Starting /dee2/code/volunteer_pipeline.sh SRR11216161 current disk space = 1526773489664 free memory = 1421574340 SRR11216161 SRAfilesize ef0d5d978fb6c781477056ee94b3229a SRR11216161.sra SRR11216161.sra file validated SRR11216161 is single end SRR11216161 is conventional basespace SRR11216161 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216161_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40175 33.0 33.0 33.0 33.0 33.0 2 32.539 33.0 33.0 33.0 33.0 33.0 3 32.55475 33.0 33.0 33.0 33.0 33.0 4 32.5545 33.0 33.0 33.0 33.0 33.0 5 32.5615 33.0 33.0 33.0 33.0 33.0 6 35.8625 37.0 37.0 37.0 37.0 37.0 7 36.28475 37.0 37.0 37.0 37.0 37.0 8 36.37775 37.0 37.0 37.0 37.0 37.0 9 36.4695 37.0 37.0 37.0 37.0 37.0 10-11 36.404624999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.452625 37.0 37.0 37.0 37.0 37.0 14-15 36.493375 37.0 37.0 37.0 37.0 37.0 16-17 36.514375 37.0 37.0 37.0 37.0 37.0 18-19 36.487750000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.4855 37.0 37.0 37.0 37.0 37.0 22-23 36.433625000000006 37.0 37.0 37.0 37.0 37.0 24-25 36.406125 37.0 37.0 37.0 37.0 37.0 26-27 36.424375 37.0 37.0 37.0 37.0 37.0 28-29 36.421499999999995 37.0 37.0 37.0 37.0 37.0 30-31 36.36125 37.0 37.0 37.0 37.0 37.0 32-33 36.351 37.0 37.0 37.0 37.0 37.0 34-35 36.3955 37.0 37.0 37.0 37.0 37.0 36-37 36.411625 37.0 37.0 37.0 37.0 37.0 38-39 36.356125000000006 37.0 37.0 37.0 37.0 37.0 40-41 36.396375 37.0 37.0 37.0 37.0 37.0 42-43 36.456875 37.0 37.0 37.0 37.0 37.0 44-45 36.31875 37.0 37.0 37.0 37.0 37.0 46-47 36.3485 37.0 37.0 37.0 37.0 37.0 48-49 36.403125 37.0 37.0 37.0 37.0 37.0 50-51 36.366125 37.0 37.0 37.0 37.0 37.0 52-53 36.362125 37.0 37.0 37.0 37.0 37.0 54-55 36.321124999999995 37.0 37.0 37.0 37.0 37.0 56-57 36.3285 37.0 37.0 37.0 37.0 37.0 58-59 36.287125 37.0 37.0 37.0 37.0 37.0 60-61 36.329375 37.0 37.0 37.0 37.0 37.0 62-63 36.3195 37.0 37.0 37.0 37.0 37.0 64-65 36.34825 37.0 37.0 37.0 37.0 37.0 66-67 36.30275 37.0 37.0 37.0 37.0 37.0 68-69 36.309375 37.0 37.0 37.0 37.0 37.0 70-71 36.285 37.0 37.0 37.0 37.0 37.0 72-73 36.285375 37.0 37.0 37.0 37.0 37.0 74-75 36.269625000000005 37.0 37.0 37.0 37.0 37.0 76-77 36.25625 37.0 37.0 37.0 37.0 37.0 78-79 36.25125 37.0 37.0 37.0 37.0 37.0 80-81 36.108125 37.0 37.0 37.0 37.0 37.0 82-83 36.148375 37.0 37.0 37.0 37.0 37.0 84-85 36.147875 37.0 37.0 37.0 37.0 37.0 86-87 36.106624999999994 37.0 37.0 37.0 37.0 37.0 88-89 35.997875 37.0 37.0 37.0 37.0 37.0 90-91 35.988749999999996 37.0 37.0 37.0 37.0 37.0 92-93 35.9375 37.0 37.0 37.0 37.0 37.0 94-95 35.900999999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.873625 37.0 37.0 37.0 37.0 37.0 98-99 35.779624999999996 37.0 37.0 37.0 37.0 37.0 100-101 34.132625000000004 37.0 35.0 37.0 29.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 0.0 18 1.0 19 0.0 20 3.0 21 1.0 22 2.0 23 1.0 24 6.0 25 5.0 26 5.0 27 13.0 28 12.0 29 24.0 30 25.0 31 42.0 32 59.0 33 70.0 34 100.0 35 255.0 36 3359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.034188034188034 10.583207642031171 5.88235294117647 45.500251382604326 2 21.3 12.5 39.300000000000004 26.900000000000002 3 20.849999999999998 16.5 23.625 39.025 4 27.725 25.5 20.150000000000002 26.625 5 25.25 29.725 24.349999999999998 20.674999999999997 6 21.54235145385588 31.327433628318584 23.81795195954488 23.31226295828066 7 19.0 22.775000000000002 37.775 20.45 8 19.25 23.275000000000002 30.625000000000004 26.85 9 20.525 19.950000000000003 33.85 25.674999999999997 10-11 23.2375 28.6875 23.175 24.9 12-13 23.549999999999997 22.4375 25.937500000000004 28.075 14-15 