Starting /dee2/code/volunteer_pipeline.sh SRR11216159 current disk space = 1526826139648 free memory = 1602354476 SRR11216159 SRAfilesize 48b596b76079671559b9e399d1ff4043 SRR11216159.sra SRR11216159.sra file validated SRR11216159 is single end SRR11216159 is conventional basespace SRR11216159 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3625 33.0 33.0 33.0 33.0 33.0 2 32.4035 33.0 33.0 33.0 33.0 33.0 3 32.466 33.0 33.0 33.0 33.0 33.0 4 32.5285 33.0 33.0 33.0 33.0 33.0 5 32.506 33.0 33.0 33.0 33.0 33.0 6 35.64325 37.0 37.0 37.0 33.0 37.0 7 36.2105 37.0 37.0 37.0 37.0 37.0 8 36.32775 37.0 37.0 37.0 37.0 37.0 9 36.39825 37.0 37.0 37.0 37.0 37.0 10-11 36.40175 37.0 37.0 37.0 37.0 37.0 12-13 36.419 37.0 37.0 37.0 37.0 37.0 14-15 36.405125 37.0 37.0 37.0 37.0 37.0 16-17 36.436499999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.454625 37.0 37.0 37.0 37.0 37.0 20-21 36.441125 37.0 37.0 37.0 37.0 37.0 22-23 36.358125 37.0 37.0 37.0 37.0 37.0 24-25 36.38825 37.0 37.0 37.0 37.0 37.0 26-27 36.389875 37.0 37.0 37.0 37.0 37.0 28-29 36.323375 37.0 37.0 37.0 37.0 37.0 30-31 36.341 37.0 37.0 37.0 37.0 37.0 32-33 36.391875 37.0 37.0 37.0 37.0 37.0 34-35 36.356 37.0 37.0 37.0 37.0 37.0 36-37 36.29375 37.0 37.0 37.0 37.0 37.0 38-39 36.274625 37.0 37.0 37.0 37.0 37.0 40-41 36.337125 37.0 37.0 37.0 37.0 37.0 42-43 36.333125 37.0 37.0 37.0 37.0 37.0 44-45 36.197374999999994 37.0 37.0 37.0 37.0 37.0 46-47 36.251125 37.0 37.0 37.0 37.0 37.0 48-49 36.40075 37.0 37.0 37.0 37.0 37.0 50-51 36.36175 37.0 37.0 37.0 37.0 37.0 52-53 36.315625 37.0 37.0 37.0 37.0 37.0 54-55 36.28775 37.0 37.0 37.0 37.0 37.0 56-57 36.309 37.0 37.0 37.0 37.0 37.0 58-59 36.277874999999995 37.0 37.0 37.0 37.0 37.0 60-61 36.308499999999995 37.0 37.0 37.0 37.0 37.0 62-63 36.240624999999994 37.0 37.0 37.0 37.0 37.0 64-65 36.258375 37.0 37.0 37.0 37.0 37.0 66-67 36.253125 37.0 37.0 37.0 37.0 37.0 68-69 36.2885 37.0 37.0 37.0 37.0 37.0 70-71 36.223875 37.0 37.0 37.0 37.0 37.0 72-73 36.266875 37.0 37.0 37.0 37.0 37.0 74-75 36.25475 37.0 37.0 37.0 37.0 37.0 76-77 36.24525 37.0 37.0 37.0 37.0 37.0 78-79 36.205125 37.0 37.0 37.0 37.0 37.0 80-81 36.1075 37.0 37.0 37.0 37.0 37.0 82-83 36.03575 37.0 37.0 37.0 37.0 37.0 84-85 36.036875 37.0 37.0 37.0 37.0 37.0 86-87 36.067375 37.0 37.0 37.0 37.0 37.0 88-89 35.97 37.0 37.0 37.0 37.0 37.0 90-91 35.875 37.0 37.0 37.0 37.0 37.0 92-93 35.911375 37.0 37.0 37.0 37.0 37.0 94-95 35.855125 37.0 37.0 37.0 37.0 37.0 96-97 35.746375 37.0 37.0 37.0 37.0 37.0 98-99 35.66775 37.0 37.0 37.0 37.0 37.0 100-101 34.03225 37.0 35.0 37.0 27.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 0.0 5 1.0 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 0.0 22 3.0 23 4.0 24 6.0 25 10.0 26 6.0 27 15.0 28 11.0 29 21.0 30 27.0 31 40.0 32 54.0 33 65.0 34 120.0 35 238.0 36 3356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.71708051166291 10.55931778279408 5.643340857787811 40.080260847755206 2 25.025 13.600000000000001 35.525 25.85 3 21.625 17.474999999999998 24.075 36.825 4 27.950000000000003 