Starting /dee2/code/volunteer_pipeline.sh SRR11216160 current disk space = 1526823899136 free memory = 1529152820 SRR11216160 SRAfilesize 29233b3c4456e182612680b84db7405f SRR11216160.sra SRR11216160.sra file validated SRR11216160 is single end SRR11216160 is conventional basespace SRR11216160 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40125 33.0 33.0 33.0 33.0 33.0 2 32.40825 33.0 33.0 33.0 33.0 33.0 3 32.48475 33.0 33.0 33.0 33.0 33.0 4 32.50925 33.0 33.0 33.0 33.0 33.0 5 32.50875 33.0 33.0 33.0 33.0 33.0 6 35.664 37.0 37.0 37.0 37.0 37.0 7 36.2665 37.0 37.0 37.0 37.0 37.0 8 36.321 37.0 37.0 37.0 37.0 37.0 9 36.4255 37.0 37.0 37.0 37.0 37.0 10-11 36.392624999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.358125 37.0 37.0 37.0 37.0 37.0 14-15 36.429125 37.0 37.0 37.0 37.0 37.0 16-17 36.449125 37.0 37.0 37.0 37.0 37.0 18-19 36.448875 37.0 37.0 37.0 37.0 37.0 20-21 36.398625 37.0 37.0 37.0 37.0 37.0 22-23 36.395125 37.0 37.0 37.0 37.0 37.0 24-25 36.372125 37.0 37.0 37.0 37.0 37.0 26-27 36.36275 37.0 37.0 37.0 37.0 37.0 28-29 36.345375000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.298500000000004 37.0 37.0 37.0 37.0 37.0 32-33 36.3675 37.0 37.0 37.0 37.0 37.0 34-35 36.313 37.0 37.0 37.0 37.0 37.0 36-37 36.308499999999995 37.0 37.0 37.0 37.0 37.0 38-39 36.27312499999999 37.0 37.0 37.0 37.0 37.0 40-41 36.380375 37.0 37.0 37.0 37.0 37.0 42-43 36.404375 37.0 37.0 37.0 37.0 37.0 44-45 36.2615 37.0 37.0 37.0 37.0 37.0 46-47 36.24575 37.0 37.0 37.0 37.0 37.0 48-49 36.348 37.0 37.0 37.0 37.0 37.0 50-51 36.355625 37.0 37.0 37.0 37.0 37.0 52-53 36.314625 37.0 37.0 37.0 37.0 37.0 54-55 36.319374999999994 37.0 37.0 37.0 37.0 37.0 56-57 36.326125 37.0 37.0 37.0 37.0 37.0 58-59 36.301375 37.0 37.0 37.0 37.0 37.0 60-61 36.321875 37.0 37.0 37.0 37.0 37.0 62-63 36.278875 37.0 37.0 37.0 37.0 37.0 64-65 36.313125 37.0 37.0 37.0 37.0 37.0 66-67 36.2615 37.0 37.0 37.0 37.0 37.0 68-69 36.264375 37.0 37.0 37.0 37.0 37.0 70-71 36.26075 37.0 37.0 37.0 37.0 37.0 72-73 36.26825 37.0 37.0 37.0 37.0 37.0 74-75 36.203625 37.0 37.0 37.0 37.0 37.0 76-77 36.221375 37.0 37.0 37.0 37.0 37.0 78-79 36.212625 37.0 37.0 37.0 37.0 37.0 80-81 36.125125 37.0 37.0 37.0 37.0 37.0 82-83 36.135000000000005 37.0 37.0 37.0 37.0 37.0 84-85 36.10675 37.0 37.0 37.0 37.0 37.0 86-87 36.097375 37.0 37.0 37.0 37.0 37.0 88-89 36.089375000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.954499999999996 37.0 37.0 37.0 37.0 37.0 92-93 35.959999999999994 37.0 37.0 37.0 37.0 37.0 94-95 35.91775 37.0 37.0 37.0 37.0 37.0 96-97 35.816374999999994 37.0 37.0 37.0 37.0 37.0 98-99 35.726 37.0 37.0 37.0 37.0 37.0 100-101 33.88525 37.0 35.0 37.0 27.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 4.0 20 0.0 21 1.0 22 1.0 23 4.0 24 9.0 25 6.0 26 10.0 27 16.0 28 18.0 29 20.0 30 23.0 31 39.0 32 48.0 33 85.0 34 112.0 35 221.0 36 3367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.31869510664993 8.255959849435383 7.076537013801756 46.34880803011293 2 24.55 12.075 34.599999999999994 28.775000000000002 3 23.674999999999997 14.224999999999998 21.349999999999998 40.75 4 29.175 21.9 20.125 28.799999999999997 5 28.7 26.25 23.0 22.05 6 24.14844941535333 30.071174377224196 23.868835790543976 21.911540416878495 7 18.825 21.475 39.15 20.549999999999997 8 20.225 21.125 31.075000000000003 27.575 9 21.15 19.1 34.65 25.1 10-11 24.7375 28.262500000000003 22.900000000000002 24.099999999999998 12-13 24.425 22.650000000000002 26.174999999999997 26.75 14-15 23.974999999999998 23.1875 26.525 26.3125 16-17 24.9375 23.9125 24.8625 26.2875 18-19 23.8125 24.2625 24.925 27.0 20-21 24.2625 23.3375 25.412499999999998 26.987499999999997 22-23 24.762500000000003 24.65 24.5 