23.3875 23.825 26.6125 26.174999999999997 16-17 23.799999999999997 24.95 25.4625 25.7875 18-19 23.200000000000003 24.0125 25.387500000000003 27.400000000000002 20-21 23.4375 24.5125 26.1625 25.887500000000003 22-23 23.8625 25.337500000000002 24.6125 26.187500000000004 24-25 23.125 25.1 25.25 26.525 26-27 23.3875 24.1125 26.05 26.450000000000003 28-29 22.825 24.85 25.775 26.55 30-31 23.05 24.2625 25.324999999999996 27.3625 32-33 23.8125 23.3375 26.4625 26.387500000000003 34-35 23.849999999999998 24.349999999999998 25.887500000000003 25.912499999999998 36-37 23.4125 23.925 25.575 27.0875 38-39 23.7125 23.8625 26.0125 26.4125 40-41 24.1125 24.474999999999998 25.0 26.4125 42-43 24.099999999999998 24.0375 24.8625 27.0 44-45 24.2625 23.825 25.324999999999996 26.5875 46-47 23.6625 25.650000000000002 26.0 24.6875 48-49 23.9125 23.8875 25.4625 26.737499999999997 50-51 23.799999999999997 25.387500000000003 24.3625 26.450000000000003 52-53 24.1375 24.2375 25.275 26.35 54-55 23.8875 24.325 25.5125 26.275 56-57 22.1 24.675 25.662499999999998 27.5625 58-59 23.325000000000003 23.974999999999998 26.6625 26.0375 60-61 24.05 24.25 25.674999999999997 26.025 62-63 23.8625 23.75 25.637500000000003 26.75 64-65 24.5375 23.724999999999998 24.9125 26.825 66-67 23.4625 23.525 25.924999999999997 27.0875 68-69 23.7125 23.8375 26.0625 26.387500000000003 70-71 24.0375 23.7625 26.0625 26.137500000000003 72-73 24.2875 23.45 24.4125 27.85 74-75 24.0 24.375 24.4875 27.1375 76-77 24.0625 25.2875 24.575 26.075 78-79 23.799999999999997 24.625 24.675 26.900000000000002 80-81 23.5375 24.6 25.424999999999997 26.437500000000004 82-83 24.837500000000002 24.4375 25.074999999999996 25.650000000000002 84-85 23.275000000000002 24.825 24.575 27.325 86-87 24.6875 23.5125 25.3 26.5 88-89 23.89048631078885 23.8404800600075 25.390673834229275 26.878359794974372 90-91 24.265533191648956 24.1780222527816 25.015626953369168 26.540817602200274 92-93 23.4625 24.925 25.724999999999998 25.887500000000003 94-95 24.55 24.85 24.075 26.525 96-97 23.549999999999997 25.3125 24.0125 27.125 98-99 23.918479619904975 24.293573393348336 25.268817204301076 26.51912978244561 100-101 23.5125 24.65 25.412499999999998 26.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.5 29 2.5 30 3.5 31 2.5 32 5.0 33 11.5 34 15.0 35 21.0 36 34.0 37 48.5 38 71.0 39 85.5 40 92.0 41 117.0 42 140.5 43 147.5 44 164.5 45 188.5 46 190.5 47 188.5 48 180.5 49 165.5 50 159.0 51 153.5 52 148.0 53 140.5 54 135.5 55 153.0 56 154.0 57 135.5 58 135.5 59 125.5 60 110.0 61 98.5 62 84.5 63 77.5 64 74.0 65 62.5 66 43.5 67 32.5 68 31.5 69 25.5 70 17.0 71 9.0 72 5.0 73 5.0 74 4.0 75 2.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 1.125 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.0717802539518 93.65 2 2.3840373153666756 4.6 3 0.4405286343612335 1.275 4 0.051826898160145116 0.2 5 0.025913449080072558 0.125 6 0.025913449080072558 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 6 0.15 No Hit GTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.30000000000000004 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.675 0.0 0.0 0.0 0.0 78-79 0.8125 0.0 0.0 0.0 0.0 80-81 1.075 0.0 0.0 0.0 0.0 82-83 1.35 0.0 0.0 0.0 0.0 84-85 1.6 0.0 0.0 0.0 0.0 86-87 2.0125 0.0 0.0 0.0 0.0 88-89 2.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382542 READS because READLEN < 1 Read 1382542 spots for SRR11216161.sra Written 1382542 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra Rejected 1382523 READS because READLEN < 1 Read 1382523 spots for SRR11216161.sra Written 1382523 spots for SRR11216161.sra SRR ids: ['SRR11216161.