% 85 8336 0.03% 86 10193 0.04% 87 10077 0.04% 88 10447 0.04% 89 12596 0.04% 90 13805 0.05% 91 16042 0.06% 92 18841 0.07% 93 23330 0.08% 94 29551 0.10% 95 38826 0.14% 96 53278 0.19% 97 80263 0.28% 98 131588 0.46% 99 427429 1.49% 100 1848229 6.46% 101 25668988 89.71% 28612226 reads passed initial QC criterion=sequence-density sequence-density=2.16 sequence-density-rank=1 fanout-score=56.75 fanout-score-rank=1 prefix-density=2.94 prefix-fanout=41.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=2.16 sequence-density-rank=1 fanout-score=56.75 fanout-score-rank=1 prefix-density=2.94 prefix-fanout=41.6 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR11216157 - Input file: STDIN trimmed: SRR11216157-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 08:29:06 2024 >> started Tue Dec 10 08:29:20 2024 >> done (13.910s) 9537409 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 9537400 (100.00%) reads available; of these: 732926 ( 7.68%) trimmed reads available after processing 8804474 (92.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 144 0.00% 19 167 0.00% 20 162 0.00% 21 181 0.00% 22 209 0.00% 23 264 0.00% 24 241 0.00% 25 310 0.00% 26 305 0.00% 27 252 0.00% 28 267 0.00% 29 241 0.00% 30 288 0.00% 31 255 0.00% 32 261 0.00% 33 288 0.00% 34 268 0.00% 35 268 0.00% 36 280 0.00% 37 332 0.00% 38 305 0.00% 39 366 0.00% 40 365 0.00% 41 373 0.00% 42 395 0.00% 43 446 0.00% 44 480 0.01% 45 500 0.01% 46 513 0.01% 47 581 0.01% 48 583 0.01% 49 656 0.01% 50 723 0.01% 51 845 0.01% 52 869 0.01% 53 966 0.01% 54 948 0.01% 55 1057 0.01% 56 1119 0.01% 57 1137 0.01% 58 1377 0.01% 59 1480 0.02% 60 1701 0.02% 61 1790 0.02% 62 2081 0.02% 63 2196 0.02% 64 2527 0.03% 65 2694 0.03% 66 2923 0.03% 67 3220 0.03% 68 3637 0.04% 69 4083 0.04% 70 4585 0.05% 71 5283 0.06% 72 5670 0.06% 73 6991 0.07% 74 7073 0.07% 75 7912 0.08% 76 8678 0.09% 77 9414 0.10% 78 10196 0.11% 79 11941 0.13% 80 12844 0.13% 81 14116 0.15% 82 15750 0.17% 83 17234 0.18% 84 18584 0.19% 85 20389 0.21% 86 22322 0.23% 87 23472 0.25% 88 26062 0.27% 89 27695 0.29% 90 29685 0.31% 91 33127 0.35% 92 35495 0.37% 93 39286 0.41% 94 44210 0.46% 95 51261 0.54% 96 67145 0.70% 97 101787 1.07% 98 221402 2.32% 99 133239 1.40% 100 580660 6.09% 101 7875973 82.58% criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=13 prefix-density=0.81 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=15.23 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=2.5 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGTGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAAT Started job on | Dec 10 08:29:55 Started mapping on | Dec 10 08:29:55 Finished on | Dec 10 08:30:23 Mapping speed, Million of reads per hour | 3678.71 Number of input reads | 28612217 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 25643463 Uniquely mapped reads % | 89.62% Average mapped length | 99.71 Number of splices: Total | 8527392 Number of splices: Annotated (sjdb) | 8098050 Number of splices: GT/AG | 8400722 Number of splices: GC/AG | 110670 Number of splices: AT/AC | 2870 Number of splices: Non-canonical | 13130 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.91 Insertion rate per base | 0.01% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1950104 % of reads mapped to multiple loci | 6.82% Number of reads mapped to too many loci | 842893 % of reads mapped to too many loci | 2.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1018650 1018650 1018650 N_multimapping 1950104 1950104 1950104 N_noFeature 940990 25019645 1093461 N_ambiguous 524300 1334 54376 UnstrandedReadsAssigned:24178173 PositiveStrandReadsAssigned:622484 NegativeStrandReadsAssigned:24495626 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216157 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216157-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,612,217 reads, 24,771,341 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52973 SRR11216157.ke.tsv 35125 SRR11216157.se.tsv 88098 total ==> SRR11216157.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 37.1921 2.81777 PNS24247 1044 945 47.4152 3.18174 PNS24249 1928 1829 44.732 1.5509 PNS24246 1044 945 47.4152 3.18174 PNS24248 1044 945 47.4152 3.18174 PNS24244 1471 1372 203.83 9.42094 PNS24243 293 194 0 0 KQK14069 1603 1504 5942.74 250.564 KQK14071 474 375 589.279 99.6482 ==> SRR11216157.se.tsv <== BRADI_1g14170v3 7287 BRADI_1g53295v3 10 BRADI_1g59795v3 619 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 404 BRADI_1g74790v3 149 BRADI_1g09890v3 0 BRADI_1g77505v3 387 BRADI_1g48960v3 0 SRR11216157 completed mapping pipeline successfully