Starting /dee2/code/volunteer_pipeline.sh SRR11216158 current disk space = 1526837190656 free memory = 1431902552 SRR11216158 SRAfilesize 535c67dd3eef08531414c6dfb24da14d SRR11216158.sra SRR11216158.sra file validated SRR11216158 is single end SRR11216158 is conventional basespace SRR11216158 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2565 33.0 33.0 33.0 33.0 33.0 2 32.256 33.0 33.0 33.0 33.0 33.0 3 32.27875 33.0 33.0 33.0 33.0 33.0 4 32.3835 33.0 33.0 33.0 33.0 33.0 5 32.30075 33.0 33.0 33.0 33.0 33.0 6 35.559 37.0 37.0 37.0 33.0 37.0 7 36.06125 37.0 37.0 37.0 37.0 37.0 8 36.0455 37.0 37.0 37.0 37.0 37.0 9 36.21825 37.0 37.0 37.0 37.0 37.0 10-11 36.165375 37.0 37.0 37.0 37.0 37.0 12-13 36.1865 37.0 37.0 37.0 37.0 37.0 14-15 36.160624999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.161500000000004 37.0 37.0 37.0 37.0 37.0 18-19 36.167249999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.186125000000004 37.0 37.0 37.0 37.0 37.0 22-23 36.171125 37.0 37.0 37.0 37.0 37.0 24-25 36.10125 37.0 37.0 37.0 37.0 37.0 26-27 36.101875 37.0 37.0 37.0 37.0 37.0 28-29 36.159125 37.0 37.0 37.0 37.0 37.0 30-31 36.086 37.0 37.0 37.0 37.0 37.0 32-33 36.077625 37.0 37.0 37.0 37.0 37.0 34-35 36.056 37.0 37.0 37.0 37.0 37.0 36-37 36.090125 37.0 37.0 37.0 37.0 37.0 38-39 36.045249999999996 37.0 37.0 37.0 37.0 37.0 40-41 36.068625 37.0 37.0 37.0 37.0 37.0 42-43 36.12125 37.0 37.0 37.0 37.0 37.0 44-45 36.015125 37.0 37.0 37.0 37.0 37.0 46-47 36.0005 37.0 37.0 37.0 37.0 37.0 48-49 36.02375 37.0 37.0 37.0 37.0 37.0 50-51 36.07575 37.0 37.0 37.0 37.0 37.0 52-53 36.102625 37.0 37.0 37.0 37.0 37.0 54-55 36.066125 37.0 37.0 37.0 37.0 37.0 56-57 36.09525 37.0 37.0 37.0 37.0 37.0 58-59 35.99975 37.0 37.0 37.0 37.0 37.0 60-61 36.047375 37.0 37.0 37.0 37.0 37.0 62-63 36.002125 37.0 37.0 37.0 37.0 37.0 64-65 35.9755 37.0 37.0 37.0 37.0 37.0 66-67 36.0245 37.0 37.0 37.0 37.0 37.0 68-69 36.002125 37.0 37.0 37.0 37.0 37.0 70-71 35.967124999999996 37.0 37.0 37.0 37.0 37.0 72-73 35.978625 37.0 37.0 37.0 37.0 37.0 74-75 35.953374999999994 37.0 37.0 37.0 37.0 37.0 76-77 35.941375 37.0 37.0 37.0 37.0 37.0 78-79 35.93025 37.0 37.0 37.0 37.0 37.0 80-81 35.778625000000005 37.0 37.0 37.0 37.0 37.0 82-83 35.783125 37.0 37.0 37.0 37.0 37.0 84-85 35.817625 37.0 37.0 37.0 37.0 37.0 86-87 35.778 37.0 37.0 37.0 37.0 37.0 88-89 35.694375 37.0 37.0 37.0 37.0 37.0 90-91 35.588499999999996 37.0 37.0 37.0 37.0 37.0 92-93 35.6605 37.0 37.0 37.0 37.0 37.0 94-95 35.55575 37.0 37.0 37.0 35.0 37.0 96-97 35.555125000000004 37.0 37.0 37.0 37.0 37.0 98-99 35.444874999999996 37.0 37.0 37.0 35.0 37.0 100-101 33.7095 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 3.0 4 2.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 3.