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1m5gt_z_ SRR11216161.sra spots: 27650479 blocks: [[1, 1382523], [1382524, 2765046], [2765047, 4147569], [4147570, 5530092], [5530093, 6912615], [6912616, 8295138], [8295139, 9677661], [9677662, 11060184], [11060185, 12442707], [12442708, 13825230], [13825231, 15207753], [15207754, 16590276], [16590277, 17972799], [17972800, 19355322], [19355323, 20737845], [20737846, 22120368], [22120369, 23502891], [23502892, 24885414], [24885415, 26267937], [26267938, 27650479]] SRR11216161 file size 6674900 SRR11216161 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216161 SRR11216161_1.fastq Input file: SRR11216161_1.fastq trimmed: SRR11216161-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:29:03 2024 >> started Tue Dec 10 08:29:18 2024 >> done (15.252s) 27650479 reads processed; of these: 11037 ( 0.04%) short reads filtered out after trimming by size control 29391 ( 0.11%) empty reads filtered out after trimming by size control 27610051 (99.85%) reads available; of these: 2830322 (10.25%) trimmed reads available after processing 24779729 (89.75%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 501 0.00% 19 447 0.00% 20 465 0.00% 21 509 0.00% 22 618 0.00% 23 675 0.00% 24 841 0.00% 25 989 0.00% 26 867 0.00% 27 866 0.00% 28 753 0.00% 29 757 0.00% 30 777 0.00% 31 816 0.00% 32 845 0.00% 33 831 0.00% 34 815 0.00% 35 810 0.00% 36 846 0.00% 37 884 0.00% 38 921 0.00% 39 970 0.00% 40 1071 0.00% 41 1136 0.00% 42 1189 0.00% 43 1209 0.00% 44 1248 0.00% 45 1402 0.01% 46 1488 0.01% 47 1559 0.01% 48 1705 0.01% 49 1974 0.01% 50 1997 0.01% 51 2355 0.01% 52 2317 0.01% 53 2471 0.01% 54 2720 0.01% 55 2809 0.01% 56 3011 0.01% 57 3283 0.01% 58 3700 0.01% 59 3914 0.01% 60 4677 0.02% 61 5152 0.02% 62 5653 0.02% 63 6271 0.02% 64 6995 0.03% 65 7417 0.03% 66 8286 0.03% 67 9477 0.03% 68 10292 0.04% 69 11191 0.04% 70 2218 0.01% 71 2663 0.01% 72 2688 0.01% 73 4032 0.01% 74 3041 0.01% 75 3498 0.01% 76 3699 0.01% 77 3656 0.01% 78 4037 0.01% 79 4808 0.02% 80 4916 0.02% 81 5153 0.02% 82 5513 0.02% 83 7303 0.03% 84 7294 0.03% 85 7815 0.03% 86 9844 0.04% 87 9788 0.04% 88 10119 0.04% 89 12253 0.04% 90 13563 0.05% 91 15488 0.06% 92 18434 0.07% 93 22750 0.08% 94 28807 0.10% 95 36989 0.13% 96 51340 0.19% 97 77089 0.28% 98 127247 0.46% 99 410902 1.49% 100 1778603 6.44% 101 24779729 89.75% 27610051 reads passed initial QC criterion=sequence-density sequence-density=2.14 sequence-density-rank=1 fanout-score=59.74 fanout-score-rank=1 prefix-density=2.93 prefix-fanout=43.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=2.14 sequence-density-rank=1 fanout-score=59.74 fanout-score-rank=1 prefix-density=2.93 prefix-fanout=43.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR11216161 - Input file: STDIN trimmed: SRR11216161-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 08:30:50 2024 >> started Tue Dec 10 08:31:03 2024 >> done (13.032s) 9203350 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 9203348 (100.00%) reads available; of these: 707359 ( 7.69%) trimmed reads available after processing 8495989 (92.