Starting /dee2/code/volunteer_pipeline.sh SRR11216162 current disk space = 1526762520576 free memory = 1532449592 SRR11216162 SRAfilesize 5c91999feca3ef2190d208060a429b35 SRR11216162.sra SRR11216162.sra file validated SRR11216162 is single end SRR11216162 is conventional basespace SRR11216162 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11216162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3405 33.0 33.0 33.0 33.0 33.0 2 32.453 33.0 33.0 33.0 33.0 33.0 3 32.499 33.0 33.0 33.0 33.0 33.0 4 32.478 33.0 33.0 33.0 33.0 33.0 5 32.52925 33.0 33.0 33.0 33.0 33.0 6 35.61825 37.0 37.0 37.0 37.0 37.0 7 36.21875 37.0 37.0 37.0 37.0 37.0 8 36.2665 37.0 37.0 37.0 37.0 37.0 9 36.38375 37.0 37.0 37.0 37.0 37.0 10-11 36.417625 37.0 37.0 37.0 37.0 37.0 12-13 36.484125 37.0 37.0 37.0 37.0 37.0 14-15 36.438125 37.0 37.0 37.0 37.0 37.0 16-17 36.416375 37.0 37.0 37.0 37.0 37.0 18-19 36.434124999999995 37.0 37.0 37.0 37.0 37.0 20-21 36.461875000000006 37.0 37.0 37.0 37.0 37.0 22-23 36.394000000000005 37.0 37.0 37.0 37.0 37.0 24-25 36.427375 37.0 37.0 37.0 37.0 37.0 26-27 36.39725 37.0 37.0 37.0 37.0 37.0 28-29 36.400875 37.0 37.0 37.0 37.0 37.0 30-31 36.314125 37.0 37.0 37.0 37.0 37.0 32-33 36.3215 37.0 37.0 37.0 37.0 37.0 34-35 36.327875 37.0 37.0 37.0 37.0 37.0 36-37 36.334500000000006 37.0 37.0 37.0 37.0 37.0 38-39 36.3575 37.0 37.0 37.0 37.0 37.0 40-41 36.32275 37.0 37.0 37.0 37.0 37.0 42-43 36.35425 37.0 37.0 37.0 37.0 37.0 44-45 36.24675 37.0 37.0 37.0 37.0 37.0 46-47 36.335625 37.0 37.0 37.0 37.0 37.0 48-49 36.361000000000004 37.0 37.0 37.0 37.0 37.0 50-51 36.389125 37.0 37.0 37.0 37.0 37.0 52-53 36.389125 37.0 37.0 37.0 37.0 37.0 54-55 36.313625 37.0 37.0 37.0 37.0 37.0 56-57 36.336625 37.0 37.0 37.0 37.0 37.0 58-59 36.279125 37.0 37.0 37.0 37.0 37.0 60-61 36.30925 37.0 37.0 37.0 37.0 37.0 62-63 36.26649999999999 37.0 37.0 37.0 37.0 37.0 64-65 36.2785 37.0 37.0 37.0 37.0 37.0 66-67 36.259125 37.0 37.0 37.0 37.0 37.0 68-69 36.262625 37.0 37.0 37.0 37.0 37.0 70-71 36.256625 37.0 37.0 37.0 37.0 37.0 72-73 36.182249999999996 37.0 37.0 37.0 37.0 37.0 74-75 36.198875 37.0 37.0 37.0 37.0 37.0 76-77 36.1745 37.0 37.0 37.0 37.0 37.0 78-79 36.152 37.0 37.0 37.0 37.0 37.0 80-81 36.034375 37.0 37.0 37.0 37.0 37.0 82-83 36.131125 37.0 37.0 37.0 37.0 37.0 84-85 36.119625 37.0 37.0 37.0 37.0 37.0 86-87 36.038125 37.0 37.0 37.0 37.0 37.0 88-89 35.986125 37.0 37.0 37.0 37.0 37.0 90-91 35.917625 37.0 37.0 37.0 37.0 37.0 92-93 35.871125000000006 37.0 37.0 37.0 37.0 37.0 94-95 35.839375000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.826499999999996 37.0 37.0 37.0 37.0 37.0 98-99 35.725750000000005 37.0 37.0 37.0 37.0 37.0 100-101 33.971375 37.0 35.0 37.0 27.5 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 2.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 5.0 23 6.0 24 8.0 25 7.0 26 7.0 27 8.0 28 23.0 29 14.0 30 43.0 31 40.0 32 50.0 33 86.0 34 115.0 35 230.0 36 3339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.909821652851036 8.389851796031147 6.932931424265259 45.76739512685255 2 24.175 11.95 35.825 28.050000000000004 3 23.400000000000002 16.225 22.175 38.2 4 28.075 24.525 19.625 27.775 5 28.125 28.675 23.025000000000002 20.175 6 23.695596843980656 31.6110969712395 23.237465003817764 21.455841180962075 7 19.2 22.650000000000002 39.875 18.275 8 21.099999999999998 21.75 31.374999999999996 25.775 9 19.725 20.875 34.300000000000004 25.1 10-11 24.4 28.275 23.45 23.875 12-13 23.6875 21.825 28.025 26.4625 14-15 