26.087500000000002 24-25 24.74059257407176 23.990498812351543 24.065508188523566 27.203400425053132 26-27 23.3 23.225 26.387500000000003 27.0875 28-29 25.137500000000003 23.549999999999997 24.712500000000002 26.6 30-31 24.0375 23.7 24.762500000000003 27.500000000000004 32-33 24.45 22.8375 25.174999999999997 27.537499999999998 34-35 24.587500000000002 22.6875 25.8 26.924999999999997 36-37 23.400000000000002 22.975 25.8 27.825 38-39 23.775 23.150000000000002 24.4375 28.6375 40-41 24.85 23.9875 24.5 26.6625 42-43 24.425 23.7375 25.15 26.687499999999996 44-45 25.95 22.675 25.137500000000003 26.237500000000004 46-47 24.7875 24.0 25.3 25.912499999999998 48-49 24.2375 23.0875 24.762500000000003 27.9125 50-51 24.075 23.275000000000002 24.9 27.750000000000004 52-53 25.090636329541194 23.69046130766346 24.278034754344294 26.940867608451057 54-55 24.390548818602326 22.927865983247905 25.95324415551944 26.728341042630326 56-57 24.337500000000002 23.8625 24.925 26.875 58-59 24.6 23.075000000000003 25.8125 26.5125 60-61 24.925 23.1125 24.925 27.037499999999998 62-63 24.224999999999998 23.1125 25.0125 27.650000000000002 64-65 25.275 23.400000000000002 25.2 26.125 66-67 24.337500000000002 24.25 24.3125 27.1 68-69 24.587500000000002 23.175 25.2 27.037499999999998 70-71 24.7875 23.2875 25.525 26.400000000000002 72-73 25.05 23.6625 24.4 26.887499999999996 74-75 24.224999999999998 23.962500000000002 25.0625 26.75 76-77 24.715589448681087 23.80297537192149 24.765595699462434 26.715839479934996 78-79 23.7125 23.4875 25.137500000000003 27.6625 80-81 25.153144143017876 23.102887860982623 24.52806600825103 27.21590198774847 82-83 25.3 23.200000000000003 24.15 27.35 84-85 25.440680085010626 23.06538317289661 25.17814726840855 26.31578947368421 86-87 24.60615153788447 23.3183295823956 24.843710927731934 27.231807951987996 88-89 24.58114528632158 24.056014003500874 23.88097024256064 27.481870467616904 90-91 25.51887971992998 24.418604651162788 23.15578894723681 26.906726681670417 92-93 25.29382345586397 23.718429607401852 24.143535883970994 26.84421105276319 94-95 25.18129532383096 23.605901475368842 23.95598899724931 27.25681420355089 96-97 24.60615153788447 24.33108277069267 23.730932733183295 27.33183295823956 98-99 25.168792198049513 24.081020255063766 24.006001500375092 26.744186046511626 100-101 25.85646411602901 24.48112028007002 23.680920230057513 25.98149537384346 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 1.0 31 4.5 32 8.0 33 10.0 34 15.5 35 22.0 36 27.0 37 36.0 38 46.5 39 64.5 40 87.0 41 112.0 42 132.0 43 136.0 44 133.5 45 147.0 46 160.5 47 158.5 48 151.0 49 156.5 50 155.0 51 149.5 52 150.5 53 148.0 54 145.5 55 160.0 56 186.0 57 168.0 58 133.5 59 118.0 60 115.5 61 119.5 62 114.5 63 92.5 64 79.5 65 66.5 66 54.5 67 55.0 68 49.5 69 39.0 70 28.0 71 20.0 72 16.5 73 12.0 74 6.0 75 3.5 76 3.0 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 1.6500000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0125 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0125 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.025 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.025 96-97 0.025 98-99 0.025 100-101 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.825 #Duplication Level Percentage of deduplicated Percentage of total 1 96.32141925384816 92.30000000000001 2 3.1307070180015653 6.0 3 0.4174276024002087 1.2 4 0.1304461257500652 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.7875 0.0 0.0 0.0 0.0 80-81 0.95 0.0 0.0 0.0 0.0 82-83 1.1875 0.0 0.0 0.0 0.0 84-85 1.4875 0.0 0.0 0.0 0.0 86-87 1.9 0.0 0.0 0.0 0.0 88-89 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGTC 25 0.004678785 56.954998 7 >>END_MODULE Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738196 READS because READLEN < 1 Read 1738196 spots for SRR11216160.sra Written 1738196 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra Rejected 1738182 READS because READLEN < 1 Read 1738182 spots for SRR11216160.sra Written 1738182 spots for SRR11216160.sra SRR ids: ['SRR11216160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8djavyei SRR11216160.sra spots: 34763654 blocks: [[1, 1738182], [1738183, 3476364], [3476365, 5214546], [5214547, 6952728], [6952729, 8690910], [8690911, 10429092], [10429093, 12167274], [12167275, 13905456], [13905457, 15643638], [15643639, 17381820], [17381821, 19120002], [19120003, 20858184], [20858185, 22596366], [22596367, 24334548], [24334549, 26072730], [26072731, 27810912], [27810913, 29549094], [29549095, 31287276], [31287277, 33025458], [33025459, 34763654]] SRR11216160 file size 8397622 SRR11216160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216160 SRR11216160_1.fastq Input file: SRR11216160_1.fastq trimmed: SRR11216160-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:29:33 2024 >> started Tue Dec 10 08:29:51 2024 >> done (18.490s) 34763654 reads processed; of these: 16543 ( 0.05%) short reads filtered out after trimming by size control 51221 ( 0.15%) empty reads filtered out after trimming by size control 34695890 (99.81%) reads available; of these: 3648891 (10.52%) trimmed reads available after processing 31046999 (89.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 614 0.00% 19 679 0.00% 20 682 0.00% 21 760 0.00% 22 863 0.00% 23 928 0.00% 24 1185 0.00% 25 1281 0.00% 26 1132 0.00% 27 1112 0.00% 28 1054 0.00% 29 1033 0.00% 30 1022 0.00% 31 1014 0.00% 32 1029 0.00% 33 1154 0.00% 34 1098 0.00% 35 1069 0.00% 36 1195 0.00% 37 1253 0.00% 38 1295 0.00% 39 1282 0.00% 40 1403 0.00% 41 1544 0.00% 42 1493 0.00% 43 1624 0.00% 44 1714 0.00% 45 1773 0.01% 46 1923 0.01% 47 1968 0.01% 48 2191 0.01% 49 2425 0.01% 50 2622 0.01% 51 2994 0.01% 52 3214 0.01% 53 3153 0.01% 54 3438 0.01% 55 3658 0.01% 56 3812 0.01% 57 4277 0.01% 58 4662 0.01% 59 5183 0.01% 60 5817 0.02% 61 6358 0.02% 62 7212 0.02% 63 7703 0.02% 64 8514 0.02% 65 9555 0.03% 66 10464 0.03% 67 11732 0.03% 68 12958 0.04% 69 13776 0.04% 70 3017 0.01% 71 3719 0.01% 72 3747 0.01% 73 5352 0.02% 74 4015 0.01% 75 4547 0.01% 76 4768 0.01% 77 4907 0.01% 78 5217 0.02% 79 6364 0.02% 80 6463 0.02% 81 6801 0.02% 82 7564 0.02% 83 9512 0.03% 84 9499 0.03% 85 10567 0.03% 86 13204 0.04% 87 13010 0.04% 88 13490 0.04% 89 16434 0.05% 90 17811 0.05% 91 20582 0.06% 92 24467 0.07% 93 29666 0.09% 94 38431 0.11% 95 49097 0.14% 96 67170 0.19% 97 101476 0.29% 98 166001 0.48% 99 531478 1.53% 100 2278621 6.57% 101 31046999 89.48% 34695890 reads passed initial QC criterion=sequence-density sequence-density=2.08 sequence-density-rank=1 fanout-score=60.80 fanout-score-rank=1 prefix-density=2.86 prefix-fanout=44.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=2.08 sequence-density-rank=1 fanout-score=60.80 fanout-score-rank=1 prefix-density=2.86 prefix-fanout=44.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR11216160 - Input file: STDIN trimmed: SRR11216160-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 08:30:56 2024 >> started Tue Dec 10 08:31:13 2024 >> done (16.948s) 11565297 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 10 ( 0.00%) empty reads filtered out after trimming by size control 11565277 (100.00%) reads available; of these: 862243 ( 7.46%) trimmed reads available after processing 10703034 (92.