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 178 0.00% 19 140 0.00% 20 153 0.00% 21 187 0.00% 22 211 0.00% 23 205 0.00% 24 323 0.00% 25 336 0.00% 26 255 0.00% 27 289 0.00% 28 230 0.00% 29 242 0.00% 30 276 0.00% 31 265 0.00% 32 272 0.00% 33 261 0.00% 34 276 0.00% 35 273 0.00% 36 301 0.00% 37 296 0.00% 38 305 0.00% 39 360 0.00% 40 363 0.00% 41 388 0.00% 42 405 0.00% 43 423 0.00% 44 432 0.00% 45 466 0.01% 46 491 0.01% 47 519 0.01% 48 564 0.01% 49 646 0.01% 50 667 0.01% 51 782 0.01% 52 810 0.01% 53 855 0.01% 54 899 0.01% 55 938 0.01% 56 982 0.01% 57 1079 0.01% 58 1248 0.01% 59 1305 0.01% 60 1535 0.02% 61 1711 0.02% 62 1859 0.02% 63 2043 0.02% 64 2390 0.03% 65 2482 0.03% 66 2776 0.03% 67 3073 0.03% 68 3446 0.04% 69 3862 0.04% 70 4397 0.05% 71 4825 0.05% 72 5578 0.06% 73 6532 0.07% 74 6779 0.07% 75 7487 0.08% 76 8237 0.09% 77 8903 0.10% 78 9838 0.11% 79 11557 0.13% 80 12291 0.13% 81 13550 0.15% 82 14798 0.16% 83 16726 0.18% 84 18206 0.20% 85 19692 0.21% 86 21978 0.24% 87 23254 0.25% 88 25373 0.28% 89 26930 0.29% 90 28915 0.31% 91 32209 0.35% 92 35474 0.39% 93 38578 0.42% 94 42974 0.47% 95 50189 0.55% 96 65554 0.71% 97 97546 1.06% 98 209395 2.28% 99 127878 1.39% 100 557733 6.06% 101 7604899 82.63% criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=0.54 prefix-fanout=1.9 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=49.17 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.5 sequence=AGGAGAGAGCACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTACCCAGCGTTTACCGTAGGCACGATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAACGCCCACACCGGATATGGACCGAACTGTCTCACGACGTTCTGAACCCAGCTCACGTACCGCATTAATGGGCGAACAGCCCAACCCTTGGAACCACCTACAGCTCCAGGTGGCGAAGAGCCGACATCGAGGTGCCAAACCTTCCCGTCGATGTGGACTCTTGGGGAAGATCAGCCTGTTATCCCTAGAGTAACTTTTATCCGTTGAGCGACGGCCCTTCCACTCGGCACCGTCGGATCACTAAGGCCGACTTTCGTCTCTGCTCGACGGGTGAGTCTTGCAGTCAAGCTCCCTTCTGCCTTTGCACTCGAGGACCAATGTCCGTCTGGCCCGAGGAAACCTTTGC Started job on | Dec 10 08:31:36 Started mapping on | Dec 10 08:31:36 Finished on | Dec 10 08:32:07 Mapping speed, Million of reads per hour | 3206.33 Number of input reads | 27610049 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 23288920 Uniquely mapped reads % | 84.35% Average mapped length | 99.77 Number of splices: Total | 7451927 Number of splices: Annotated (sjdb) | 7064234 Number of splices: GT/AG | 7339660 Number of splices: GC/AG | 97276 Number of splices: AT/AC | 2342 Number of splices: Non-canonical | 12649 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.94 Insertion rate per base | 0.01% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2905337 % of reads mapped to multiple loci | 10.52% Number of reads mapped to too many loci | 1222523 % of reads mapped to too many loci | 4.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1415792 1415792 1415792 N_multimapping 2905337 2905337 2905337 N_noFeature 1026025 22693576 1161163 N_ambiguous 509465 1232 50472 UnstrandedReadsAssigned:21753430 PositiveStrandReadsAssigned:594112 NegativeStrandReadsAssigned:22077285 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216161 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216161-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,610,049 reads, 22,412,317 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,267 rounds 52973 SRR11216161.ke.tsv 35125 SRR11216161.se.tsv 88098 total ==> SRR11216161.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 129.162 10.7336 PNS24247 1044 945 26.8887 1.97914 PNS24249 1928 1829 36.2421 1.37828 PNS24246 1044 945 26.8887 1.97914 PNS24248 1044 945 26.8887 1.97914 PNS24244 1471 1372 143.93 7.29685 PNS24243 293 194 0 0 KQK14069 1603 1504 7577.54 350.444 KQK14071 474 375 639.759 118.665 ==> SRR11216161.se.tsv <== BRADI_1g14170v3 9344 BRADI_1g53295v3 17 BRADI_1g59795v3 591 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 226 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 366 BRADI_1g48960v3 0 SRR11216161 completed mapping pipeline successfully