24.325 24.025 26.924999999999997 24.725 16-17 24.0375 24.9375 25.825 25.2 18-19 24.125 24.625 24.65 26.6 20-21 24.3 24.474999999999998 25.624999999999996 25.6 22-23 23.525 24.4125 25.7375 26.325 24-25 24.474999999999998 24.625 24.55 26.35 26-27 23.6625 24.25 25.8125 26.275 28-29 24.6625 24.525 24.5125 26.3 30-31 24.2 24.462500000000002 24.9875 26.35 32-33 23.4125 23.9 25.650000000000002 27.037499999999998 34-35 25.2625 23.849999999999998 24.55 26.337500000000002 36-37 24.712500000000002 24.65 24.725 25.912499999999998 38-39 24.4375 24.349999999999998 25.337500000000002 25.874999999999996 40-41 25.174999999999997 24.2 24.6 26.025 42-43 24.4875 24.474999999999998 25.3 25.7375 44-45 24.825 23.825 25.587500000000002 25.7625 46-47 24.975 24.175 25.1875 25.662499999999998 48-49 23.799999999999997 24.15 25.025 27.025 50-51 24.1875 24.125 25.174999999999997 26.5125 52-53 24.087500000000002 24.462500000000002 24.762500000000003 26.687499999999996 54-55 24.349999999999998 24.2625 24.775 26.6125 56-57 23.925 23.8875 25.5625 26.625 58-59 23.775 24.5 25.525 26.200000000000003 60-61 24.212500000000002 24.1125 25.1 26.575 62-63 25.5625 24.075 23.974999999999998 26.387500000000003 64-65 24.675 24.2 25.1 26.025 66-67 25.15 23.8125 24.575 26.4625 68-69 24.375 23.5875 24.8 27.237499999999997 70-71 25.662499999999998 24.575 24.637500000000003 25.124999999999996 72-73 24.95 23.825 24.6875 26.5375 74-75 24.125 24.837500000000002 24.075 26.9625 76-77 24.425 24.85 24.575 26.150000000000002 78-79 24.425 23.525 24.962500000000002 27.0875 80-81 24.0375 24.75 25.7375 25.474999999999998 82-83 25.137500000000003 24.0625 23.599999999999998 27.200000000000003 84-85 24.9875 23.9 24.325 26.787499999999998 86-87 24.7 24.3125 24.762500000000003 26.224999999999998 88-89 25.268817204301076 24.256064016004 24.081020255063766 26.39409852463116 90-91 25.406351587896975 24.10602650662666 23.755938984746187 26.731682920730183 92-93 24.543635908977244 24.718679669917478 25.35633908477119 25.381345336334082 94-95 24.74059257407176 25.378172271533945 23.51543942992874 26.365795724465556 96-97 26.0375 24.712500000000002 22.662499999999998 26.5875 98-99 25.05939727397774 24.84681755658372 24.571714392897338 25.5220707765412 100-101 26.415801975246904 25.065633204150515 24.14051756469559 24.37804725590699 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.0 29 3.0 30 5.0 31 3.5 32 6.5 33 10.5 34 14.5 35 22.0 36 33.5 37 49.0 38 64.5 39 84.0 40 97.0 41 111.5 42 135.0 43 157.5 44 165.5 45 168.0 46 183.5 47 181.5 48 163.5 49 165.5 50 164.5 51 150.5 52 149.5 53 134.5 54 117.5 55 121.0 56 136.5 57 137.5 58 124.5 59 112.5 60 105.5 61 99.5 62 90.5 63 86.5 64 75.5 65 72.0 66 72.0 67 64.5 68 49.0 69 34.0 70 27.5 71 19.0 72 10.0 73 5.5 74 3.5 75 4.5 76 2.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 1.775 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.025 90-91 0.025 92-93 0.025 94-95 0.0125 96-97 0.0 98-99 0.0375 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.8772378516624 95.675 2 1.9948849104859334 3.9 3 0.10230179028132991 0.3 4 0.0 0.0 5 0.025575447570332477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.3 0.0 0.0 0.0 0.0 86-87 1.775 0.0 0.0 0.0 0.0 88-89 2.