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 198 0.00% 19 208 0.00% 20 235 0.00% 21 276 0.00% 22 287 0.00% 23 315 0.00% 24 388 0.00% 25 430 0.00% 26 387 0.00% 27 347 0.00% 28 358 0.00% 29 351 0.00% 30 310 0.00% 31 331 0.00% 32 350 0.00% 33 385 0.00% 34 362 0.00% 35 340 0.00% 36 379 0.00% 37 403 0.00% 38 417 0.00% 39 429 0.00% 40 481 0.00% 41 476 0.00% 42 470 0.00% 43 583 0.01% 44 593 0.01% 45 592 0.01% 46 663 0.01% 47 661 0.01% 48 724 0.01% 49 816 0.01% 50 854 0.01% 51 1020 0.01% 52 1088 0.01% 53 1022 0.01% 54 1213 0.01% 55 1284 0.01% 56 1336 0.01% 57 1471 0.01% 58 1566 0.01% 59 1793 0.02% 60 2011 0.02% 61 2165 0.02% 62 2378 0.02% 63 2580 0.02% 64 2873 0.02% 65 3251 0.03% 66 3385 0.03% 67 3859 0.03% 68 4258 0.04% 69 4718 0.04% 70 5394 0.05% 71 6104 0.05% 72 6971 0.06% 73 8188 0.07% 74 8349 0.07% 75 9367 0.08% 76 10246 0.09% 77 11170 0.10% 78 12024 0.10% 79 14109 0.12% 80 15083 0.13% 81 16576 0.14% 82 18482 0.16% 83 20437 0.18% 84 22459 0.19% 85 24866 0.22% 86 27184 0.24% 87 28138 0.24% 88 31502 0.27% 89 33414 0.29% 90 36089 0.31% 91 40200 0.35% 92 43447 0.38% 93 47713 0.41% 94 53972 0.47% 95 62491 0.54% 96 81141 0.70% 97 121513 1.05% 98 257961 2.23% 99 166185 1.44% 100 718154 6.21% 101 9548678 82.56% criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=18 prefix-density=0.63 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=39.30 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.3 sequence=AGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGACGTTCTGAACCCAGCTCACGTACCGCATTAATGGGCGAACAGCCCAACCCTTGGAACCACCTACAGCTCCAGGTGGCGAAGAGCCGACATCGAGGTGCCAAACCTTCCCGTCGATGTGGACTCTTGGGGAAGATCAGCCTGTTATCCCTAGAGTAACTTTTATCCGTTGAGCGACGGCCCTTCCACTCGGCACCGTCGGATCACTAAGGCCGACTTTCGTCTCTGCTCGACGGGTGAGTCTTGCAGTCAAGCTCCCTTCTGCCTTTGCACTCGAGGACCAATGTCCGTCTGGCCCGAGGAAACCTTTGC Started job on | Dec 10 08:31:44 Started mapping on | Dec 10 08:31:44 Finished on | Dec 10 08:32:20 Mapping speed, Million of reads per hour | 3469.59 Number of input reads | 34695870 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 28218242 Uniquely mapped reads % | 81.33% Average mapped length | 99.72 Number of splices: Total | 8800628 Number of splices: Annotated (sjdb) | 8320345 Number of splices: GT/AG | 8670267 Number of splices: GC/AG | 112615 Number of splices: AT/AC | 2707 Number of splices: Non-canonical | 15039 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.91 Insertion rate per base | 0.00% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4274276 % of reads mapped to multiple loci | 12.32% Number of reads mapped to too many loci | 1956868 % of reads mapped to too many loci | 5.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2203352 2203352 2203352 N_multimapping 4274276 4274276 4274276 N_noFeature 1336381 27530956 1507160 N_ambiguous 576625 1641 62177 UnstrandedReadsAssigned:26305236 PositiveStrandReadsAssigned:685645 NegativeStrandReadsAssigned:26648905 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216160 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216160-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,695,870 reads, 27,126,130 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR11216160.ke.tsv 35125 SRR11216160.se.tsv 88098 total ==> SRR11216160.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 86.0293 5.78976 PNS24247 1044 945 45.7228 2.72547 PNS24249 1928 1829 35.631 1.09737 PNS24246 1044 945 45.7228 2.72547 PNS24248 1044 945 45.7228 2.72547 PNS24244 1471 1372 146.171 6.00134 PNS24243 293 194 0 0 KQK14069 1603 1504 9571.37 358.481 KQK14071 474 375 1304.84 196.004 ==> SRR11216160.se.tsv <== BRADI_1g14170v3 12604 BRADI_1g53295v3 19 BRADI_1g59795v3 606 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 354 BRADI_1g74790v3 182 BRADI_1g09890v3 0 BRADI_1g77505v3 340 BRADI_1g48960v3 1 SRR11216160 completed mapping pipeline successfully