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 2.0 19 0.0 20 2.0 21 3.0 22 2.0 23 2.0 24 8.0 25 11.0 26 10.0 27 9.0 28 22.0 29 30.0 30 35.0 31 39.0 32 48.0 33 72.0 34 126.0 35 227.0 36 3307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.91217063989962 10.614805520702635 8.155583437892096 51.31744040150564 2 19.7 14.274999999999999 40.175 25.85 3 20.1 16.575 24.9 38.425 4 26.075 23.95 21.475 28.499999999999996 5 25.724999999999998 28.525 23.775 21.975 6 20.90609972158947 31.738800303720577 25.15818780055682 22.196912174133132 7 19.25 22.175 37.925 20.65 8 19.900000000000002 21.675 31.25 27.175 9 21.575 20.95 32.675 24.8 10-11 23.974999999999998 28.625 22.412499999999998 24.9875 12-13 23.599999999999998 21.875 26.575 27.950000000000003 14-15 22.912499999999998 24.637500000000003 25.575 26.875 16-17 23.8375 24.0125 24.962500000000002 27.187499999999996 18-19 23.9 24.2875 24.8125 27.0 20-21 23.925 24.4875 25.2625 26.325 22-23 22.900000000000002 24.837500000000002 25.624999999999996 26.637499999999996 24-25 23.7375 25.025 24.4875 26.75 26-27 23.6375 24.224999999999998 25.624999999999996 26.5125 28-29 24.175 24.462500000000002 25.4875 25.874999999999996 30-31 22.3375 25.025 25.4875 27.150000000000002 32-33 24.1875 24.224999999999998 25.424999999999997 26.1625 34-35 24.1125 24.525 25.087500000000002 26.275 36-37 24.875 23.95 24.5 26.674999999999997 38-39 23.599999999999998 24.3 25.4625 26.637499999999996 40-41 24.5 24.3625 24.325 26.8125 42-43 25.0 24.05 24.762500000000003 26.187500000000004 44-45 24.9125 23.849999999999998 25.2875 25.95 46-47 23.275000000000002 24.7 25.7 26.325 48-49 24.0125 23.625 25.637500000000003 26.724999999999998 50-51 24.025 24.325 24.925 26.724999999999998 52-53 23.3125 24.625 24.3875 27.675 54-55 23.1125 24.725 24.462500000000002 27.700000000000003 56-57 24.625 24.15 25.15 26.075 58-59 24.1125 24.349999999999998 24.575 26.9625 60-61 24.462500000000002 23.5125 25.662499999999998 26.3625 62-63 23.5 23.6625 25.374999999999996 27.462500000000002 64-65 23.875 24.3125 25.2875 26.525 66-67 24.0375 24.087500000000002 25.025 26.85 68-69 23.9375 24.4875 25.674999999999997 25.900000000000002 70-71 24.474999999999998 24.025 25.162499999999998 26.337500000000002 72-73 23.599999999999998 24.2375 25.3125 26.85 74-75 24.125 23.599999999999998 24.5625 27.712500000000002 76-77 24.775 24.95 24.1125 26.1625 78-79 24.0375 24.3 24.4125 27.250000000000004 80-81 24.337500000000002 24.5125 25.174999999999997 25.974999999999998 82-83 24.337500000000002 25.0 24.5375 26.125 84-85 25.0625 22.35 24.3 28.287499999999998 86-87 24.7375 24.175 24.65 26.437500000000004 88-89 24.57807225903238 24.603075384423054 24.74059257407176 26.078259782472806 90-91 24.34054256782098 24.478059757469683 24.24053006625828 26.940867608451057 92-93 25.387500000000003 24.4 24.0625 26.150000000000002 94-95 24.15 24.875 24.425 26.55 96-97 24.45 24.637500000000003 23.4875 27.425 98-99 24.793698424606152 24.33108277069267 24.468617154288573 26.406601650412604 100-101 24.7875 24.712500000000002 24.05 26.450000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 0.5 29 2.5 30 3.5 31 5.5 32 7.0 33 7.0 34 10.5 35 14.5 36 23.0 37 40.5 38 63.0 39 75.0 40 94.5 41 126.5 42 143.5 43 142.5 44 158.0 45 166.5 46 169.0 47 182.0 48 173.0 49 173.5 50 171.5 51 156.0 52 148.5 53 147.5 54 151.0 55 154.0 56 165.0 57 156.5 58 136.5 59 126.0 60 110.0 61 102.5 62 87.5 63 68.5 64 66.0 65 62.5 66 54.5 67 48.5 68 34.0 69 20.5 70 16.0 71 12.0 72 9.5 73 6.5 74 3.0 75 1.