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609892 READS because READLEN < 1 Read 1609892 spots for SRR11216162.sra Written 1609892 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra Rejected 1609878 READS because READLEN < 1 Read 1609878 spots for SRR11216162.sra Written 1609878 spots for SRR11216162.sra SRR ids: ['SRR11216162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zfweu0_3 SRR11216162.sra spots: 32197574 blocks: [[1, 1609878], [1609879, 3219756], [3219757, 4829634], [4829635, 6439512], [6439513, 8049390], [8049391, 9659268], [9659269, 11269146], [11269147, 12879024], [12879025, 14488902], [14488903, 16098780], [16098781, 17708658], [17708659, 19318536], [19318537, 20928414], [20928415, 22538292], [22538293, 24148170], [24148171, 25758048], [25758049, 27367926], [27367927, 28977804], [28977805, 30587682], [30587683, 32197574]] SRR11216162 file size 7776149 SRR11216162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11216162 SRR11216162_1.fastq Input file: SRR11216162_1.fastq trimmed: SRR11216162-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 08:31:26 2024 >> started Tue Dec 10 08:31:42 2024 >> done (15.834s) 32197574 reads processed; of these: 12949 ( 0.04%) short reads filtered out after trimming by size control 37503 ( 0.12%) empty reads filtered out after trimming by size control 32147122 (99.84%) reads available; of these: 3248502 (10.11%) trimmed reads available after processing 28898620 (89.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 567 0.00% 19 566 0.00% 20 619 0.00% 21 690 0.00% 22 711 0.00% 23 850 0.00% 24 1034 0.00% 25 1168 0.00% 26 1079 0.00% 27 996 0.00% 28 959 0.00% 29 937 0.00% 30 964 0.00% 31 972 0.00% 32 973 0.00% 33 972 0.00% 34 966 0.00% 35 941 0.00% 36 1019 0.00% 37 1109 0.00% 38 1184 0.00% 39 1213 0.00% 40 1224 0.00% 41 1361 0.00% 42 1355 0.00% 43 1401 0.00% 44 1551 0.00% 45 1679 0.01% 46 1734 0.01% 47 1866 0.01% 48 1941 0.01% 49 2173 0.01% 50 2395 0.01% 51 2811 0.01% 52 2759 0.01% 53 3009 0.01% 54 3139 0.01% 55 3315 0.01% 56 3647 0.01% 57 3917 0.01% 58 4335 0.01% 59 4748 0.01% 60 5276 0.02% 61 5929 0.02% 62 6571 0.02% 63 7311 0.02% 64 8122 0.03% 65 8894 0.03% 66 9701 0.03% 67 10887 0.03% 68 12052 0.04% 69 13261 0.04% 70 2639 0.01% 71 3063 0.01% 72 3191 0.01% 73 4825 0.02% 74 3642 0.01% 75 3845 0.01% 76 4279 0.01% 77 4168 0.01% 78 4485 0.01% 79 5538 0.02% 80 5496 0.02% 81 5773 0.02% 82 6383 0.02% 83 8124 0.03% 84 8115 0.03% 85 8992 0.03% 86 11277 0.04% 87 11113 0.03% 88 11520 0.04% 89 13978 0.04% 90 15412 0.05% 91 17726 0.06% 92 20786 0.06% 93 25768 0.08% 94 33223 0.10% 95 42773 0.13% 96 58216 0.18% 97 88152 0.27% 98 145551 0.45% 99 475129 1.48% 100 2036467 6.33% 101 28898620 89.89% 32147122 reads passed initial QC criterion=sequence-density sequence-density=2.20 sequence-density-rank=1 fanout-score=59.60 fanout-score-rank=1 prefix-density=3.02 prefix-fanout=43.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=2.20 sequence-density-rank=1 fanout-score=59.60 fanout-score-rank=1 prefix-density=3.02 prefix-fanout=43.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR11216162 - Input file: STDIN trimmed: SRR11216162-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Tue Dec 10 08:32:44 2024 >> started Tue Dec 10 08:32:58 2024 >> done (13.430s) 10715707 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 10715697 (100.00%) reads available; of these: 854210 ( 7.97%) trimmed reads available after processing 9861487 (92.