23.849999999999998 21.075 27.125 5 26.125 29.049999999999997 22.275 22.55 6 22.731880385200203 30.9680689305626 23.01064368981247 23.289406994424734 7 19.7 22.3 37.55 20.45 8 20.575 22.400000000000002 30.349999999999998 26.674999999999997 9 20.875 20.05 33.5 25.575 10-11 24.762500000000003 27.9375 22.8375 24.462500000000002 12-13 24.075 22.3875 25.525 28.012500000000003 14-15 23.2125 24.2625 25.8125 26.7125 16-17 24.925 23.4125 25.137500000000003 26.525 18-19 24.825 24.2875 24.7 26.187500000000004 20-21 23.9125 24.1125 25.575 26.400000000000002 22-23 24.825 23.9375 25.775 25.4625 24-25 24.775 23.25 24.5125 27.462500000000002 26-27 23.6125 24.375 25.624999999999996 26.387500000000003 28-29 24.337500000000002 24.587500000000002 25.374999999999996 25.7 30-31 24.2875 24.125 25.35 26.237500000000004 32-33 23.8375 23.8375 24.4875 27.8375 34-35 24.8 24.5 24.3625 26.337500000000002 36-37 24.4875 23.1375 24.95 27.425 38-39 24.775 24.125 24.1875 26.9125 40-41 25.362499999999997 24.4125 24.4125 25.8125 42-43 24.275 23.2375 25.8625 26.625 44-45 23.9375 24.6125 25.124999999999996 26.325 46-47 24.7375 24.3 24.7 26.2625 48-49 25.112499999999997 24.125 25.1 25.662499999999998 50-51 25.087500000000002 23.6375 25.724999999999998 25.55 52-53 24.40305038129766 24.86560820102513 24.678084760595073 26.053256657082137 54-55 24.62807850981373 24.04050506313289 24.21552694086761 27.11588948618577 56-57 24.087500000000002 24.3875 24.45 27.075 58-59 24.925 25.025 24.975 25.074999999999996 60-61 24.8125 23.6875 24.099999999999998 27.400000000000002 62-63 25.05 24.4 24.474999999999998 26.075 64-65 25.2875 23.8125 24.25 26.650000000000002 66-67 24.087500000000002 24.275 24.275 27.3625 68-69 24.0375 23.8875 25.874999999999996 26.200000000000003 70-71 25.2375 23.35 24.9125 26.5 72-73 25.2375 23.2875 24.1875 27.287499999999998 74-75 24.1125 23.8625 24.975 27.05 76-77 25.59069883735467 23.44043005375672 25.66570821352669 25.30316289536192 78-79 24.5375 24.4375 24.3625 26.6625 80-81 23.902987873484186 24.440555069383674 24.590573821727716 27.065883235404424 82-83 24.8 23.825 24.5125 26.8625 84-85 24.428053506688336 23.31541442680335 24.990623827978496 27.265908238529818 86-87 25.468867216804203 24.031007751937985 23.968492123030757 26.531632908227053 88-89 25.543885971492873 24.76869217304326 23.95598899724931 25.731432858214554 90-91 25.468867216804203 24.043510877719427 24.118529632408105 26.36909227306827 92-93 25.23130782695674 23.868467116779193 24.668667166791696 26.231557889472366 94-95 24.85621405351338 24.193548387096776 24.493623405851466 26.456614153538382 96-97 25.23130782695674 24.118529632408105 23.755938984746187 26.894223555888974 98-99 26.63165791447862 22.83070767691923 24.593648412103025 25.943985996499126 100-101 25.156289072268066 24.356089022255563 23.568392098024507 26.91922980745186 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 1.5 28 0.5 29 0.5 30 0.5 31 3.0 32 5.0 33 6.5 34 11.0 35 19.5 36 26.0 37 32.5 38 46.0 39 68.0 40 91.0 41 118.5 42 129.5 43 134.5 44 151.5 45 165.5 46 187.5 47 201.0 48 191.0 49 175.0 50 166.5 51 151.5 52 157.5 53 149.0 54 130.5 55 126.5 56 129.0 57 137.0 58 126.5 59 120.5 60 116.0 61 108.0 62 98.0 63 85.0 64 82.0 65 81.0 66 76.5 67 54.5 68 31.5 69 27.0 70 22.5 71 21.0 72 14.0 73 8.5 74 5.0 75 4.0 76 3.