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 1.225 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.675 #Duplication Level Percentage of deduplicated Percentage of total 1 96.39404233080742 92.225 2 2.9527044682518944 5.65 3 0.4964724327149203 1.425 4 0.07839038411288216 0.3 5 0.052260256075254766 0.25 6 0.026130128037627383 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGCATCGAGCTATTTTGCCGCAGGACCTCCCCTACAGTATCGTCACCG 6 0.15 No Hit CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 5 0.125 No Hit CCCGAAGTTACGGGGCTATTTTGCCGAGTTCCTTAGAGAGAGTTGTCTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.625 0.0 0.0 0.0 0.0 78-79 0.775 0.0 0.0 0.0 0.0 80-81 0.9 0.0 0.0 0.0 0.0 82-83 1.1875 0.0 0.0 0.0 0.0 84-85 1.5 0.0 0.0 0.0 0.0 86-87 1.9249999999999998 0.0 0.0 0.0 0.0 88-89 2.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541039 READS because READLEN < 1 Read 1541039 spots for SRR11216158.sra Written 1541039 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra Rejected 1541027 READS because READLEN < 1 Read 1541027 spots for SRR11216158.sra Written 1541027 spots for SRR11216158.sra SRR ids: ['SRR11216158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3jr_bwyi SRR11216158.sra spots: 30820552 blocks: [[1, 1541027], [1541028, 3082054], [3082055, 4623081], [4623082, 6164108], [6164109, 7705135], [7705136, 9246162], [9246163, 10787189], [10787190, 12328216], [12328217, 13869243], [13869244, 15410270], [15410271, 16951297], [16951298, 18492324], [18492325, 20033351], [20033352, 21574378], [21574379, 23115405], [23115406, 24656432], [24656433, 26197459], [26197460, 27738486], [27738487, 29279513], [29279514, 30820552]] SRR11216158 file size 7442652 SRR11216158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216158 SRR11216158_1.fastq Input file: SRR11216158_1.fastq trimmed: SRR11216158-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:28:02 2024 >> started Tue Dec 10 08:28:47 2024 >> done (44.858s) 30820552 reads processed; of these: 29618 ( 0.10%) short reads filtered out after trimming by size control 184864 ( 0.60%) empty reads filtered out after trimming by size control 30606070 (99.30%) reads available; of these: 3333523 (10.89%) trimmed reads available after processing 27272547 (89.11%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 842 0.00% 19 965 0.00% 20 976 0.00% 21 871 0.00% 22 1001 0.00% 23 1025 0.00% 24 1262 0.00% 25 1430 0.00% 26 1479 0.00% 27 1170 0.00% 28 1219 0.00% 29 1180 0.00% 30 1271 0.00% 31 1178 0.00% 32 1240 0.00% 33 1238 0.00% 34 1229 0.00% 35 1173 0.00% 36 1217 0.00% 37 1401 0.00% 38 1552 0.01% 39 1413 0.00% 40 1546 0.01% 41 1590 0.01% 42 1644 0.01% 43 1684 0.01% 44 1755 0.01% 45 1865 0.01% 46 1891 0.01% 47 2281 0.01% 48 2381 0.01% 49 2434 0.01% 50 2822 0.01% 51 3130 0.01% 52 2906 0.01% 53 3222 0.01% 54 3164 0.01% 55 