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 190 0.00% 19 199 0.00% 20 228 0.00% 21 240 0.00% 22 232 0.00% 23 281 0.00% 24 335 0.00% 25 408 0.00% 26 332 0.00% 27 316 0.00% 28 290 0.00% 29 287 0.00% 30 327 0.00% 31 298 0.00% 32 354 0.00% 33 320 0.00% 34 338 0.00% 35 316 0.00% 36 327 0.00% 37 365 0.00% 38 400 0.00% 39 393 0.00% 40 422 0.00% 41 453 0.00% 42 458 0.00% 43 482 0.00% 44 560 0.01% 45 582 0.01% 46 574 0.01% 47 658 0.01% 48 659 0.01% 49 726 0.01% 50 756 0.01% 51 942 0.01% 52 923 0.01% 53 1040 0.01% 54 1030 0.01% 55 1107 0.01% 56 1195 0.01% 57 1301 0.01% 58 1387 0.01% 59 1680 0.02% 60 1749 0.02% 61 1993 0.02% 62 2259 0.02% 63 2422 0.02% 64 2727 0.03% 65 2968 0.03% 66 3274 0.03% 67 3628 0.03% 68 3971 0.04% 69 4465 0.04% 70 5047 0.05% 71 5893 0.05% 72 6447 0.06% 73 7593 0.07% 74 7936 0.07% 75 8786 0.08% 76 9723 0.09% 77 10695 0.10% 78 11403 0.11% 79 13331 0.12% 80 14593 0.14% 81 15995 0.15% 82 17923 0.17% 83 20121 0.19% 84 21767 0.20% 85 23574 0.22% 86 25958 0.24% 87 27336 0.26% 88 30186 0.28% 89 32749 0.31% 90 35097 0.33% 91 39079 0.36% 92 42038 0.39% 93 46325 0.43% 94 52173 0.49% 95 60444 0.56% 96 77439 0.72% 97 115975 1.08% 98 252539 2.36% 99 147254 1.37% 100 636686 5.94% 101 8840425 82.50% criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=6.28 fanout-score-rank=4 prefix-density=1.04 prefix-fanout=4.1 sequence=AGGTTCTCGAGGGGACCCTTGCCGGTGACAATGGCCTGGACGAAGAACCCAAACATGGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=18.80 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.8 sequence=GGATTGACTAATGGTACACACGATTCACGATTCTTCCGTCATTCATTCACTCGTGCACCTCATGCTTAATTACATTGCGCGGGGTTCACTCCACCATGGTACAAATCAACACATAACTAGACAAAGGTACAAGTTGATCTACGGCGTACAAGTACACATGCATGCATATATCGATCGTCCGATGGATGGACCGATATATACTACAGCTAGCTGCTAATTCTCATTTAGCTCCCGGGGGCGAAGTTGGTAGCAAAGGCCCATGCATTGTTGTTGACTGGGTCGGCGACGTGGTCGAAGAGGTTCTCGACGGGTCCCTTGCCCGTGACGATGGC Started job on | Dec 10 08:33:27 Started mapping on | Dec 10 08:33:27 Finished on | Dec 10 08:33:56 Mapping speed, Million of reads per hour | 3990.68 Number of input reads | 32147112 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 30445809 Uniquely mapped reads % | 94.71% Average mapped length | 99.71 Number of splices: Total | 9794818 Number of splices: Annotated (sjdb) | 9275132 Number of splices: GT/AG | 9656525 Number of splices: GC/AG | 119275 Number of splices: AT/AC | 2834 Number of splices: Non-canonical | 16184 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1197148 % of reads mapped to multiple loci | 3.72% Number of reads mapped to too many loci | 360103 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 504155 504155 504155 N_multimapping 1197148 1197148 1197148 N_noFeature 921815 29710839 1094660 N_ambiguous 622520 1751 62912 UnstrandedReadsAssigned:28901474 PositiveStrandReadsAssigned:733219 NegativeStrandReadsAssigned:29288237 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11216162 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11216162-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,147,112 reads, 29,459,129 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,285 rounds 52973 SRR11216162.ke.tsv 35125 SRR11216162.se.tsv 88098 total ==> SRR11216162.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 98.1627 6.09449 PNS24247 1044 945 54.2683 2.98422 PNS24249 1928 1829 38.1854 1.08492 PNS24246 1044 945 54.2683 2.98422 PNS24248 1044 945 54.2683 2.98422 PNS24244 1471 1372 124.847 4.72867 PNS24243 293 194 0 0 KQK14069 1603 1504 10850.8 374.911 KQK14071 474 375 1512.92 209.652 ==> SRR11216162.se.tsv <== BRADI_1g14170v3 14796 BRADI_1g53295v3 17 BRADI_1g59795v3 626 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 310 BRADI_1g74790v3 143 BRADI_1g09890v3 0 BRADI_1g77505v3 436 BRADI_1g48960v3 0 SRR11216162 completed mapping pipeline successfully