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 1.35 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.025 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.025 96-97 0.025 98-99 0.025 100-101 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.92679805477349 95.65 2 1.791656002047607 3.5000000000000004 3 0.25595085743537244 0.75 4 0.02559508574353724 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.3625 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.8375 0.0 0.0 0.0 0.0 82-83 0.9874999999999999 0.0 0.0 0.0 0.0 84-85 1.1625 0.0 0.0 0.0 0.0 86-87 1.425 0.0 0.0 0.0 0.0 88-89 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCGG 15 0.009957196 47.5 84-85 >>END_MODULE Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627801 READS because READLEN < 1 Read 1627801 spots for SRR11216159.sra Written 1627801 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra Rejected 1627782 READS because READLEN < 1 Read 1627782 spots for SRR11216159.sra Written 1627782 spots for SRR11216159.sra SRR ids: ['SRR11216159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m1t6cmvv SRR11216159.sra spots: 32555659 blocks: [[1, 1627782], [1627783, 3255564], [3255565, 4883346], [4883347, 6511128], [6511129, 8138910], [8138911, 9766692], [9766693, 11394474], [11394475, 13022256], [13022257, 14650038], [14650039, 16277820], [16277821, 17905602], [17905603, 19533384], [19533385, 21161166], [21161167, 22788948], [22788949, 24416730], [24416731, 26044512], [26044513, 27672294], [27672295, 29300076], [29300077, 30927858], [30927859, 32555659]] SRR11216159 file size 7862873 SRR11216159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216159 SRR11216159_1.fastq Input file: SRR11216159_1.fastq trimmed: SRR11216159-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:29:07 2024 >> started Tue Dec 10 08:29:23 2024 >> done (16.221s) 32555659 reads processed; of these: 14691 ( 0.05%) short reads filtered out after trimming by size control 40414 ( 0.12%) empty reads filtered out after trimming by size control 32500554 (99.83%) reads available; of these: 3451092 (10.62%) trimmed reads available after processing 29049462 (89.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 605 0.00% 19 672 0.00% 20 738 0.00% 21 706 0.00% 22 868 0.00% 23 946 0.00% 24 1038 0.00% 25 1237 0.00% 26 1178 0.00% 27 1096 0.00% 28 1075 0.00% 29 1073 0.00% 30 1046 0.00% 31 969 0.00% 32 990 0.00% 33 1025 0.00% 34 1049 0.00% 35 1056 0.00% 36 1147 0.00% 37 1104 0.00% 38 1244 0.00% 39 1263 0.00% 40 1322 0.00% 41 1393 0.00% 42 1558 0.00% 43 1500 0.00% 44 1596 0.00% 45 1617 0.00% 46 1853 0.01% 47 1950 0.01% 48 2112 0.01% 49 2220 0.01% 50 2329 0.01% 51 2798 0.01% 52 2719 0.01% 53 2874 0.01% 54 2957 0.01% 55 3190 0.01% 56 3433 0.01% 57 3677 0.01% 58 4166 0.01% 59 4459 0.01% 60 5078 0.02% 61 