3480 0.01% 56 3636 0.01% 57 3852 0.01% 58 4320 0.01% 59 4737 0.02% 60 5253 0.02% 61 5784 0.02% 62 6355 0.02% 63 6804 0.02% 64 7551 0.02% 65 8657 0.03% 66 9344 0.03% 67 10834 0.04% 68 12097 0.04% 69 12842 0.04% 70 5843 0.02% 71 10740 0.04% 72 32453 0.11% 73 33772 0.11% 74 9271 0.03% 75 4981 0.02% 76 4697 0.02% 77 4667 0.02% 78 5005 0.02% 79 5966 0.02% 80 5969 0.02% 81 6313 0.02% 82 6779 0.02% 83 8681 0.03% 84 8577 0.03% 85 9584 0.03% 86 11826 0.04% 87 11752 0.04% 88 12269 0.04% 89 14671 0.05% 90 16251 0.05% 91 18351 0.06% 92 22284 0.07% 93 27105 0.09% 94 34767 0.11% 95 44454 0.15% 96 61598 0.20% 97 91001 0.30% 98 149449 0.49% 99 472162 1.54% 100 2016092 6.59% 101 27272547 89.11% 30606070 reads passed initial QC criterion=sequence-density sequence-density=1.89 sequence-density-rank=1 fanout-score=58.17 fanout-score-rank=1 prefix-density=2.60 prefix-fanout=42.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=1.89 sequence-density-rank=1 fanout-score=58.17 fanout-score-rank=1 prefix-density=2.60 prefix-fanout=42.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Started job on | Dec 10 08:29:05 Started mapping on | Dec 10 08:29:05 Finished on | Dec 10 08:29:56 Mapping speed, Million of reads per hour | 2160.43 Number of input reads | 30606070 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 25589746 Uniquely mapped reads % | 83.61% Average mapped length | 99.78 Number of splices: Total | 7691434 Number of splices: Annotated (sjdb) | 7271079 Number of splices: GT/AG | 7574284 Number of splices: GC/AG | 100727 Number of splices: AT/AC | 2275 Number of splices: Non-canonical | 14148 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3342956 % of reads mapped to multiple loci | 10.92% Number of reads mapped to too many loci | 1368212 % of reads mapped to too many loci | 4.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1673368 1673368 1673368 N_multimapping 3342956 3342956 3342956 N_noFeature 1057926 24936233 1196675 N_ambiguous 567392 1228 54849 UnstrandedReadsAssigned:23964428 PositiveStrandReadsAssigned:652285 NegativeStrandReadsAssigned:24338222 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216158 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216158-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,606,070 reads, 24,693,363 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR11216158.ke.tsv 35125 SRR11216158.se.tsv 88098 total ==> SRR11216158.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 149.661 10.791 PNS24247 1044 945 9.39837 0.600203 PNS24249 1928 1829 11.7442 0.387514 PNS24246 1044 945 9.39837 0.600203 PNS24248 1044 945 9.39837 0.600203 PNS24244 1471 1372 134.399 5.91181 PNS24243 293 194 0 0 KQK14069 1603 1504 5667.1 227.4 KQK14071 474 375 342.74 55.1583 ==> SRR11216158.se.tsv <== BRADI_1g14170v3 6605 BRADI_1g53295v3 5 BRADI_1g59795v3 516 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 214 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 399 BRADI_1g48960v3 0 SRR11216158 completed mapping pipeline successfully