5566 0.02% 62 6232 0.02% 63 6811 0.02% 64 7496 0.02% 65 8045 0.02% 66 8731 0.03% 67 9777 0.03% 68 10858 0.03% 69 11873 0.04% 70 2978 0.01% 71 3392 0.01% 72 3495 0.01% 73 5041 0.02% 74 3810 0.01% 75 4293 0.01% 76 4604 0.01% 77 4602 0.01% 78 5111 0.02% 79 5817 0.02% 80 6176 0.02% 81 6380 0.02% 82 6975 0.02% 83 8835 0.03% 84 8796 0.03% 85 9808 0.03% 86 12258 0.04% 87 12125 0.04% 88 12843 0.04% 89 15447 0.05% 90 17042 0.05% 91 19453 0.06% 92 22675 0.07% 93 28564 0.09% 94 36289 0.11% 95 46915 0.14% 96 65063 0.20% 97 96436 0.30% 98 158436 0.49% 99 503937 1.55% 100 2161181 6.65% 101 29049462 89.38% 32500554 reads passed initial QC criterion=sequence-density sequence-density=1.83 sequence-density-rank=1 fanout-score=59.02 fanout-score-rank=1 prefix-density=2.50 prefix-fanout=43.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=1.83 sequence-density-rank=1 fanout-score=59.02 fanout-score-rank=1 prefix-density=2.50 prefix-fanout=43.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Started job on | Dec 10 08:29:59 Started mapping on | Dec 10 08:29:59 Finished on | Dec 10 08:30:31 Mapping speed, Million of reads per hour | 3656.31 Number of input reads | 32500554 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 29861600 Uniquely mapped reads % | 91.88% Average mapped length | 99.81 Number of splices: Total | 9307504 Number of splices: Annotated (sjdb) | 8802183 Number of splices: GT/AG | 9173556 Number of splices: GC/AG | 114745 Number of splices: AT/AC | 2660 Number of splices: Non-canonical | 16543 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.89 Insertion rate per base | 0.01% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1778429 % of reads mapped to multiple loci | 5.47% Number of reads mapped to too many loci | 676070 % of reads mapped to too many loci | 2.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 860525 860525 860525 N_multimapping 1778429 1778429 1778429 N_noFeature 923178 29101252 1110011 N_ambiguous 634750 1510 65202 UnstrandedReadsAssigned:28303672 PositiveStrandReadsAssigned:758838 NegativeStrandReadsAssigned:28686387 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216159 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216159-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,500,554 reads, 28,893,781 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,266 rounds 52973 SRR11216159.ke.tsv 35125 SRR11216159.se.tsv 88098 total ==> SRR11216159.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 243.895 15.6045 PNS24247 1044 945 39.0539 2.21312 PNS24249 1928 1829 72.7145 2.12902 PNS24246 1044 945 39.0539 2.21312 PNS24248 1044 945 39.0539 2.21312 PNS24244 1471 1372 131.229 5.12211 PNS24243 293 194 0 0 KQK14069 1603 1504 24249.8 863.443 KQK14071 474 375 2373.94 339.009 ==> SRR11216159.se.tsv <== BRADI_1g14170v3 30183 BRADI_1g53295v3 21 BRADI_1g59795v3 486 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 275 BRADI_1g74790v3 146 BRADI_1g09890v3 0 BRADI_1g77505v3 483 BRADI_1g48960v3 0 SRR11216159 completed mapping pipeline successfully